Dataset for CDS BCL-2-like of organism Cyprinus carpio

[Download (right click)] [Sequences] [Repertoires]

18 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A8C2A7Q5_MCL1-04        atgagttt-agctttc--agcagggctcctcgaaagactgcgggaaaccg
A0A8C2A7Q5_MCL1-02        atgtttcctgggagt---aaagtttcaaac-gacaacggcctttg-----
A0A8C2A7Q5_MCL1-03        atgtttcctgggagt---aaagtttcaaac-gacaacggcctttg-----
A0A8C1JUN1_MCL1-01        atgtttcctgggagt---aaagtttcaaac-gacaacggcctttg-----
A0A8C2A7Q5_MCL1-01        atgtttcctgggagt---aaagtttcaaac-gacaacggcctttg-----
A0A8C1Y6A5_MCL1-01        atgttccctgggagt---aaagtttcaaac-gacaacggcttttg-----
A0A8C1PPB3_MCL1-01        atgacttt-gagttt---gatgagaagaac-agctacggtgagtc-----
A0A8C1X8V5_MCL1-01        atgacttt-gagttt---gatgagaagaac-agctacggtgagtc-----
A0A8C1YDY0_MCL1-01        atgactct-aagttttgggattaaacgaac-ggccgcgttgagtg-----
A0A8C2BAP8_MCL1-01        atgactct-aagttttgggattaaacgaac-ggccgcgttgagtg-----
A0A8C2BAP8_MCL1-02        atgactct-aagttttgggattaaacgaac-ggccgcgttgagtg-----
A0A8C1JXA4_BCL2L1-01      atgtcttac---------------tataacagagaactggtggta-----
A0A8C2HNY8_BCL2L1-01      atgtcttac---------------tataaccgagaactggtggtg-----
A0A8C1WYA7_BCL2-01        atggccaacgaaatt---cgctatgacaatcggaatattgtggag-----
X4ZGI8_BCL2-01            atggccaacgaaatt---cgctatgacaatcggaatattgtggag-----
A0A8C1IQE4_BCL2-01        atggcacaggagaat---gtgtatgataaccgcagtatagtggag-----
A0A8C1S8K5_BCL2-01        atggcacaggagaat---gtgtatgataaccgcagtatagtggag-----
A0A8C1JUN1_MCL1-02        atgtttcctgggagt---aaagtttcaaac-gacaacggcctttg-----
                          ***                                               

A0A8C2A7Q5_MCL1-04        catgtccagactgctggat---gcagaagaggaggatgagttct-----a
A0A8C2A7Q5_MCL1-02        -----------gccat------gcat---tggaatagcagctcttaacgt
A0A8C2A7Q5_MCL1-03        -----------gccat------gcat---tggaatagcagctcttaacgt
A0A8C1JUN1_MCL1-01        -----------gccat------gcat---tggaatagcagctcttaacgt
A0A8C2A7Q5_MCL1-01        -----------gccat------gcat---tggaatagcagctcttaacgt
A0A8C1Y6A5_MCL1-01        -----------gccat------gcat---cggaataacagctcttaacgt
A0A8C1PPB3_MCL1-01        -----------tcctc------ggcg---cgcacacggcgctcgcgcccg
A0A8C1X8V5_MCL1-01        -----------tcctc------ggcg---cgcacacggcgctcgcgcccg
A0A8C1YDY0_MCL1-01        -----------tcttcgcgcaaggcg---cgcacacgtcgcttgtacccg
A0A8C2BAP8_MCL1-01        -----------tcttcgcgcaaggcg---cgcacacgtcgcttgtacccg
A0A8C2BAP8_MCL1-02        -----------tcttcgcgcaaggcg---cgcacacgtcgcttgtacccg
A0A8C1JXA4_BCL2L1-01      -----------ttttt-------ta----ttaaatataaactct------
A0A8C2HNY8_BCL2L1-01      -----------ttttt-------ta----ttaaatacaaactct------
A0A8C1WYA7_BCL2-01        -----------aaata-------cc----tcaatcacaaacttt------
X4ZGI8_BCL2-01            -----------aaata-------cc----tcaatcacaaacttt------
A0A8C1IQE4_BCL2-01        -----------aagta-------ca----tccaccataagctct------
A0A8C1S8K5_BCL2-01        -----------aagta-------ca----tccaccataagctct------
A0A8C1JUN1_MCL1-02        -----------gccat------gcat---tggaatagcagctcttaacgt
                                                          *        *        

