Dataset for CDS BCL-2-like of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

27 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1PPB3_MCL1-01      -atg---actttgagttt---gatgagaagaacagctacgg---------
A0A8C1X8V5_MCL1-01      -atg---actttgagttt---gatgagaagaacagctacgg---------
A0A8C2BAP8_MCL1-02      -atg---actctaagttttgggattaaacgaacggccgcgt---------
A0A8C2BPF9_MCL1-01      -atg---actctaagttttgggattaaacgaacggccgcgt---------
A0A8C1YDY0_MCL1-01      -atg---actctaagttttgggattaaacgaacggccgcgt---------
A0A8C2BAP8_MCL1-01      -atg---actctaagttttgggattaaacgaacggccgcgt---------
A0A8C1S8K5_BCL2-01      -atg---------gcacaggagaat--gtgtatgataaccg---------
A0A8C1IQE4_BCL2-01      -atg---------gcacaggagaat--gtgtatgataaccg---------
A0A8C2KJQ5_BCL2-01      -atg---------gcacaggagaat--gtgtatgataaccg---------
A0A8C2KJQ5_BCL2-02      -atg---------gcacaggagaat--gtgtatgataaccg---------
A0A8C1WYA7_BCL2-01      -atg---------gccaacgaaatt--cgctatgacaatcg---------
X4ZGI8_BCL2-01          -atg---------gccaacgaaatt--cgctatgacaatcg---------
A0A8C2HNY8_BCL2L1-      -atg-----------------------tcttactataaccg---------
A0A8C1JXA4_BCL2L1-      -atg-----------------------tcttactataacag---------
A0A8C2G339_BCL2L1-      gcca-----------------------ttgcaccatccctg---------
A0A8C1Y6A5_MCL1-01      -atg---ttccctgggagtaaagtt--tcaaacgacaacgg-----cttt
A0A8C2BR28_MCL1-01      -atg---ttccctgggagtaaagtt--tcaaacgacaacgg-----cttt
A0A8C2A7Q5_MCL1-04      -atgagtttagctttcagcagggctcctcgaaagactgcgggaaaccgca
A0A8C2KHZ4_MCL1-04      -atgagtttagctttcagcagggctcctcgaaagactgcgggaaaccgca
A0A8C2KHZ4_MCL1-01      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
A0A8C2KHZ4_MCL1-02      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
A0A8C2KHZ4_MCL1-03      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
A0A8C2A7Q5_MCL1-03      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
A0A8C2A7Q5_MCL1-01      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
A0A8C2A7Q5_MCL1-02      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
A0A8C1JUN1_MCL1-01      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
A0A8C1JUN1_MCL1-02      -atg---tttcctgggagtaaagtt--tcaaacgacaacgg-----cctt
                                                       *                  

A0A8C1PPB3_MCL1-01      ------------tgagtctcctc------ggcgcgcacacggcgctcgcg
A0A8C1X8V5_MCL1-01      ------------tgagtctcctc------ggcgcgcacacggcgctcgcg
A0A8C2BAP8_MCL1-02      ------------tgagtgtcttcgcgcaaggcgcgcacacgtcgcttgta
A0A8C2BPF9_MCL1-01      ------------tgagtgtcttcgcgcaaggcgcgcacacgtcgcttgta
A0A8C1YDY0_MCL1-01      ------------tgagtgtcttcgcgcaaggcgcgcacacgtcgcttgta
A0A8C2BAP8_MCL1-01      ------------tgagtgtcttcgcgcaaggcgcgcacacgtcgcttgta
A0A8C1S8K5_BCL2-01      -------------cagtatagt-------ggagaag--------------
A0A8C1IQE4_BCL2-01      -------------cagtatagt-------ggagaag--------------
A0A8C2KJQ5_BCL2-01      -------------cagtatagt-------ggtgaag--------------
A0A8C2KJQ5_BCL2-02      -------------cagtatagt-------ggtgaag--------------
A0A8C1WYA7_BCL2-01      -------------gaatattgt-------ggagaaa--------------
X4ZGI8_BCL2-01          -------------gaatattgt-------ggagaaa--------------
A0A8C2HNY8_BCL2L1-      ----------------agaact-------ggtg-----------------
A0A8C1JXA4_BCL2L1-      ----------------agaact-------ggtg-----------------
A0A8C2G339_BCL2L1-      ----------------agcgtc-------ggcagaagcctgagaaggacg
A0A8C1Y6A5_MCL1-01      tggcc----------atgcatc-------ggaataa---ca---------
A0A8C2BR28_MCL1-01      tggcc----------atgcatc-------ggaataa---ca---------
A0A8C2A7Q5_MCL1-04      tgtccagactgctggatgcaga-------agaggaggatga---------
A0A8C2KHZ4_MCL1-04      tgtccagactgctggatgcaga-------agaggaggatga---------
A0A8C2KHZ4_MCL1-01      tggcc----------atgcatt-------ggaatag---ca---------
A0A8C2KHZ4_MCL1-02      tggcc----------atgcatt-------ggaatag---ca---------
A0A8C2KHZ4_MCL1-03      tggcc----------atgcatt-------ggaatag---ca---------
A0A8C2A7Q5_MCL1-03      tggcc----------atgcatt-------ggaatag---ca---------
A0A8C2A7Q5_MCL1-01      tggcc----------atgcatt-------ggaatag---ca---------
A0A8C2A7Q5_MCL1-02      tggcc----------atgcatt-------ggaatag---ca---------
A0A8C1JUN1_MCL1-01      tggcc----------atgcatt-------ggaatag---ca---------
A0A8C1JUN1_MCL1-02      tggcc----------atgcatt-------ggaatag---ca---------
                                                      *                   

A0A8C1PPB3_MCL1-01      cccgcgcccgcactcaaagcgcggaccgaggacgagctc-----gacggg
A0A8C1X8V5_MCL1-01      cccgcgcccgcactcaaagcgcggaccgaggacgagctc-----gacggg
A0A8C2BAP8_MCL1-02      cccgggcccgcgctcaaaccgcgcacggaggacgagctt-----gacggg
A0A8C2BPF9_MCL1-01      cccgggcccgcgctcaaaccgcgcacggaggacgagctt-----gacggg
A0A8C1YDY0_MCL1-01      cccgggcccgcgctcaaaccgcgcacggaggacgagctt-----gacggg
A0A8C2BAP8_MCL1-01      cccgggcccgcgctcaaaccgcgcacggaggacgagctt-----gacggg
A0A8C1S8K5_BCL2-01      ---------------ta------catccaccataagctctggaagaaggg
A0A8C1IQE4_BCL2-01      ---------------ta------catccaccataagctctggaagaaggg
A0A8C2KJQ5_BCL2-01      ---------------ta------catccaccataagctctggaagaaggg
A0A8C2KJQ5_BCL2-02      ---------------ta------catccaccataagctctggaagaaggg
A0A8C1WYA7_BCL2-01      ---------------ta------cctcaatcacaaactttcaaagaaggg
X4ZGI8_BCL2-01          ---------------ta------cctcaatcacaaactttcaaagaaggg
A0A8C2HNY8_BCL2L1-      ---------gtgttttt------tattaaatacaaactctcgcagaggaa
A0A8C1JXA4_BCL2L1-      ---------gtattttt------tattaaatataaactctcacagaggaa
A0A8C2G339_BCL2L1-      caagggtgtgcactgtg------ttctaagaacaagc-------gagtgg
A0A8C1Y6A5_MCL1-01      ---------gctcttaa------cgtctccagc-agatccag--------
A0A8C2BR28_MCL1-01      ---------gctcttaa------cgtctccagc-agatccag--------
A0A8C2A7Q5_MCL1-04      ---------gttct-----------acaagacc-acctatggaggatttc
A0A8C2KHZ4_MCL1-04      ---------gttct-----------acaagacc-acctatggaggatttc
A0A8C2KHZ4_MCL1-01      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
A0A8C2KHZ4_MCL1-02      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
A0A8C2KHZ4_MCL1-03      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
A0A8C2A7Q5_MCL1-03      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
A0A8C2A7Q5_MCL1-01      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
A0A8C2A7Q5_MCL1-02      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
A0A8C1JUN1_MCL1-01      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
A0A8C1JUN1_MCL1-02      ---------gctcttaa------cgtcaacaac-agctcgagcgggtttg
                                                          *               

