Dataset for CDS BAX of Organism Anolis carolinensis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|H9G9C2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Anolis carolinensis GN=BAX (length=741 residues).
atgactggaagaacacagcggcacactggaggatttagagattccaagataggacagattaaattaaatctatgtgtaat
caaatccacagacatcaaaaccagaaatgtgcagggacaaatgtcatctaacatctctgctcacattcagcataaatgct
tgactccatccaaatcagtctgctggaagctcgacccaattctccttctccttttctcttccaggttcataagacagctt
tggcagcaatatagagcttccaatccccaggtgccccccttggaggaaacaaccagggaggacttgtcagtggaaggagc
agaggcctccccagatgctgctgcagtcacgtctctgcaagattgcatgttccgtatatggcaggaactcagcagtaatc
gtgatttgaccagcatggtagaaagtgccactggtaaaaaccctctggaagtcctggctgatgtgtctgaacacctgttt
gctgacgggatcaactggggtcggattgttgtctttttctactttgccttccgagttattgcccagtatacgccaagctg
gttccatgatgtggtgagttgggccatgaccttcctacagaaccacctggctaactggatccaacagcaaggaggctggg
agggcctcctgtcctacttcggcaccccaacttggcaaaccattgctgtatttgcggctggcgtcttgactgcttcgctg
accttctggaaaatgtcttaa
>gnl|bcl2dbcds|H9GPC1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Anolis carolinensis GN=BAX (length=624 residues).
atggcggcagcagcagcggatcccgggagatcgcgggaagctggggccccacctcggaaagcgggcaccagttcagatca
gatccttcagacaggaactgtgcttctgaagggatttatttgggaccgagtgcagagctgtggagactctgaacgcatcc
aggcaacgttggcggagctcaaggaatcagagtctcggatttgtgaccctaagaccaagcagttgagtgagtgcctgcgc
cggattggagatgaactggacggaaatatggagctgcaaagtatgatagaacaagtccaggtgtatccgccaaaggaggt
ttttttcagagtcgctgccgagatgttctctgatgggaccttcaattggggacgagtggtagctttgttctactttgcat
gcaagttggtcctgaaggcaatttgcactaaattaccagagctcataaagaccatcattagctggacaatggagtacatc
aaaaatcatgtcctgacctggatccaagcccagggaggatgggagggcctcctgtcctacttcggcaccccgacttggca
aactattgctgtatttgcggctggtgtcttgactgcctcgctcaccttctggaaaatgtcttaa
© 1998-2023Legal notice