A0A8C2A7Q5_MCL1-04        caagaccacctatggaggatttcacgacgaatcaggtgatgaagaatata
A0A8C2A7Q5_MCL1-02        caacaacagc-------------------------------tcgagcggg
A0A8C2A7Q5_MCL1-03        caacaacagc-------------------------------tcgagcggg
A0A8C1JUN1_MCL1-01        caacaacagc-------------------------------tcgagcggg
A0A8C2A7Q5_MCL1-01        caacaacagc-------------------------------tcgagcggg
A0A8C1Y6A5_MCL1-01        ctccagcaga-------------------------------tccag----
A0A8C1PPB3_MCL1-01        cgcccgcact------------caaagcgcg--gaccgaggacgagctcg
A0A8C1X8V5_MCL1-01        cgcccgcact------------caaagcgcg--gaccgaggacgagctcg
A0A8C1YDY0_MCL1-01        ggcccgcgct------------caaaccgcg--cacggaggacgagcttg
A0A8C2BAP8_MCL1-01        ggcccgcgct------------caaaccgcg--cacggaggacgagcttg
A0A8C2BAP8_MCL1-02        ggcccgcgct------------caaaccgcg--cacggaggacgagcttg
A0A8C1JXA4_BCL2L1-01      --------------------------------------------cacaga
A0A8C2HNY8_BCL2L1-01      --------------------------------------------cgcaga
A0A8C1WYA7_BCL2-01        --------------------------------------------caaaga
X4ZGI8_BCL2-01            --------------------------------------------caaaga
A0A8C1IQE4_BCL2-01        --------------------------------------------ggaaga
A0A8C1S8K5_BCL2-01        --------------------------------------------ggaaga
A0A8C1JUN1_MCL1-02        caacaacagc-------------------------------tcgagcggg
                                                                            

A0A8C2A7Q5_MCL1-04        agggtgacttgtctgaaacggaagatgaggtgga----------------
A0A8C2A7Q5_MCL1-02        ttt------------ggtcgcaagccact--------agtaatgccagaa
A0A8C2A7Q5_MCL1-03        ttt------------ggtcgcaagccact--------agtaatgccagaa
A0A8C1JUN1_MCL1-01        ttt------------ggtcgcaagccact--------agtaatgccagaa
A0A8C2A7Q5_MCL1-01        ttt------------ggtcgcaagccact--------agtaatgccagaa
A0A8C1Y6A5_MCL1-01        --------------------caagccaca--------gataatgccagaa
A0A8C1PPB3_MCL1-01        acgggtgcgcggatgaaacggacgccgcgatgaagccgttcagaccggga
A0A8C1X8V5_MCL1-01        acgggtgcgcggatgaaacggacgccgcgatgaagccgttcagaccggga
A0A8C1YDY0_MCL1-01        acgggtacgcggatgacacggaagccgcgctgaagccgccgaggcccggg
A0A8C2BAP8_MCL1-01        acgggtacgcggatgacacggacgccgcgctgaagccgccgaggcccggg
A0A8C2BAP8_MCL1-02        acgggtacgcggatgacacggacgccgcgctgaagccgccgaggcccggg
A0A8C1JXA4_BCL2L1-01      ggaact--------------------------------------------
A0A8C2HNY8_BCL2L1-01      ggaact--------------------------------------------
A0A8C1WYA7_BCL2-01        agggat--------------------------------------------
X4ZGI8_BCL2-01            agggat--------------------------------------------
A0A8C1IQE4_BCL2-01        aggggt--------------------------------------------
A0A8C1S8K5_BCL2-01        aggggt--------------------------------------------
A0A8C1JUN1_MCL1-02        ttt------------ggtcgcaagccact--------agtaatgccagaa
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        ccgaaagcccagaacgagttcgca---gggaacggtctccagggctcggt
A0A8C2A7Q5_MCL1-03        ccgaaagcccagaacgagttcgca---gggaacggtctccagggctcggt
A0A8C1JUN1_MCL1-01        ccgaaagcccagaacgagttcgca---gggaacggtctgcagggctcggt
A0A8C2A7Q5_MCL1-01        ccgaaagcccagaacgagttcgca---gggaacggtctccagggctcggt
A0A8C1Y6A5_MCL1-01        ctgaaaacccagaacccgtttaca---aggaacggactccagggctcggt
A0A8C1PPB3_MCL1-01        acgaacggcctgaaaggactgcat---ctggacggacgctatgtgtccgc
A0A8C1X8V5_MCL1-01        acgaacggcctgaaaggactgcat---ctggacggacgctatgtgtccgc
A0A8C1YDY0_MCL1-01        acgaacggcttgaaagggctgcag---ctggacgggcggttcgtgtccgc
A0A8C2BAP8_MCL1-01        acgaatggcttgaaagggctgcag---ctggacgggcggttcgtgtccgc
A0A8C2BAP8_MCL1-02        acgaatggcttgaaagggctgcag---ctggacgggcggttcgtgtccgc
A0A8C1JXA4_BCL2L1-01      -------------acccgtacaatcacattgaattt------------ac
A0A8C2HNY8_BCL2L1-01      -------------acccctacaaccacattgaattt------------ac
A0A8C1WYA7_BCL2-01        -------------atgagtggaaa---tttcaatct------------tc
X4ZGI8_BCL2-01            -------------atgagtggaaa---tttcaatct------------tc
A0A8C1IQE4_BCL2-01        -------------acgtgtgggaa---gag--------------------
A0A8C1S8K5_BCL2-01        -------------acgtgtgggaa---gtgaacgga--------------
A0A8C1JUN1_MCL1-02        ccgaaagcccagaacgagttcgca---gggaacggtctgcagggctcggt
                                                                            