A0A8C1PPB3_MCL1-01      tgcgcggatgaaacggacgccgcgatgaagccgttcagaccgggaacgaa
A0A8C1X8V5_MCL1-01      tgcgcggatgaaacggacgccgcgatgaagccgttcagaccgggaacgaa
A0A8C2BAP8_MCL1-02      tacgcggatgacacggacgccgcgctgaagccgccgaggcccgggacgaa
A0A8C2BPF9_MCL1-01      tacgcggatgacacggacgccgcgctgaagccgccgaggcccgggacgaa
A0A8C1YDY0_MCL1-01      tacgcggatgacacggaagccgcgctgaagccgccgaggcccgggacgaa
A0A8C2BAP8_MCL1-01      tacgcggatgacacggacgccgcgctgaagccgccgaggcccgggacgaa
A0A8C1S8K5_BCL2-01      gta-----------------------------------------------
A0A8C1IQE4_BCL2-01      gta-----------------------------------------------
A0A8C2KJQ5_BCL2-01      gta-----------------------------------------------
A0A8C2KJQ5_BCL2-02      gta-----------------------------------------------
A0A8C1WYA7_BCL2-01      ata-----------------------------------------------
X4ZGI8_BCL2-01          ata-----------------------------------------------
A0A8C2HNY8_BCL2L1-      ctacccctaca----accacattgaatttacag--aagacacaaatcgga
A0A8C1JXA4_BCL2L1-      ctacccgtaca----atcacattgaatttacag--aagacacacatcgga
A0A8C2G339_BCL2L1-      atatccagacatcggagaacgacgagcaacgac--aagacacacatcgga
A0A8C1Y6A5_MCL1-01      ----caagcca----cagataatgccagaactg--aaaacccagaacccg
A0A8C2BR28_MCL1-01      ----caagcca----caggtaatgccagaactg--aaaacccagaacccg
A0A8C2A7Q5_MCL1-04      acgacgaatca------ggtgatg-aagaatat--aagg---gtgacttg
A0A8C2KHZ4_MCL1-04      acgacgaatca------ggtgatg-aagaatat--aagg---gtgacttg
A0A8C2KHZ4_MCL1-01      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
A0A8C2KHZ4_MCL1-02      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
A0A8C2KHZ4_MCL1-03      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
A0A8C2A7Q5_MCL1-03      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
A0A8C2A7Q5_MCL1-01      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
A0A8C2A7Q5_MCL1-02      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
A0A8C1JUN1_MCL1-01      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
A0A8C1JUN1_MCL1-02      gtcgcaagcca----ctagtaatgccagaaccg--aaagcccagaacgag
                                                                          

A0A8C1PPB3_MCL1-01      ----cggcctgaaaggactgcatctggacggacgctatgtgtc-------
A0A8C1X8V5_MCL1-01      ----cggcctgaaaggactgcatctggacggacgctatgtgtc-------
A0A8C2BAP8_MCL1-02      ----tggcttgaaagggctgcagctggacgggcggttcgtgtc-------
A0A8C2BPF9_MCL1-01      ----cggcttgaaagggctgcagctggacgggcggttcgtgtc-------
A0A8C1YDY0_MCL1-01      ----cggcttgaaagggctgcagctggacgggcggttcgtgtc-------
A0A8C2BAP8_MCL1-01      ----tggcttgaaagggctgcagctggacgggcggttcgtgtc-------
A0A8C1S8K5_BCL2-01      ----cgtgtgggaagtgaacggacacgatgacagcgtct-----------
A0A8C1IQE4_BCL2-01      ----cgtgtgggaa------------------------------------
A0A8C2KJQ5_BCL2-01      ----cgtgtgggaagtgaacggacacgatgaccgcgtct-----------
A0A8C2KJQ5_BCL2-02      ----cgtgtgggaa------------------------------------
A0A8C1WYA7_BCL2-01      ----tgagtggaaatt----------------------------------
X4ZGI8_BCL2-01          ----tgagtggaaatt----------------------------------
A0A8C2HNY8_BCL2L1-      ctgatgcggcggaagg----------------------------------
A0A8C1JXA4_BCL2L1-      ctgatgcggtggaagg----------------------------------
A0A8C2G339_BCL2L1-      ctgatgcggcggaagg----------------------------------
A0A8C1Y6A5_MCL1-01      tt--tacaaggaacggactccagggctcggtaccatcttcgcc-------
A0A8C2BR28_MCL1-01      tt--tacaaggaacggactccagggctcggtaccatctttgcc-------
A0A8C2A7Q5_MCL1-04      tc--tgaaacggaagat-----gaggtggacagtgactttgacattgatg
A0A8C2KHZ4_MCL1-04      tc--tgaaacggaagat-----gaggtggacagtgactttgacattgatg
A0A8C2KHZ4_MCL1-01      tt--cgcagggaacggtctccagggctcggtaccatcctcgcc-------
A0A8C2KHZ4_MCL1-02      tt--cgcagggaacggtctccagggctcggtaccatcctcgcc-------
A0A8C2KHZ4_MCL1-03      tt--cgcagggaacggtctccagggctcggtaccatcctcgcc-------
A0A8C2A7Q5_MCL1-03      tt--cgcagggaacggtctccagggctcggtaccatcctcgcc-------
A0A8C2A7Q5_MCL1-01      tt--cgcagggaacggtctccagggctcggtaccatcctcgcc-------
A0A8C2A7Q5_MCL1-02      tt--cgcagggaacggtctccagggctcggtaccatcctcgcc-------
A0A8C1JUN1_MCL1-01      tt--cgcagggaacggtctgcagggctcggtaccatcctcgcc-------
A0A8C1JUN1_MCL1-02      tt--cgcagggaacggtctgcagggctcggtaccatcctcgcc-------
                                  * *                                     

A0A8C1PPB3_MCL1-01      -------cgcggcggacgggtctctcccgaacacaccggacccgcaggag
A0A8C1X8V5_MCL1-01      -------cgcggcggacgggtctctcccgaacacaccggacccgcaggag
A0A8C2BAP8_MCL1-02      -------cgcgggggacggctctctaccggccaccccggacccgaaggag
A0A8C2BPF9_MCL1-01      -------cgcgggggacggctctctaccggccaccccggacccaaaggag
A0A8C1YDY0_MCL1-01      -------cgcgggggacggctctctaccggccaccccggacccgaaggag
A0A8C2BAP8_MCL1-01      -------cgcgggggacggctctctaccggccaccccggacccgaaggag
A0A8C1S8K5_BCL2-01      -------cgaatggactgatgatggagaggcagg----------------
A0A8C1IQE4_BCL2-01      ---------------------------------g----------------
A0A8C2KJQ5_BCL2-01      -------cgaatggactgatgatggggaggcagg----------------
A0A8C2KJQ5_BCL2-02      ---------------------------------g----------------
A0A8C1WYA7_BCL2-01      -------tcaatcttccggggagga-------------------------
X4ZGI8_BCL2-01          -------tcaatcttccggggagga-------------------------
A0A8C2HNY8_BCL2L1-      --------gaat--gatgatgaggaggcagcagg------aacgacgacc
A0A8C1JXA4_BCL2L1-      --------gaat--gatgatgaggaggcagcagg------aacaacgacc
A0A8C2G339_BCL2L1-      --------gaat--gatgatgaggaggcagcagg------aaggacgacc
A0A8C1Y6A5_MCL1-01      -------tgagtcggattgcgagaaaacaccagatgaatacacgtctaac
A0A8C2BR28_MCL1-01      -------tgagtcggattgcgagaaaacaccagatgaatacacgtctaac
A0A8C2A7Q5_MCL1-04      aaggggatgaacccgacagcgagcaggaggaggatg-----------ggc
A0A8C2KHZ4_MCL1-04      aaggggatgaacccgacagcgagcaggaggaggatg-----------ggc
A0A8C2KHZ4_MCL1-01      -------tgagtcggactgcgaggaaacagttgatta---------cagc
A0A8C2KHZ4_MCL1-02      -------tgagtcggactgcgaggaaacagttgatta---------cagc
A0A8C2KHZ4_MCL1-03      -------tgagtcggactgcgaggaaacagttgatta---------cagc
A0A8C2A7Q5_MCL1-03      -------tgagtcggactgcgaggaaatagttgatta---------cagc
A0A8C2A7Q5_MCL1-01      -------tgagtcggactgcgaggaaatagttgatta---------cagc
A0A8C2A7Q5_MCL1-02      -------tgagtcggactgcgaggaaatagttgatta---------cagc
A0A8C1JUN1_MCL1-01      -------tgagtcggactgcgaggaaatagttgatta---------cagc
A0A8C1JUN1_MCL1-02      -------tgagtcggactgcgaggaaatagttgatta---------cagc
                                                                          