A0A8C2A7Q5_MCL1-04        ---------cagtgactttgacattgatgaaggggat-------------
A0A8C2A7Q5_MCL1-02        accatcctcgcctgagtcggactgcgaggaaatagttgattac-------
A0A8C2A7Q5_MCL1-03        accatcctcgcctgagtcggactgcgaggaaatagttgattac-------
A0A8C1JUN1_MCL1-01        accatcctcgcctgagtcggactgcgaggaaatagttgattac-------
A0A8C2A7Q5_MCL1-01        accatcctcgcctgagtcggactgcgaggaaatagttgattac-------
A0A8C1Y6A5_MCL1-01        accatcttcgcctgagtcggattgcgagaaaacaccagatgaatacacgt
A0A8C1PPB3_MCL1-01        ggcggacgggtctctcccgaacacaccggacccgcag-------------
A0A8C1X8V5_MCL1-01        ggcggacgggtctctcccgaacacaccggacccgcag-------------
A0A8C1YDY0_MCL1-01        gggggacggctctctaccggccaccccggacccgaag-------------
A0A8C2BAP8_MCL1-01        gggggacggctctctaccggccaccccggacccgaag-------------
A0A8C2BAP8_MCL1-02        gggggacggctctctaccggccaccccggacccgaag-------------
A0A8C1JXA4_BCL2L1-01      agaagacacacatcggactgatgcggtggaagggaat-------------
A0A8C2HNY8_BCL2L1-01      agaagacacaaatcggactgatgcggcggaagggaat-------------
A0A8C1WYA7_BCL2-01        cggggaggatgatgacactatcaatacgggagtggag-------------
X4ZGI8_BCL2-01            cggggaggatgatgacactatcaatacgggagtggag-------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        -------cacgatgacagcgtctcgaatggactgatg-------------
A0A8C1JUN1_MCL1-02        accatcctcgcctgagtcggactgcgaggaaatagttgattac-------
                                                                            

A0A8C2A7Q5_MCL1-04        --gaacccga----cagcgagcaggaggaggatgggccacgtcgca----
A0A8C2A7Q5_MCL1-02        --agc-cccgtctgcgccgctctggaa--atggacacgcgcgagattatt
A0A8C2A7Q5_MCL1-03        --agc-cccgtctgcgccgctctggaa--atggacacgcgcgagattatt
A0A8C1JUN1_MCL1-01        --agc-cccgtctgcgccgctctggaa--atggacacgcgcgagattatt
A0A8C2A7Q5_MCL1-01        --agc-cccgtctgcgccgctctggaa--atggacacgcgcgagattatt
A0A8C1Y6A5_MCL1-01        ctaac-cgtatctacgacgccctggaa--atggacacacgagagattatt
A0A8C1PPB3_MCL1-01        --gag-ttcggttccgccgagctgggt--cgcgacacgaggcggctttta
A0A8C1X8V5_MCL1-01        --gag-ttcggttccgccgagctgggt--cgcgacacgaggcggctttta
A0A8C1YDY0_MCL1-01        --gag-ctgggttccgtcgagctgcat--ctggacacgcggcagcttatg
A0A8C2BAP8_MCL1-01        --gag-ctgggttccgtcgagctgcat--ctggacacgcggcagcttatg
A0A8C2BAP8_MCL1-02        --gag-ctgggttccgtcgagctgcat--ctggacacgcggcagcttatg
A0A8C1JXA4_BCL2L1-01      --gat-gatg----aggaggcagcaggaacaacgaccctcgttaat----
A0A8C2HNY8_BCL2L1-01      --gat-gatg----aggaggcagcaggaacgacgaccctcgttaat----
A0A8C1WYA7_BCL2-01        --gac-tcct----ctccgagctctgacaggaggctccaggctccc----
X4ZGI8_BCL2-01            --gac-tcct----ctccgagctctgacaggaggctccaggctccc----
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        ---------------at---------------------------------
A0A8C1JUN1_MCL1-02        --agc-cccgtctgcgccgctctggaa--atggacacgcgcgagattatt
                                                                            