A0A8C1PPB3_MCL1-01      ttcggttccgccgagctgggtcgcgacacgaggcggcttttactggattt
A0A8C1X8V5_MCL1-01      ttcggttccgccgagctgggtcgcgacacgaggcggcttttactggattt
A0A8C2BAP8_MCL1-02      ctgggttccgtcgagctgcatctggacacgcggcagcttatgttggattt
A0A8C2BPF9_MCL1-01      ctgggttccgtcgagctgcatctggacacgcggcagcttatgttggattt
A0A8C1YDY0_MCL1-01      ctgggttccgtcgagctgcatctggacacgcggcagcttatgttggattt
A0A8C2BAP8_MCL1-01      ctgggttccgtcgagctgcatctggacacgcggcagcttatgttggattt
A0A8C1S8K5_BCL2-01      ----------------------aggaccgcggcggcacccgtcacgaccc
A0A8C1IQE4_BCL2-01      ----------------------aggaccgcggcggcacccgtcacgaccc
A0A8C2KJQ5_BCL2-01      ----------------------aggaccgcggcggcacccgtcacgaccc
A0A8C2KJQ5_BCL2-02      ----------------------aggaccgcggcggcacccgtcacgaccc
A0A8C1WYA7_BCL2-01      -----tgatgacactatcaatacgggagtggaggactcctctccgagctc
X4ZGI8_BCL2-01          -----tgatgacactatcaatacgggagtggaggactcctctccgagctc
A0A8C2HNY8_BCL2L1-      ctcgttaatggatccct-gaacggaacaagtactggttccactgggaccc
A0A8C1JXA4_BCL2L1-      ctcgttaatggctccct-gaacggaacaagtactggttccactgggaccc
A0A8C2G339_BCL2L1-      ctcgttaatggctccct-gaacggaacaagtactggttccactgggaccc
A0A8C1Y6A5_MCL1-01      cgtatctacgacgccctggaaatggacacacgagagat-tattgacattt
A0A8C2BR28_MCL1-01      cgtatctacgacgccctggaaatggacacacgagagat-tattgacattt
A0A8C2A7Q5_MCL1-04      cacgtc-------------------gcaagagc-agag-tggtgac----
A0A8C2KHZ4_MCL1-04      cacgtc-------------------gcaagagc-agag-tggtgac----
A0A8C2KHZ4_MCL1-01      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
A0A8C2KHZ4_MCL1-02      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
A0A8C2KHZ4_MCL1-03      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
A0A8C2A7Q5_MCL1-03      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
A0A8C2A7Q5_MCL1-01      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
A0A8C2A7Q5_MCL1-02      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
A0A8C1JUN1_MCL1-01      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
A0A8C1JUN1_MCL1-02      cccgtctgcgccgctctggaaatggacacgcgcgagat-tattgacattt
                                                                          

A0A8C1PPB3_MCL1-01      ctatcgcacgc-acacgggactgtgtccgcgggaccggaagcagcatcac
A0A8C1X8V5_MCL1-01      ctatcgcacgc-acacgggactgtgtccgcgggaccggaagcagcatcac
A0A8C2BAP8_MCL1-02      ctatcgcacgc-acacgggaatgtgtccgccggaccggaagcgtcatcac
A0A8C2BPF9_MCL1-01      ctatcgcacgc-acacgggaatgtgtccgctggaccggaagcgtcatcac
A0A8C1YDY0_MCL1-01      ctatcgcacgc-acacgggaatgtgtccgccggaccggaagcgtcatcac
A0A8C2BAP8_MCL1-01      ctatcgcacgc-acacgggaatgtgtccgccggaccggaagcgtcatcac
A0A8C1S8K5_BCL2-01      gtgcagcgccctccacacgg------------------------------
A0A8C1IQE4_BCL2-01      gtgcagcgcgcttcataagg------------------------------
A0A8C2KJQ5_BCL2-01      gtgcagcgcgcttcataagg------------------------------
A0A8C2KJQ5_BCL2-02      gtgcagcgcgcttcataagg------------------------------
A0A8C1WYA7_BCL2-01      tgacaggaggctcca---ggctccctcagccggagggggaaacaac----
X4ZGI8_BCL2-01          tgacaggaggctcca---ggctccctcagccggagggggaaacaac----
A0A8C2HNY8_BCL2L1-      caccaaggtcccccgcttcaaccccccagcgtcagacgaacgggactggg
A0A8C1JXA4_BCL2L1-      caccaaggtcccccacttcagccccccagcgtcagacgaacgggactggg
A0A8C2G339_BCL2L1-      caccaaggtcccccacttcagccccccagcgtcagacgaacgggactggg
A0A8C1Y6A5_MCL1-01      tcttaaaaaactttaatggattgcctcattctaaacgtgggaataaacag
A0A8C2BR28_MCL1-01      tcttaaaaaactttactggattgcctcattctaaacgtgggaataaacag
A0A8C2A7Q5_MCL1-04      -----caaagcctacaaggagccagtt------aaagtggtgaggcaaaa
A0A8C2KHZ4_MCL1-04      -----caaagcctacaaggagccagtt------aaagtggtgaggcaaaa
A0A8C2KHZ4_MCL1-01      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C2KHZ4_MCL1-02      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C2KHZ4_MCL1-03      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C2A7Q5_MCL1-03      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C2A7Q5_MCL1-01      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C2A7Q5_MCL1-02      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C1JUN1_MCL1-01      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C1JUN1_MCL1-02      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
                                  *                                       

A0A8C1PPB3_MCL1-01      gcgttaccgac-----aatgactcgcgttg--------------------
A0A8C1X8V5_MCL1-01      gcgttaccgac-----aatgactcgcgttg--------------------
A0A8C2BAP8_MCL1-02      gcgttaccgac-----aatgaggcgcgtcg--------------------
A0A8C2BPF9_MCL1-01      gcgttaccgac-----aatgaggcgcgtcg--------------------
A0A8C1YDY0_MCL1-01      gcgttaccgac-----aatgaggcgcgtcg--------------------
A0A8C2BAP8_MCL1-01      gcgttaccgac-----aatgaggcgcgtcg--------------------
A0A8C1S8K5_BCL2-01      --------tgc---------------------------------------
A0A8C1IQE4_BCL2-01      --------tgc---------------------------------------
A0A8C2KJQ5_BCL2-01      --------tgc---------------------------------------
A0A8C2KJQ5_BCL2-02      --------tgc---------------------------------------
A0A8C1WYA7_BCL2-01      --tctgaatgcctgatagcaaaccgggtcacacgttcagacccttattcg
X4ZGI8_BCL2-01          --tctgaatgcctgatagcaaaccgggtcacacgttcagacccttattcg
A0A8C2HNY8_BCL2L1-      ggtctggacgc-----tgtaaaggaggca-----------c---------
A0A8C1JXA4_BCL2L1-      ggtcttgatgc-----agtaaaggaggcg-----------c---------
A0A8C2G339_BCL2L1-      ggtctggatgc-----agtaaaggaggcg-----------c---------
A0A8C1Y6A5_MCL1-01      gttctggaaac-----gatgaatcgggtt-----------g---------
A0A8C2BR28_MCL1-01      gttctggaaac-----gatgaatcgggtt-----------g---------
A0A8C2A7Q5_MCL1-04      accaaaacaac-----g--gaaactggctgaactgcccagg---------
A0A8C2KHZ4_MCL1-04      accaaaacaac-----g--gaaactggctgaactgcccagg---------
A0A8C2KHZ4_MCL1-01      atcctatctac-----gatgaagcgggtt-----------g---------
A0A8C2KHZ4_MCL1-02      atcctatctac-----gatgaagcgggtt-----------g---------
A0A8C2KHZ4_MCL1-03      atcctatctac-----gatgaagcgggtt-----------g---------
A0A8C2A7Q5_MCL1-03      atcctatctac-----gatgaagcgggtt-----------g---------
A0A8C2A7Q5_MCL1-01      atcctatctac-----gatgaagcgggtt-----------g---------
A0A8C2A7Q5_MCL1-02      atcctatctac-----gatgaagcgggtt-----------g---------
A0A8C1JUN1_MCL1-01      atcctatctac-----gatgaagcgggtt-----------g---------
A0A8C1JUN1_MCL1-02      atcctatctac-----gatgaagcgggtt-----------g---------
                                  *                                       

A0A8C1PPB3_MCL1-01      ----------------tcgcggacattctcctaaagcacgagatcgcgta
A0A8C1X8V5_MCL1-01      ----------------tcgcggacattctcctaaagcacgagatcgcgta
A0A8C2BAP8_MCL1-02      ----------------tcgcggacattctgataaagcaccagatcactta
A0A8C2BPF9_MCL1-01      ----------------tcgcggacattctgataaagcaccagatcactta
A0A8C1YDY0_MCL1-01      ----------------tcgcggacattctgataaagcaccagatcactta
A0A8C2BAP8_MCL1-01      ----------------tcgcggacattctgataaagcaccagatcactta
A0A8C1S8K5_BCL2-01      ----------------tacgggaggctggggacgaactggagcggcttta
A0A8C1IQE4_BCL2-01      ----------------tgcgggaggccggggacgagctggagcggcttta
A0A8C2KJQ5_BCL2-01      ----------------tgcgggaggccggggacgagctggagcggcttta
A0A8C2KJQ5_BCL2-02      ----------------tgcgggaggccggggacgagctggagcggcttta
A0A8C1WYA7_BCL2-01      aggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgta
X4ZGI8_BCL2-01          aggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgta
A0A8C2HNY8_BCL2L1-      ----------------ttcgtgattctgccaacgagtttgagctgcgtta
A0A8C1JXA4_BCL2L1-      ----------------ttcgcgattctgccaacgaatttgagctgcgtta
A0A8C2G339_BCL2L1-      ----------------ttcgcgattctgccaacgaatttgagctgcgtta
A0A8C1Y6A5_MCL1-01      ----------------tggaaagtcttgtggtgaagcacgaactggctta
A0A8C2BR28_MCL1-01      ----------------tggaaagtcttgtggtgaagcacgaactggctta
A0A8C2A7Q5_MCL1-04      ----------------aggacagtc---------aagacaaa--gatcaa
A0A8C2KHZ4_MCL1-04      ----------------aggacagtc---------aagacaaa--gatcaa
A0A8C2KHZ4_MCL1-01      ----------------tggacagtctcgtggtgaagcacgaattggctta
A0A8C2KHZ4_MCL1-02      ----------------tggacagtctcgtggtgaagcacgaattggctta
A0A8C2KHZ4_MCL1-03      ----------------tggacagtctcgtggtgaagcacgaattggctta
A0A8C2A7Q5_MCL1-03      ----------------tggacagtctcgtggtgaagcacgaattggctta
A0A8C2A7Q5_MCL1-01      ----------------tggacagtctcgtggtgaagcacgaattggctta
A0A8C2A7Q5_MCL1-02      ----------------tggacagtctcgtggtgaagcacgaattggctta
A0A8C1JUN1_MCL1-01      ----------------tggacagtctcgtggtgaagcacgaattggctta
A0A8C1JUN1_MCL1-02      ----------------tggacagtctcgtggtgaagcacgaattggctta
                                                          *     *        *

A0A8C1PPB3_MCL1-01      ------------caaaggaatgttgcagcgtctgcag--ctggactctca
A0A8C1X8V5_MCL1-01      ------------caaaggaatgttgcagcgtctgcag--ctggactctca
A0A8C2BAP8_MCL1-02      ------------caaaggaatgttgcagcgtctgcag--ctggactctca
A0A8C2BPF9_MCL1-01      ------------caaaggaatgttgcagcgtctgcag--ctggactctga
A0A8C1YDY0_MCL1-01      ------------caaaggaatgttgcagcgtctgcag--ctggactctca
A0A8C2BAP8_MCL1-01      ------------caaaggaatgttgcagcgtctgcag--ctggactctca
A0A8C1S8K5_BCL2-01      tcagtcggactttgcggagatgtccaaacagctgcat--atcacgtccat
A0A8C1IQE4_BCL2-01      tcagtcggactttgcggagatgtccaaacagctgcat--ctcacgtccat
A0A8C2KJQ5_BCL2-01      tcagtccgactttgcggagatgtccaaacagctgcat--ctcacgtccat
A0A8C2KJQ5_BCL2-02      tcagtccgactttgcggagatgtccaaacagctgcat--ctcacgtccat
A0A8C1WYA7_BCL2-01      ccagcgtgaatttgaggagatgtcccaccagatgaca--ttcagtcccag
X4ZGI8_BCL2-01          ccagcgtgaatttgaggagatgtcccaccagatgaca--ttcagtcccag
A0A8C2HNY8_BCL2L1-      ttcccaagcattcaacgacctgtccttgcagctccac--atcacgcctgc
A0A8C1JXA4_BCL2L1-      ttcccaagcattcaacgacctgtcctcgcagctccac--atcacgcctgc
A0A8C2G339_BCL2L1-      ttcccaagcattcaacgacctgtcctcgcagctccac--atcacgcctgc
A0A8C1Y6A5_MCL1-01      ------------caaaggtatgatcgcacggctgaat--ctggagcaga-
A0A8C2BR28_MCL1-01      ------------caaaggtatgatcgcacggctgaat--ctggagcaga-
A0A8C2A7Q5_MCL1-04      ------------caaataca-----acccccctgaactacaggaggacat
A0A8C2KHZ4_MCL1-04      ------------caaataca-----acccccctgaactacaggaggacat
A0A8C2KHZ4_MCL1-01      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
A0A8C2KHZ4_MCL1-02      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
A0A8C2KHZ4_MCL1-03      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
A0A8C2A7Q5_MCL1-03      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
A0A8C2A7Q5_MCL1-01      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
A0A8C2A7Q5_MCL1-02      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
A0A8C1JUN1_MCL1-01      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
A0A8C1JUN1_MCL1-02      ------------caaaggtatgattgcacggctgaat--ctggaggaga-
                                                    *   *                 

A0A8C1PPB3_MCL1-01      accggacgacatgagct-----------tcatcagctgtatagccaagac
A0A8C1X8V5_MCL1-01      accggacgacatgagct-----------tcatcagctgtatagccaagac
A0A8C2BAP8_MCL1-02      accggacgacatgagct-----------tcatcagctgtatagccaagac
A0A8C2BPF9_MCL1-01      accggacgacatgagct-----------tcatcagctgtatagccaagac
A0A8C1YDY0_MCL1-01      accggacgacatgagct-----------tcatcagctgtatagccaagac
A0A8C2BAP8_MCL1-01      accggacgacatgagct-----------tcatcagctgtatagccaagac
A0A8C1S8K5_BCL2-01      cacggcgcagcagcgct-----------tcaccgcggtcatagacgag--
A0A8C1IQE4_BCL2-01      cacggcgcagcagcgct-----------ttaccgcggtcatagacgag--
A0A8C2KJQ5_BCL2-01      cacggcgcagcagcgct-----------tcaccgcggtcatagacgag--
A0A8C2KJQ5_BCL2-02      cacggcgcagcagcgct-----------tcaccgcggtcatagacgag--
A0A8C1WYA7_BCL2-01      tgcagcacaacgcagct-----------tcttagctgtggctgaagag--
X4ZGI8_BCL2-01          tgcagcacaacgcagct-----------tcttagctgtggctgaagag--
A0A8C2HNY8_BCL2L1-      cacggcgtaccagagct-----------ttgagagcgtaatggatgag--
A0A8C1JXA4_BCL2L1-      cacagcgtaccagagct-----------tcgagagcgtgatggatgag--
A0A8C2G339_BCL2L1-      cacagcgtaccagagct-----------tcgagagcgtgatggatgag--
A0A8C1Y6A5_MCL1-01      ----aaggagaagatgtgagt---tttgttaagactgtggcaacagaa--
A0A8C2BR28_MCL1-01      ----aaggagaagatgtgagt---tttgttaagactgtggcaacagaa--
A0A8C2A7Q5_MCL1-04      caacaagaacaggaagtcggtgcgtcagtcaa--------caacagaa--
A0A8C2KHZ4_MCL1-04      caacaagaacaggaagtcggtgcgtcagtcaa--------caacagaa--
A0A8C2KHZ4_MCL1-01      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
A0A8C2KHZ4_MCL1-02      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
A0A8C2KHZ4_MCL1-03      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
A0A8C2A7Q5_MCL1-03      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
A0A8C2A7Q5_MCL1-01      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
A0A8C2A7Q5_MCL1-02      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
A0A8C1JUN1_MCL1-01      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
A0A8C1JUN1_MCL1-02      ----aaggagaagatgtgagt---tttgtcaagactgtggcaacagag--
                                *       *           *                 *   

A0A8C1PPB3_MCL1-01      catgttcaaggaccacaccacgaactggggccggatc---gtgagtctgg
A0A8C1X8V5_MCL1-01      catgttcaaggaccacaccacgaactggggccggatc---gtgagtctgg
A0A8C2BAP8_MCL1-02      catgttcaaggaccacaccacgaactggggccggatc---gtgagtctgg
A0A8C2BPF9_MCL1-01      catgttcaaggaccacaccacgaactggggccggatc---gtgagtctgg
A0A8C1YDY0_MCL1-01      catgttcaaggaccacaccacgaactggggccggatc---gtgagtctgg
A0A8C2BAP8_MCL1-01      catgttcaaggaccacaccacgaactggggccggatc---gtgagtctgg
A0A8C1S8K5_BCL2-01      -ctgttcagggacggcgtg---aactggggcagaatc---atcgcttttt
A0A8C1IQE4_BCL2-01      -ctgttcagggacggcgtg---aactggggcagaatc---atcgcttttt
A0A8C2KJQ5_BCL2-01      -ctgttcagggacggcgtg---aactggggcagaatc---atcgcttttt
A0A8C2KJQ5_BCL2-02      -ctgttcagggacggcgtg---aactggggcagaatc---atcgcttttt
A0A8C1WYA7_BCL2-01      -ctcttcagagacggagtg---aactgggggcggatc---gtcgctttct
X4ZGI8_BCL2-01          -ctcttcagagacggagtg---aactgggggcggatc---gtcgctttct
A0A8C2HNY8_BCL2L1-      -gtgttccgcgacggtgtc---aactggggccgcatc---gtgggactgt
A0A8C1JXA4_BCL2L1-      -gtgttccgcgacggcgtc---aactggggccgcatc---gtgggactgt
A0A8C2G339_BCL2L1-      -gtgttccgcgacggcgtc---aactggggccgcatc---gtgggactgt
A0A8C1Y6A5_MCL1-01      -ctcttcagcgatggcatcacaaactggggtcgcatt---gccagcctgc
A0A8C2BR28_MCL1-01      -ctcttcagcgatggcatctcaaactggggtcgcatt---gccagcctgc
A0A8C2A7Q5_MCL1-04      -cacacaag-gttgacgt----acctgaggctgcaggagaggcaggttgc
A0A8C2KHZ4_MCL1-04      -cacacaag-gttgacgt----acctgaggctgcaggagaggcaggttgc
A0A8C2KHZ4_MCL1-01      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
A0A8C2KHZ4_MCL1-02      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
A0A8C2KHZ4_MCL1-03      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
A0A8C2A7Q5_MCL1-03      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
A0A8C2A7Q5_MCL1-01      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
A0A8C2A7Q5_MCL1-02      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
A0A8C1JUN1_MCL1-01      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
A0A8C1JUN1_MCL1-02      -ctcttcagcgatggcatcacaaactgggggcgcatt---gccagcctgc
                                  *           * *** **  * *            *  