A0A8C2A7Q5_MCL1-04        -------agagcagagtggtgaccaaagcctacaaggagccagttaaagt
A0A8C2A7Q5_MCL1-02        gacattttcttaaaaagcttcacaggac----------------------
A0A8C2A7Q5_MCL1-03        gacattttcttaaaaagcttcacaggac----------------------
A0A8C1JUN1_MCL1-01        gacattttcttaaaaagcttcacaggac----------------------
A0A8C2A7Q5_MCL1-01        gacattttcttaaaaagcttcacaggac----------------------
A0A8C1Y6A5_MCL1-01        gacattttcttaaaaaactttaatggat----------------------
A0A8C1PPB3_MCL1-01        ctggatttctatcgcacgcacacgggac----------------------
A0A8C1X8V5_MCL1-01        ctggatttctatcgcacgcacacgggac----------------------
A0A8C1YDY0_MCL1-01        ttggatttctatcgcacgcacacgggaa----------------------
A0A8C2BAP8_MCL1-01        ttggatttctatcgcacgcacacgggaa----------------------
A0A8C2BAP8_MCL1-02        ttggatttctatcgcacgcacacgggaa----------------------
A0A8C1JXA4_BCL2L1-01      -------ggctccctgaacggaacaagt----------------------
A0A8C2HNY8_BCL2L1-01      -------ggatccctgaacggaacaagt----------------------
A0A8C1WYA7_BCL2-01        -------tcagccggagggggaaacaac----------------------
X4ZGI8_BCL2-01            -------tcagccggagggggaaacaac----------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        gacattttcttaaaaagcttcacaggac----------------------
                                                                            

A0A8C2A7Q5_MCL1-04        ggtgaggcaaaaaccaaaacaacggaaactggctgaactgcccaggagga
A0A8C2A7Q5_MCL1-02        ---------------------------tccctcat-tctaa---------
A0A8C2A7Q5_MCL1-03        ---------------------------tccctcat-tctaa---------
A0A8C1JUN1_MCL1-01        ---------------------------tccctcat-tctaa---------
A0A8C2A7Q5_MCL1-01        ---------------------------tccctcat-tctaa---------
A0A8C1Y6A5_MCL1-01        ---------------------------tgcctcat-tctaa---------
A0A8C1PPB3_MCL1-01        ---------------------------tgtgtccg-cggga---------
A0A8C1X8V5_MCL1-01        ---------------------------tgtgtccg-cggga---------
A0A8C1YDY0_MCL1-01        ---------------------------tgtgtccg-ccgga---------
A0A8C2BAP8_MCL1-01        ---------------------------tgtgtccg-ccgga---------
A0A8C2BAP8_MCL1-02        ---------------------------tgtgtccg-ccgga---------
A0A8C1JXA4_BCL2L1-01      ---------------------------actggttccactgg---------
A0A8C2HNY8_BCL2L1-01      ---------------------------actggttccactgg---------
A0A8C1WYA7_BCL2-01        ---------------------------tctgaatg-cctga---------
X4ZGI8_BCL2-01            ---------------------------tctgaatg-cctga---------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        -----------------------------ggagag-gcagg---------
A0A8C1JUN1_MCL1-02        ---------------------------tccctcat-tctaa---------
                                                                            