A0A8C1PPB3_MCL1-01      tggcgttcggagccgtggtgtgcacgcatc-------tgaaggagctgca
A0A8C1X8V5_MCL1-01      tggcgttcggagccgtggtgtgcacgcagc-------tgaaggagctgca
A0A8C2BAP8_MCL1-02      tggcgttcggagccgtggtgtgcacgcagc-------tgaaggagctgca
A0A8C2BPF9_MCL1-01      tggcgttcggagccgtggtgtgcacgcagc-------tgaaggagctgca
A0A8C1YDY0_MCL1-01      tggcgttcggagccgtggtgtgcacgcagc-------tgaaggagctgca
A0A8C2BAP8_MCL1-01      tggcgttcggagccgtggtgtgcacgcagc-------tgaaggagctgca
A0A8C1S8K5_BCL2-01      tcgagtttggagggaccgtttgtg-------------tcgaatgcgtgaa
A0A8C1IQE4_BCL2-01      tcgagtttggagggaccgtttgtg-------------tcgaatgcgtgaa
A0A8C2KJQ5_BCL2-01      tcgagtttggagggaccgtttgtg-------------tcgaatgcgtgaa
A0A8C2KJQ5_BCL2-02      tcgagtttggagggaccgtttgtg-------------tcgaatgcgtgaa
A0A8C1WYA7_BCL2-01      ttgagtttggtgggaccatgtgtg-------------tggagagcttcaa
X4ZGI8_BCL2-01          ttgagtttggtgggaccatgtgtg-------------tggagagcttcaa
A0A8C2HNY8_BCL2L1-      ttgcctttggaggggctctgtgtg-------------ttgagtgcgtgga
A0A8C1JXA4_BCL2L1-      ttgccttcggaggggctctgtgtg-------------ttgagtgcgtgga
A0A8C2G339_BCL2L1-      ttgccttcggaggggctctgtgtg-------------ttgagtgcgtgga
A0A8C1Y6A5_MCL1-01      ttacatttggggcaatggtatgcaagcatcagaaggataaaggacttac-
A0A8C2BR28_MCL1-01      ttacatttggggcaatggtatgcaagcatcagaaggataaaggacttag-
A0A8C2A7Q5_MCL1-04      tccgcgtcgaaggaagggta---------caagacatgagcgacctttga
A0A8C2KHZ4_MCL1-04      tccgcgtcgaaggaagggta---------caagacatgagcgacctttga
A0A8C2KHZ4_MCL1-01      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
A0A8C2KHZ4_MCL1-02      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
A0A8C2KHZ4_MCL1-03      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
A0A8C2A7Q5_MCL1-03      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
A0A8C2A7Q5_MCL1-01      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
A0A8C2A7Q5_MCL1-02      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
A0A8C1JUN1_MCL1-01      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
A0A8C1JUN1_MCL1-02      tgacttttggggccattgtatgcaagcatcaaaatgatagaggacttag-
                        *     * *  *      *                           *   

A0A8C1PPB3_MCL1-01      gagagagcggtg--------tgtggagacggtggccgagcagatctcctc
A0A8C1X8V5_MCL1-01      gagagagcggtg--------cgtggaggcggtggccgagcagatctcctc
A0A8C2BAP8_MCL1-02      gagagagcggtg--------cgtggaggcggtggccgagcagatctcctc
A0A8C2BPF9_MCL1-01      gagagagcggtg--------cgtggaggcggtggccgagcagatctcctc
A0A8C1YDY0_MCL1-01      gagagagcagtg--------cgtggaggcggtggccgagcagatctcctc
A0A8C2BAP8_MCL1-01      gagagagcggtg--------cgtggaggcggtggccgagcagatctcctc
A0A8C1S8K5_BCL2-01      --taaggagatgacggcgcatgtggataacatcgcgggctggatgaccga
A0A8C1IQE4_BCL2-01      --taaggagatgacggcgcatgtggataacatcgcgggctggatgaccga
A0A8C2KJQ5_BCL2-01      --taaggagatgacggcgcatgtggataacatcgcgggctggatgaccga
A0A8C2KJQ5_BCL2-02      --taaggagatgacggcgcatgtggataacatcgcgggctggatgaccga
A0A8C1WYA7_BCL2-01      --ccgggagatggcgtcccaggtagataatattgcacactggatgacaga
X4ZGI8_BCL2-01          --ccgggagatggcgtcccaggtagataatattgcacactggatgacaga
A0A8C2HNY8_BCL2L1-      --gaaagagatgagcccactagtgggaagcatcgcggaatggatgatcgt
A0A8C1JXA4_BCL2L1-      --gaaggagatgagcccgctagtgggaagcatcgcgcattggatgaccgt
A0A8C2G339_BCL2L1-      --gaaggagatgagcccgctagtgggaagcatcgcggattggatgaccgt
A0A8C1Y6A5_MCL1-01      --caattgtgtgagtctggtggggaaagagatctc--------taactac
A0A8C2BR28_MCL1-01      --caattgtgtgagtctggtggggaaagagatctc--------taactac
A0A8C2A7Q5_MCL1-04      cccaagc-tgaacttttagcagaggccaaggtcac---------------
A0A8C2KHZ4_MCL1-04      cccaagc-tgaacttttagcagaggccaaggtcac---------------
A0A8C2KHZ4_MCL1-01      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
A0A8C2KHZ4_MCL1-02      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
A0A8C2KHZ4_MCL1-03      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
A0A8C2A7Q5_MCL1-03      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
A0A8C2A7Q5_MCL1-01      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
A0A8C2A7Q5_MCL1-02      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
A0A8C1JUN1_MCL1-01      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
A0A8C1JUN1_MCL1-02      --caagtgtgtgagtctggtgggggaagagatctc--------ttcctat
                                             *         *  *               

A0A8C1PPB3_MCL1-01      ctatctgatctcagaacagcacgactggctgctcaacaacaa--gagctg
A0A8C1X8V5_MCL1-01      ctatctgatctcagaacagcacgactggctgctcaacaacaa--gagctg
A0A8C2BAP8_MCL1-02      ctatctgatctcagaacagcacgactggctgctcaacaacaa--gagctg
A0A8C2BPF9_MCL1-01      ctatctgatctcagaacagcacgactggctgctcaacaacaa--gagctg
A0A8C1YDY0_MCL1-01      ctatctgatctcagaacagcacgactggctgctcaacaacaa--gagctg
A0A8C2BAP8_MCL1-01      ctatctgatctcagaacagcacgactggctgctcaacaacaa--gagctg
A0A8C1S8K5_BCL2-01      gtatctgaacgggccgctgcacgcctgg--atccaggagaacggcggctg
A0A8C1IQE4_BCL2-01      gtatctgaatgggccgctgcacgcctgg--atccaggagaacggcggctg
A0A8C2KJQ5_BCL2-01      gtatctgaacgggccgctgcacgcctgg--atccaggagaacggcggctg
A0A8C2KJQ5_BCL2-02      gtatctgaacgggccgctgcacgcctgg--atccaggagaacggcggctg
A0A8C1WYA7_BCL2-01      ctacctgaacgggccactggaaaactgg--atcgaggaaaatggaggctg
X4ZGI8_BCL2-01          ctacctgaacgggccactggaaaactgg--atcgaggaaaatggaggctg
A0A8C2HNY8_BCL2L1-      ctacctagacaacaaaattcagccctgg--atccagagccaaggaggatg
A0A8C1JXA4_BCL2L1-      ctacctagacaacaaaattcagccctgg--atccagagccaaggaggatg
A0A8C2G339_BCL2L1-      ctacctagacaacaaaattcagccctgg--atccagagccaaggaggatg
A0A8C1Y6A5_MCL1-01      cttctcacagcccag----cgggactggctgctcaaaaacaa--agcatg
A0A8C2BR28_MCL1-01      cttctcacagcccag----cgggactggctgctcaaaaacaa--agcatg
A0A8C2A7Q5_MCL1-04      ---agcacagattaa----c--cttcgatcactggaaaactatgagcgtt
A0A8C2KHZ4_MCL1-04      ---agcacagattaa----c--cttcgatcactggaaaactatgagcgtt
A0A8C2KHZ4_MCL1-01      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
A0A8C2KHZ4_MCL1-02      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
A0A8C2KHZ4_MCL1-03      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
A0A8C2A7Q5_MCL1-03      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
A0A8C2A7Q5_MCL1-01      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
A0A8C2A7Q5_MCL1-02      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
A0A8C1JUN1_MCL1-01      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
A0A8C1JUN1_MCL1-02      cttctcacagaccaa----cggcactggctgctcaaaaacaa--agcatg
                                                  *                     * 

A0A8C1PPB3_MCL1-01      g---------catggatttgtg---------------------gagtttt
A0A8C1X8V5_MCL1-01      g---------catggatttgtg---------------------gagtttt
A0A8C2BAP8_MCL1-02      ggtgagtgaccacacactcgtgtttccttcactgcgtaactcagagccgt
A0A8C2BPF9_MCL1-01      g---------catggattcgtg---------------------gagtttt
A0A8C1YDY0_MCL1-01      g---------catggattcgtg---------------------gagtttt
A0A8C2BAP8_MCL1-01      g---------catggattcgtg---------------------gagtttt
A0A8C1S8K5_BCL2-01      g---------gaggcgtttgtg---------------------gagctct
A0A8C1IQE4_BCL2-01      g---------gaggcgtttgtg---------------------gagctct
A0A8C2KJQ5_BCL2-01      g---------gaggcgtttgtg---------------------gagctct
A0A8C2KJQ5_BCL2-02      g---------gaggcgtttgtg---------------------gagctct
A0A8C1WYA7_BCL2-01      g---------gatgcctttgtg---------------------gagttat
X4ZGI8_BCL2-01          g---------gacgcctttgtg---------------------gagttat
A0A8C2HNY8_BCL2L1-      g---------gaacgcttcgca---------------------gagatct
A0A8C1JXA4_BCL2L1-      g---------gaacgcttcgcg---------------------gagatct
A0A8C2G339_BCL2L1-      g---------gaacgcttcgcg---------------------gagatct
A0A8C1Y6A5_MCL1-01      g---------gatggctttgtg---------------------gaatttt
A0A8C2BR28_MCL1-01      g---------gatggctttgtg---------------------gaatttt
A0A8C2A7Q5_MCL1-04      t---------ggaggcagataa---------------------gaa----
A0A8C2KHZ4_MCL1-04      t---------ggaggcagataa---------------------gaa----
A0A8C2KHZ4_MCL1-01      g---------gatggcttcgag---------------------gaatttt
A0A8C2KHZ4_MCL1-02      g---------gatggcttcgag---------------------gaatttt
A0A8C2KHZ4_MCL1-03      g---------gatggcttcgag---------------------gaatttt
A0A8C2A7Q5_MCL1-03      g---------gatggcttcgag---------------------gaatttt
A0A8C2A7Q5_MCL1-01      g---------gatggcttcgag---------------------gaatttt
A0A8C2A7Q5_MCL1-02      g---------gatggcttcgag---------------------gaatttt
A0A8C1JUN1_MCL1-01      g---------gatggcttcgag---------------------gaatttt
A0A8C1JUN1_MCL1-02      g---------gatggcttcgag---------------------gaatttt
                                                                   **     

A0A8C1PPB3_MCL1-01      tccgcgtggaggacgtggagtctgt-----ggttcgtaatgcttt----g
A0A8C1X8V5_MCL1-01      tccgcgtggaggacgtggagtctgt-----ggttcgtaatgcttt----g
A0A8C2BAP8_MCL1-02      tctgtgt---gtgtgtggagtccag-----tccattcaacacacg----a
A0A8C2BPF9_MCL1-01      tccgcgtggaggacgtggagtctgt-----ggttcgcagcgctct----g
A0A8C1YDY0_MCL1-01      tccgcgtggaggacgtggagtctgt-----ggttcgcagcgctct----g
A0A8C2BAP8_MCL1-01      tccgcgtggaggacgtggagtctgt-----ggttcgcagcgctct----g
A0A8C1S8K5_BCL2-01      acgg-----------caggcagagggactcggtgtttcgcagctcgt--g
A0A8C1IQE4_BCL2-01      acgg-----------caggcagagggactcggtgtttcgcagctcgt--g
A0A8C2KJQ5_BCL2-01      acgg-----------caggcagagggactctgtgtttcgcagctcgt--g
A0A8C2KJQ5_BCL2-02      acgg-----------caggcagagggactctgtgtttcgcagctcgt--g
A0A8C1WYA7_BCL2-01      acagt----------cagcag-agagactctatgttccacccattgt--c
X4ZGI8_BCL2-01          acagt----------cagcag-agagaccctatgttccacccattgt--c
A0A8C2HNY8_BCL2L1-      t---tggaaaagatgcagcagcaga--------gagcagaaaatcacaag
A0A8C1JXA4_BCL2L1-      t---tggaaaagatgcagcggcaga--------gagcagaaaatcgcaag
A0A8C2G339_BCL2L1-      t---tggaaaagatgcagcggcaga--------gagcagaaaatcgcaag
A0A8C1Y6A5_MCL1-01      ttcgtgtcccagatacagaaggggc-----tgtgagaaacgcatt----g
A0A8C2BR28_MCL1-01      ttcgtgtcccagatacagaaggggc-----tgtgagaaacgcatt----g
A0A8C2A7Q5_MCL1-04      ---acgt--caggttcatatgaagcgtcagtgtgtgggatctgttatccg
A0A8C2KHZ4_MCL1-04      ---acgt--caggttcatatgaagcgtcagtgtgtgggatctgttatccg
A0A8C2KHZ4_MCL1-01      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
A0A8C2KHZ4_MCL1-02      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
A0A8C2KHZ4_MCL1-03      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
A0A8C2A7Q5_MCL1-03      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
A0A8C2A7Q5_MCL1-01      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
A0A8C2A7Q5_MCL1-02      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
A0A8C1JUN1_MCL1-01      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
A0A8C1JUN1_MCL1-02      tccatgtcccggatacagagggagc-----tgtgagaaacgcatt----g
                                                                          

A0A8C1PPB3_MCL1-01      atggctgtagtcg----------gatgcgctggg--atcggcgccggtct
A0A8C1X8V5_MCL1-01      atggctgtagtcg----------gatgcgctggg--atcggcgccggtct
A0A8C2BAP8_MCL1-02      gaaacatgtatca----------gaccgcctgagaaaccactgttaaact
A0A8C2BPF9_MCL1-01      atggctgttgtgg----------gatgtgctggg--atcggcgccggtct
A0A8C1YDY0_MCL1-01      atggctgttgtgg----------gatgtgctggg--attggcgccggtct
A0A8C2BAP8_MCL1-01      atggctgttgtgg----------gatgtgctggg--atcggcgccggtct
A0A8C1S8K5_BCL2-01      gtcatcaatagtaacggtcttcggtctagccgct--ctcggggctgt---
A0A8C1IQE4_BCL2-01      gtcatcaatagtaacggtcttcggtctagccgct--ctcggggctgt---
A0A8C2KJQ5_BCL2-01      gtcatcaatagtaacggtcttcggtctagccgct--ctcggggctgt---
A0A8C2KJQ5_BCL2-02      gtcatcaatagtaacggtcttcggtctagccgct--ctcggggctgt---
A0A8C1WYA7_BCL2-01      gtacctaacgaaa----------gtgcttggatt--ggcagcactaggct
X4ZGI8_BCL2-01          gtacctaacgaaa----------gtgcttggatt--ggcagcactaggct
A0A8C2HNY8_BCL2L1-      aaaacttcaggaa----------gt--ggttgct--ggcgggaataacct
A0A8C1JXA4_BCL2L1-      aaaacttcaagaa----------gt--ggttgct--ggctggaatgacct
A0A8C2G339_BCL2L1-      aaaacttcaagaa----------gt--ggttgct--ggctggaatgacct
A0A8C1Y6A5_MCL1-01      atggccattggta----------gtgtggctaca--ttcggagctgcact
A0A8C2BR28_MCL1-01      atggccattggta----------gtgtggctaca--ttcggagctgcact
A0A8C2A7Q5_MCL1-04      atatcactccgtg----------ctcatgc--ca--ctggtgtctgacgt
A0A8C2KHZ4_MCL1-04      atatcactccgtg----------ctcatgc--ca--ctggtgtctgacgt
A0A8C2KHZ4_MCL1-01      atggccattggta----------gttttgcaaca--ttcggagctgcact
A0A8C2KHZ4_MCL1-02      atggccattggta----------gttttgcaaca--ttcggagctgcact
A0A8C2KHZ4_MCL1-03      atggccattggta----------gttttgcaaca--ttcggagctgcact
A0A8C2A7Q5_MCL1-03      atggccattggta----------gttttgcaaca--ttcggagctgcact
A0A8C2A7Q5_MCL1-01      atggccattggta----------gttttgcaaca--ttcggagctgcact
A0A8C2A7Q5_MCL1-02      atggccattggta----------gttttgcaaca--ttcggagctgcact
A0A8C1JUN1_MCL1-01      atggccattggta----------gttttgcaaca--ttcggagctgcact
A0A8C1JUN1_MCL1-02      atggccattggta----------gttttgcaaca--ttcggagctgcact
                                                                          