A0A8C2A7Q5_MCL1-04        cagtcaagacaaagatcaacaaatacaacccccctgaactacaggaggac
A0A8C2A7Q5_MCL1-02        --aagtg-gaaaaaaacagatcctatctacgatgaagc------------
A0A8C2A7Q5_MCL1-03        --aagtg-gaaaaaaacagatcctatctacgatgaagc------------
A0A8C1JUN1_MCL1-01        --aagtg-gaaaaaaacagatcctatctacgatgaagc------------
A0A8C2A7Q5_MCL1-01        --aagtg-gaaaaaaacagatcctatctacgatgaagc------------
A0A8C1Y6A5_MCL1-01        --acgtg-ggaataaacaggttctggaaacgatgaatc------------
A0A8C1PPB3_MCL1-01        --ccgga-agcagcatcacgcgttaccgacaatgactc------------
A0A8C1X8V5_MCL1-01        --ccgga-agcagcatcacgcgttaccgacaatgactc------------
A0A8C1YDY0_MCL1-01        --ccgga-agcgtcatcacgcgttaccgacaatgaggc------------
A0A8C2BAP8_MCL1-01        --ccgga-agcgtcatcacgcgttaccgacaatgaggc------------
A0A8C2BAP8_MCL1-02        --ccgga-agcgtcatcacgcgttaccgacaatgaggc------------
A0A8C1JXA4_BCL2L1-01      --gaccccaccaaggtcccccacttcagccccccagcgtcagacg-----
A0A8C2HNY8_BCL2L1-01      --gaccccaccaaggtcccccgcttcaaccccccagcgtcagacg-----
A0A8C1WYA7_BCL2-01        --tagca-aaccgggtcacacgtt-cagacccttattc------------
X4ZGI8_BCL2-01            --tagca-aaccgggtcacacgtt-cagacccttattc------------
A0A8C1IQE4_BCL2-01        ----gac-cgcggcggcacccgtc-acgacccgtgcag------------
A0A8C1S8K5_BCL2-01        --aggac-cgcggcggcacccgtc-acgacccgtgcag------------
A0A8C1JUN1_MCL1-02        --aagtg-gaaaaaaacagatcctatctacgatgaagc------------
                                          *            *                    

A0A8C2A7Q5_MCL1-04        atcaacaagaacaggaagtcggtgcgtcagtcaacaacagaacacacaag
A0A8C2A7Q5_MCL1-02        --------------------------------------------------
A0A8C2A7Q5_MCL1-03        --------------------------------------------------
A0A8C1JUN1_MCL1-01        --------------------------------------------------
A0A8C2A7Q5_MCL1-01        --------------------------------------------------
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------aacggg
A0A8C2HNY8_BCL2L1-01      --------------------------------------------aacggg
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        gttgacgtacctgaggctgcaggagaggcaggttgctccgcgtcgaagga
A0A8C2A7Q5_MCL1-02        --------------gggt-----------------------tgtggacag
A0A8C2A7Q5_MCL1-03        --------------gggt-----------------------tgtggacag
A0A8C1JUN1_MCL1-01        --------------gggt-----------------------tgtggacag
A0A8C2A7Q5_MCL1-01        --------------gggt-----------------------tgtggacag
A0A8C1Y6A5_MCL1-01        --------------gggt-----------------------tgtggaaag
A0A8C1PPB3_MCL1-01        --------------gcgt-----------------------tgtcgcgga
A0A8C1X8V5_MCL1-01        --------------gcgt-----------------------tgtcgcgga
A0A8C1YDY0_MCL1-01        --------------gcgt-----------------------cgtcgcgga
A0A8C2BAP8_MCL1-01        --------------gcgt-----------------------cgtcgcgga
A0A8C2BAP8_MCL1-02        --------------gcgt-----------------------cgtcgcgga
A0A8C1JXA4_BCL2L1-01      actgggggtcttgatgcagtaaaggaggcgcttcgcgattctgccaacga
A0A8C2HNY8_BCL2L1-01      actgggggtctggacgctgtaaaggaggcacttcgtgattctgccaacga
A0A8C1WYA7_BCL2-01        --------------gaggatctaccgatcgttacgcgaggctggagacca
X4ZGI8_BCL2-01            --------------gaggatctaccgatcgttacgcgaggctggagacca
A0A8C1IQE4_BCL2-01        --------------cgcgcttcataaggtgctgcgggaggccggggacga
A0A8C1S8K5_BCL2-01        --------------cgccctccacacggtgctacgggaggctggggacga
A0A8C1JUN1_MCL1-02        --------------gggt-----------------------tgtggacag
                                                                            