A0A8C1PPB3_MCL1-01      cgctt----------------------------------tcctgatccg-
A0A8C1X8V5_MCL1-01      cgctt----------------------------------tcctgatccg-
A0A8C2BAP8_MCL1-02      cacccac-------------------------------gtcttcatcagc
A0A8C2BPF9_MCL1-01      cgctc----------------------------------tcctgatccg-
A0A8C1YDY0_MCL1-01      cgctc----------------------------------tcctgatccg-
A0A8C2BAP8_MCL1-01      cgctc----------------------------------tcctgatccg-
A0A8C1S8K5_BCL2-01      ----------------------------------tggcttgaccatagga
A0A8C1IQE4_BCL2-01      ----------------------------------tggcttgaccatagga
A0A8C2KJQ5_BCL2-01      ----------------------------------tggcttgaccatagga
A0A8C2KJQ5_BCL2-02      ----------------------------------tggcttgaccatagga
A0A8C1WYA7_BCL2-01      tggc------------------------------aggagtgaccatcgga
X4ZGI8_BCL2-01          tggc------------------------------aggagtgaccatcgga
A0A8C2HNY8_BCL2L1-      tgctcac---------------------------gggtgtcgtggtcggg
A0A8C1JXA4_BCL2L1-      tgctcac---------------------------gggtgtcgtggtcggg
A0A8C2G339_BCL2L1-      tgctcac---------------------------gggtgtcgtggtcggg
A0A8C1Y6A5_MCL1-01      tgcttatttgattcgg----------------------------------
A0A8C2BR28_MCL1-01      tgcttatttgattcgg----------------------------------
A0A8C2A7Q5_MCL1-04      cac---tcttaaagaggaaaacgtgga---tgtagagggtttggaccaag
A0A8C2KHZ4_MCL1-04      cac---tcttaaagaggaaaacgtgga---tgtagagggtttggaccaag
A0A8C2KHZ4_MCL1-01      tgcttatttgatacggccatccgtggggtctaatgaggactatggtaatg
A0A8C2KHZ4_MCL1-02      tgcttatttgatacggccatccgtggggtctaatgaggactatggtaatg
A0A8C2KHZ4_MCL1-03      tgcttatttgatacggccatccgtggggtctaatgaggactatggtaatg
A0A8C2A7Q5_MCL1-03      tgcttatttgatacggccatccgtggggtctaatgaggactatggtaatg
A0A8C2A7Q5_MCL1-01      tgcttatttgatacggccatccgtggggtctaatgaggactatggtaatg
A0A8C2A7Q5_MCL1-02      tgcttatttgatacggccatccgtggggtctaatgaggactatggtaatg
A0A8C1JUN1_MCL1-01      tgcttatttgatacggccatccgtggggtctaatgaggactatggtaatg
A0A8C1JUN1_MCL1-02      tgcttatttgatac------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      ccc-----------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      gcctacc-------------------------------------------
A0A8C1IQE4_BCL2-01      gcctacc-------------------------------------------
A0A8C2KJQ5_BCL2-01      gcctacc-------------------------------------------
A0A8C2KJQ5_BCL2-02      gcctacc-------------------------------------------
A0A8C1WYA7_BCL2-01      gcctttt-------------------------------------------
X4ZGI8_BCL2-01          gcctttt-------------------------------------------
A0A8C2HNY8_BCL2L1-      tcactca-------------------------------------------
A0A8C1JXA4_BCL2L1-      tcactca-------------------------------------------
A0A8C2G339_BCL2L1-      tcactca-------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      atgcccaacagaatccaggccctcaccc--ttcacaagctctttcccagt
A0A8C2KHZ4_MCL1-04      atgcccaacagaatccaggccctcaccc--ttcacaagctctttcccagt
A0A8C2KHZ4_MCL1-01      acacaca--------cagggcctcacctgatcctccagctcact------
A0A8C2KHZ4_MCL1-02      acacaca--------cagggcctcacctgatcctccagctcact------
A0A8C2KHZ4_MCL1-03      acacaca--------cagggcctcacctgatcctccagctcact------
A0A8C2A7Q5_MCL1-03      acacaca--------cagggcctcacctgatcctccagctcact------
A0A8C2A7Q5_MCL1-01      acacaca--------cagggcctcacctgatcctccagctcact------
A0A8C2A7Q5_MCL1-02      acacaca--------cagggcctcacctgatcctccagctcact------
A0A8C1JUN1_MCL1-01      acacaca--------cagggcctcacctgatcctccagctcact------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      cagaatcaacccttactgcgcctcctagtgtcttctcttctaacacagct
A0A8C2KHZ4_MCL1-04      cagaatcaacccttactgcgcctcctagtgtcttctcttctaacacagct
A0A8C2KHZ4_MCL1-01      --gtggcagcacctgctgtggttacctgagccaggctgttaaactcagtg
A0A8C2KHZ4_MCL1-02      --gtggcagcacctgctgtggttacctgagccaggctgttaaactcagtg
A0A8C2KHZ4_MCL1-03      --gtggcagcacctgctgtggttacctgagccaggctgttaaactcagtg
A0A8C2A7Q5_MCL1-03      --gtggcagcacctgctgtggttacctgagccaggctgttaaactcagtg
A0A8C2A7Q5_MCL1-01      --gtggcagcacctgctgtggttacctgagccaggctgttaaactcagtg
A0A8C2A7Q5_MCL1-02      --gtggcagcacctgctgtggttacctgagccaggctgttaaactcagtg
A0A8C1JUN1_MCL1-01      --gtggcagcacctgctgtggttacctgagccaggctgttaaactcagtg
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      g-------------------------------------------------
A0A8C2KHZ4_MCL1-04      g-------------------------------------------------
A0A8C2KHZ4_MCL1-01      gaatacaggaatcaggtgatgaagaatataagggtgacttgtctgaaacg
A0A8C2KHZ4_MCL1-02      gaatacagggattg---------------ataagtgagccatctccacaa
A0A8C2KHZ4_MCL1-03      gaatacaggaaaaaagaagtcatgat---gtgagtga-------------
A0A8C2A7Q5_MCL1-03      gaatacaggaaaaaagaagtcatgat---gtgagtga-------------
A0A8C2A7Q5_MCL1-01      gaatacaggaatcaggtgatgaagaatataagggtgacttgtctgaaacg
A0A8C2A7Q5_MCL1-02      gaatacagggattg---------------ataagtgagccatctccacaa
A0A8C1JUN1_MCL1-01      gaatacaggtaaag---------------ccatgtga-------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------ctgtaaacccttccctgtcatcagggcctg------
A0A8C2KHZ4_MCL1-04      --------------ctgtaaacccttccctgtcatcagggcctg------
A0A8C2KHZ4_MCL1-01      gaagatgaggtggacagtgactttgacattgatgaaggggatgaacccga
A0A8C2KHZ4_MCL1-02      gaatcagtctctttcagtgtgactgccctggaaaaaatggtc--------
A0A8C2KHZ4_MCL1-03      -------------gcggtgggctggacat---------------------
A0A8C2A7Q5_MCL1-03      -------------gcggtgggctggacat---------------------
A0A8C2A7Q5_MCL1-01      gaagatgaggtggacagtgactttgacattgatgaaggggatgaacccga
A0A8C2A7Q5_MCL1-02      gaatcagtctctttcagtgtgactgccctggaaaaaatggtc--------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      cagcgagcaggaggaggatgggccacgtcgcaagagcagagtggtgacca
A0A8C2KHZ4_MCL1-02      -------tgcatgcatttttggacgtcacgacatgccaacgtgcaaaaca
A0A8C2KHZ4_MCL1-03      -----------------ctgagacatcacgtcaga---------------
A0A8C2A7Q5_MCL1-03      -----------------ctgagacatcacgtcaga---------------
A0A8C2A7Q5_MCL1-01      cagcgagcaggaggaggatgggccacgtcgcaagagcagagtggtgacca
A0A8C2A7Q5_MCL1-02      -------tgcatgcatttttggacgtcacgacatgccaacgtgcaaaaca
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      -------------------------------ccaaatgctcccgcaccta
A0A8C2KHZ4_MCL1-04      -------------------------------ccaaatgctcccgcaccta
A0A8C2KHZ4_MCL1-01      aagcctacaaggagccagttaaagtggtgaggcaaaaaccaaaacaacgg
A0A8C2KHZ4_MCL1-02      atgaccatggaatgttgcttgcatttctgattaatacagtaggctatctg
A0A8C2KHZ4_MCL1-03      -------------------------------caaaacaggtcaaaacata
A0A8C2A7Q5_MCL1-03      -------------------------------caaaacaggtcaaagcata
A0A8C2A7Q5_MCL1-01      aagcctacaaggagccagttaaagtggtgaggcaaaaaccaaaacaacgg
A0A8C2A7Q5_MCL1-02      atgaccatggaatgttgcttgcatttctgattaatacagtagcctatctg
A0A8C1JUN1_MCL1-01      -------------------------------caacacatgtactaatctg
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      catcacatt-----------------------------------------
A0A8C2KHZ4_MCL1-04      catcacatt-----------------------------------------
A0A8C2KHZ4_MCL1-01      aaactggctgaactgcccaggaggacagtcaagac------aaagatcaa
A0A8C2KHZ4_MCL1-02      aacttttttagggtttcattgtttttttttttttgttttttttttttgac
A0A8C2KHZ4_MCL1-03      agtttggtc-----------------------------------------
A0A8C2A7Q5_MCL1-03      agtttggtc-----------------------------------------
A0A8C2A7Q5_MCL1-01      aaactggctgaactgcccaggaggacagtcaagac------aaagatcaa
A0A8C2A7Q5_MCL1-02      aacttttttagggtttcattgttttttttgttttg------ttttttgac
A0A8C1JUN1_MCL1-01      cacattctt-----------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      caaatacaacccccctgaactacaggaggacatcaacaagaacaggaagt
A0A8C2KHZ4_MCL1-02      caaatgctatgcacaaatgtcattgccagtcattaaaatgatcatcaaat
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      caaatacaacccccctgaactacaggaggacatcaacaagagtgagactt
A0A8C2A7Q5_MCL1-02      caaatgctatgcacaaatgtcattgccaggcattaaaatgatcatcaaat
A0A8C1JUN1_MCL1-01      ---gttctatg---------------------------------------
A0A8C1JUN1_MCL1-02      ----------g---------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      cggtgcgtcagtcaacaacagaacacacaaggttgacgtacctgaggctg
A0A8C2KHZ4_MCL1-02      taat----------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      ttgc----------------------------------------------
A0A8C2A7Q5_MCL1-02      taat----------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      caggagaggcaggttgctccgcgtcgaaggaagggtacaagacatgagcg
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      acctttgacccaagctgaacttttagcagaggccaaggtcacagcacaga
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      ttaaccttcgatcactggaaaactatgagcgtttggaggcagataagaaa
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      cgtcaggttcatatgaagcgtcagtgtgtgggatctgttatccgatatca
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      ctccgtgctcatgccactggtgtctgacgtcactcttaaagaggaaaacg
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      tggatgtagagggtttggaccaagatgcccaacagaatccaggccctcac
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      ccttcacaagctctttcccagtcagaatcaacccttactgcgcctcctag
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-04      --------------------------------------------------
A0A8C2KHZ4_MCL1-01      tgtcttctcttctaacacagctgctgtaaacccttccctgtcatcagggc
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      -------------------------------cagtgatgatgaatccttg
A0A8C2KHZ4_MCL1-04      -------------------------------cagtgatgatgaatccttg
A0A8C2KHZ4_MCL1-01      ctgccaaatgctcccgcacctacatcacattcagtgatgatgaatccttg
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      cagcgtttctttccccagtccccacctcctcgaattcctgtccaggagat
A0A8C2KHZ4_MCL1-04      cagcgtttctttccccagtccccacctcctcgaattcctgtccaggagat
A0A8C2KHZ4_MCL1-01      cagcgtttctttccccagtccccacctcctcgaattcctgtccaggagat
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      ctgccctgttacccataagccagcgctctaccgagaccccatcacagaca
A0A8C2KHZ4_MCL1-04      ctgccctgttacccataagccagcgctctaccgagaccccatcacagaca
A0A8C2KHZ4_MCL1-01      ctgccctgttacccataagccagcgctctaccgagaccccatcacagaca
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      ttccctacgctaatgttcaagcttttaggatcatccgggaagcttataaa
A0A8C2KHZ4_MCL1-04      ttccctacgctaatgttcaagcttttaggatcatccgggaagcttataaa
A0A8C2KHZ4_MCL1-01      ttccctacgctaatgttcaagcttttaggatcatccgggaagcttataaa
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      --------------------------------------------------
A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-01      --------------------------------------------------
A0A8C2KJQ5_BCL2-02      --------------------------------------------------
A0A8C1WYA7_BCL2-01      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C2HNY8_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A8C2G339_BCL2L1-      --------------------------------------------------
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      aagtatgtggcggcccacggcctgccctccactggcacagtgactccagc
A0A8C2KHZ4_MCL1-04      aagtatgtggcggcccacggcctgccctccactggcacagcgactccagc
A0A8C2KHZ4_MCL1-01      aagtatgtggcggcccacggcctgccctccactggcacagcgactccagc
A0A8C2KHZ4_MCL1-02      --------------------------------------------------
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-02      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      --------------------------------------------------
A0A8C1X8V5_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-02      --------------------------------------------------
A0A8C2BPF9_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C2BAP8_MCL1-01      --------------------------------------------------
A0A8C1S8K5_BCL2-01      -----------------------------------ttgctcagaa-----
A0A8C1IQE4_BCL2-01      -----------------------------------ttgctcagaa-----
A0A8C2KJQ5_BCL2-01      -----------------------------------ttgcgcagaa-----
A0A8C2KJQ5_BCL2-02      -----------------------------------ttgcgcagaa-----
A0A8C1WYA7_BCL2-01      -----------------------------------tcgctcagaa-----
X4ZGI8_BCL2-01          -----------------------------------tcgctcagaa-----
A0A8C2HNY8_BCL2L1-      -----------------------------------ttgcacagaaacgcc
A0A8C1JXA4_BCL2L1-      -----------------------------------ttgcacagaaacgcc
A0A8C2G339_BCL2L1-      -----------------------------------ttgcacagaaacgcc
A0A8C1Y6A5_MCL1-01      --------------------------------------------------
A0A8C2BR28_MCL1-01      --------------------------------------------------
A0A8C2A7Q5_MCL1-04      cgacactactgcaaagaatctgcgccagaagatcattattaaacaaggca
A0A8C2KHZ4_MCL1-04      cgacactactgcaaagaatctgcgccagaagatcattattaaacaaggca
A0A8C2KHZ4_MCL1-01      cgacactactgcaaagaatctgcgccagaagatcattattaaacaaggca
A0A8C2KHZ4_MCL1-02      ------------------------------gatattttctaaaa-atata
A0A8C2KHZ4_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-03      --------------------------------------------------
A0A8C2A7Q5_MCL1-01      ------------------------------actttatttacacatgcaca
A0A8C2A7Q5_MCL1-02      ------------------------------gatattttctaaaa---ata
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1PPB3_MCL1-01      -gtga----
A0A8C1X8V5_MCL1-01      -gtga----
A0A8C2BAP8_MCL1-02      -gtga----
A0A8C2BPF9_MCL1-01      -atga----
A0A8C1YDY0_MCL1-01      -atga----
A0A8C2BAP8_MCL1-01      -atga----
A0A8C1S8K5_BCL2-01      -atga----
A0A8C1IQE4_BCL2-01      -atga----
A0A8C2KJQ5_BCL2-01      -atga----
A0A8C2KJQ5_BCL2-02      -atga----
A0A8C1WYA7_BCL2-01      -gtga----
X4ZGI8_BCL2-01          -gtga----
A0A8C2HNY8_BCL2L1-      tgtga----
A0A8C1JXA4_BCL2L1-      tgtga----
A0A8C2G339_BCL2L1-      tgtga----
A0A8C1Y6A5_MCL1-01      --tga----
A0A8C2BR28_MCL1-01      --tga----
A0A8C2A7Q5_MCL1-04      tgtag----
A0A8C2KHZ4_MCL1-04      tgtag----
A0A8C2KHZ4_MCL1-01      tgtag----
A0A8C2KHZ4_MCL1-02      tatgagtaa
A0A8C2KHZ4_MCL1-03      tctga----
A0A8C2A7Q5_MCL1-03      tctga----
A0A8C2A7Q5_MCL1-01      tgtga----
A0A8C2A7Q5_MCL1-02      tataa----
A0A8C1JUN1_MCL1-01      -gtaa----
A0A8C1JUN1_MCL1-02      -gtga----
                          *      

© 1998-2022Legal notice