A0A8C2A7Q5_MCL1-04        ag----ggt---------acaagacatgagcgacctttgacccaagctga
A0A8C2A7Q5_MCL1-02        tctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctga
A0A8C2A7Q5_MCL1-03        tctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctga
A0A8C1JUN1_MCL1-01        tctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctga
A0A8C2A7Q5_MCL1-01        tctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctga
A0A8C1Y6A5_MCL1-01        tcttgtggtgaagcacgaactggcttacaaaggtatgatcgcacggctga
A0A8C1PPB3_MCL1-01        cattctcctaaagcacgagatcgcgtacaaaggaatgttgcagcgtctgc
A0A8C1X8V5_MCL1-01        cattctcctaaagcacgagatcgcgtacaaaggaatgttgcagcgtctgc
A0A8C1YDY0_MCL1-01        cattctgataaagcaccagatcacttacaaaggaatgttgcagcgtctgc
A0A8C2BAP8_MCL1-01        cattctgataaagcaccagatcacttacaaaggaatgttgcagcgtctgc
A0A8C2BAP8_MCL1-02        cattctgataaagcaccagatcacttacaaaggaatgttgcagcgtctgc
A0A8C1JXA4_BCL2L1-01      atttgagctgcgttattcccaagcattcaacgacctgtcctcgcagctcc
A0A8C2HNY8_BCL2L1-01      gtttgagctgcgttattcccaagcattcaacgacctgtccttgcagctcc
A0A8C1WYA7_BCL2-01        gatagaaaggatgtaccagcgtgaatttgaggagatgtcccaccagatga
X4ZGI8_BCL2-01            gatagaaaggatgtaccagcgtgaatttgaggagatgtcccaccagatga
A0A8C1IQE4_BCL2-01        gctggagcggctttatcagtcggactttgcggagatgtccaaacagctgc
A0A8C1S8K5_BCL2-01        actggagcggctttatcagtcggactttgcggagatgtccaaacagctgc
A0A8C1JUN1_MCL1-02        tctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctga
                                                         *   *           *  

A0A8C2A7Q5_MCL1-04        acttttagcagaggccaaggtcacagcacagattaaccttcgatcactgg
A0A8C2A7Q5_MCL1-02        atctggaggag---------aaaggagaagatgtgagttttgtcaagact
A0A8C2A7Q5_MCL1-03        atctggaggag---------aaaggagaagatgtgagttttgtcaagact
A0A8C1JUN1_MCL1-01        atctggaggag---------aaaggagaagatgtgagttttgtcaagact
A0A8C2A7Q5_MCL1-01        atctggaggag---------aaaggagaagatgtgagttttgtcaagact
A0A8C1Y6A5_MCL1-01        atctggagcag---------aaaggagaagatgtgagttttgttaagact
A0A8C1PPB3_MCL1-01        agctggactct---------caaccggacgacatgagcttcatcagctgt
A0A8C1X8V5_MCL1-01        agctggactct---------caaccggacgacatgagcttcatcagctgt
A0A8C1YDY0_MCL1-01        agctggactct---------caaccggacgacatgagcttcatcagctgt
A0A8C2BAP8_MCL1-01        agctggactct---------caaccggacgacatgagcttcatcagctgt
A0A8C2BAP8_MCL1-02        agctggactct---------caaccggacgacatgagcttcatcagctgt
A0A8C1JXA4_BCL2L1-01      acatcacgcct---------gccacagcgtaccagagcttcgag---agc
A0A8C2HNY8_BCL2L1-01      acatcacgcct---------gccacggcgtaccagagctttgag---agc
A0A8C1WYA7_BCL2-01        cattcagtccc---------agtgcagcacaacgcagcttctta---gct
X4ZGI8_BCL2-01            cattcagtccc---------agtgcagcacaacgcagcttctta---gct
A0A8C1IQE4_BCL2-01        atctcacgtcc---------atcacggcgcagcagcgctttacc---gcg
A0A8C1S8K5_BCL2-01        atatcacgtcc---------atcacggcgcagcagcgcttcacc---gcg
A0A8C1JUN1_MCL1-02        atctggaggag---------aaaggagaagatgtgagttttgtcaagact
                             *                                  **          

A0A8C2A7Q5_MCL1-04        aaaactatgagcgtttggaggcagataagaaacgtcaggt---tcatatg
A0A8C2A7Q5_MCL1-02        gtggcaacagag------------ctcttcagcgatggcatcacaaactg
A0A8C2A7Q5_MCL1-03        gtggcaacagag------------ctcttcagcgatggcatcacaaactg
A0A8C1JUN1_MCL1-01        gtggcaacagag------------ctcttcagcgatggcatcacaaactg
A0A8C2A7Q5_MCL1-01        gtggcaacagag------------ctcttcagcgatggcatcacaaactg
A0A8C1Y6A5_MCL1-01        gtggcaacagaa------------ctcttcagcgatggcatcacaaactg
A0A8C1PPB3_MCL1-01        atagccaagacc------------atgttcaaggaccacaccacgaactg
A0A8C1X8V5_MCL1-01        atagccaagacc------------atgttcaaggaccacaccacgaactg
A0A8C1YDY0_MCL1-01        atagccaagacc------------atgttcaaggaccacaccacgaactg
A0A8C2BAP8_MCL1-01        atagccaagacc------------atgttcaaggaccacaccacgaactg
A0A8C2BAP8_MCL1-02        atagccaagacc------------atgttcaaggaccacaccacgaactg
A0A8C1JXA4_BCL2L1-01      gtgatggatgag------------gtgttccgcgacggcg---tcaactg
A0A8C2HNY8_BCL2L1-01      gtaatggatgag------------gtgttccgcgacggtg---tcaactg
A0A8C1WYA7_BCL2-01        gtggctgaagag------------ctcttcagagacggag---tgaactg
X4ZGI8_BCL2-01            gtggctgaagag------------ctcttcagagacggag---tgaactg
A0A8C1IQE4_BCL2-01        gtcatagacgag------------ctgttcagggacggcg---tgaactg
A0A8C1S8K5_BCL2-01        gtcatagacgag------------ctgttcagggacggcg---tgaactg
A0A8C1JUN1_MCL1-02        gtggcaacagag------------ctcttcagcgatggcatcacaaactg
                                                   *       *           *  **

A0A8C2A7Q5_MCL1-04        aagcgtcagtgtgtgggatctgttatccgatatcactccgtgctcatgcc
A0A8C2A7Q5_MCL1-02        ggggcgcattgccagcctgctgacttttgg----------------ggcc
A0A8C2A7Q5_MCL1-03        ggggcgcattgccagcctgctgacttttgg----------------ggcc
A0A8C1JUN1_MCL1-01        ggggcgcattgccagcctgctgacttttgg----------------ggcc
A0A8C2A7Q5_MCL1-01        ggggcgcattgccagcctgctgacttttgg----------------ggcc
A0A8C1Y6A5_MCL1-01        gggtcgcattgccagcctgcttacatttgg----------------ggca
A0A8C1PPB3_MCL1-01        gggccggatcgtgagtctggtggcgttcgg----------------agcc
A0A8C1X8V5_MCL1-01        gggccggatcgtgagtctggtggcgttcgg----------------agcc
A0A8C1YDY0_MCL1-01        gggccggatcgtgagtctggtggcgttcgg----------------agcc
A0A8C2BAP8_MCL1-01        gggccggatcgtgagtctggtggcgttcgg----------------agcc
A0A8C2BAP8_MCL1-02        gggccggatcgtgagtctggtggcgttcgg----------------agcc
A0A8C1JXA4_BCL2L1-01      gggccgcatcgtgggactgtttgccttcgg----------------aggg
A0A8C2HNY8_BCL2L1-01      gggccgcatcgtgggactgtttgcctttgg----------------aggg
A0A8C1WYA7_BCL2-01        ggggcggatcgtcgctttctttgagtttgg----------------tggg
X4ZGI8_BCL2-01            ggggcggatcgtcgctttctttgagtttgg----------------tggg
A0A8C1IQE4_BCL2-01        gggcagaatcatcgcttttttcgagtttgg----------------aggg
A0A8C1S8K5_BCL2-01        gggcagaatcatcgcttttttcgagtttgg----------------aggg
A0A8C1JUN1_MCL1-02        ggggcgcattgccagcctgctgacttttgg----------------ggcc
                            *    *            *    *  *                  *  

A0A8C2A7Q5_MCL1-04        actggtgtctgacgtcactcttaaagaggaaaacgtggatgtagagggtt
A0A8C2A7Q5_MCL1-02        --------------------------------------------------
A0A8C2A7Q5_MCL1-03        --------------------------------------------------
A0A8C1JUN1_MCL1-01        --------------------------------------------------
A0A8C2A7Q5_MCL1-01        --------------------------------------------------
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        tggaccaagatgcccaacagaatccaggccctcacccttcacaagctctt
A0A8C2A7Q5_MCL1-02        --------------------------------------------------
A0A8C2A7Q5_MCL1-03        --------------------------------------------------
A0A8C1JUN1_MCL1-01        --------------------------------------------------
A0A8C2A7Q5_MCL1-01        --------------------------------------------------
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        tcccagtcagaatcaacccttactgcgcctcctagtgtcttctcttctaa
A0A8C2A7Q5_MCL1-02        --------------------------------------------------
A0A8C2A7Q5_MCL1-03        --------------------------------------------------
A0A8C1JUN1_MCL1-01        --------------------------------------------------
A0A8C2A7Q5_MCL1-01        --------------------------------------------------
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        cacagctgctgtaaacccttccctgtcatcagggcctgccaaatgctccc
A0A8C2A7Q5_MCL1-02        ---------------------------------------attgtatgcaa
A0A8C2A7Q5_MCL1-03        ---------------------------------------attgtatgcaa
A0A8C1JUN1_MCL1-01        ---------------------------------------attgtatgcaa
A0A8C2A7Q5_MCL1-01        ---------------------------------------attgtatgcaa
A0A8C1Y6A5_MCL1-01        ---------------------------------------atggtatgcaa
A0A8C1PPB3_MCL1-01        ---------------------------------------gtggtgtgcac
A0A8C1X8V5_MCL1-01        ---------------------------------------gtggtgtgcac
A0A8C1YDY0_MCL1-01        ---------------------------------------gtggtgtgcac
A0A8C2BAP8_MCL1-01        ---------------------------------------gtggtgtgcac
A0A8C2BAP8_MCL1-02        ---------------------------------------gtggtgtgcac
A0A8C1JXA4_BCL2L1-01      ---------------------------------------gctctgtgtgt
A0A8C2HNY8_BCL2L1-01      ---------------------------------------gctctgtgtgt
A0A8C1WYA7_BCL2-01        ---------------------------------------accatgtgtgt
X4ZGI8_BCL2-01            ---------------------------------------accatgtgtgt
A0A8C1IQE4_BCL2-01        ---------------------------------------accgtttgtgt
A0A8C1S8K5_BCL2-01        ---------------------------------------accgtttgtgt
A0A8C1JUN1_MCL1-02        ---------------------------------------attgtatgcaa
                                                                     *      

A0A8C2A7Q5_MCL1-04        gcacctacatcacattcagtgatgatgaatccttgcagcgtttctttccc
A0A8C2A7Q5_MCL1-02        gcatcaaaatgatagaggacttagcaagtgtgtgagtctggtgggggaag
A0A8C2A7Q5_MCL1-03        gcatcaaaatgatagaggacttagcaagtgtgtgagtctggtgggggaag
A0A8C1JUN1_MCL1-01        gcatcaaaatgatagaggacttagcaagtgtgtgagtctggtgggggaag
A0A8C2A7Q5_MCL1-01        gcatcaaaatgatagaggacttagcaagtgtgtgagtctggtgggggaag
A0A8C1Y6A5_MCL1-01        gcatcagaaggataaaggacttaccaattgtgtgagtctggtggggaaag
A0A8C1PPB3_MCL1-01        gcatctgaaggagctgcagagagagcggtgtgtggagacggtggccgagc
A0A8C1X8V5_MCL1-01        gcagctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagc
A0A8C1YDY0_MCL1-01        gcagctgaaggagctgcagagagagcagtgcgtggaggcggtggccgagc
A0A8C2BAP8_MCL1-01        gcagctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagc
A0A8C2BAP8_MCL1-02        gcagctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagc
A0A8C1JXA4_BCL2L1-01      tgagtgcgtggagaaggagatgagcccgctagtgggaagcatcgcgcatt
A0A8C2HNY8_BCL2L1-01      tgagtgcgtggagaaagagatgagcccactagtgggaagcatcgcggaat
A0A8C1WYA7_BCL2-01        ggagagcttcaaccgggagatggcgtcccaggtagataatattgcacact
X4ZGI8_BCL2-01            ggagagcttcaaccgggagatggcgtcccaggtagataatattgcacact
A0A8C1IQE4_BCL2-01        cgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggct
A0A8C1S8K5_BCL2-01        cgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggct
A0A8C1JUN1_MCL1-02        gcatcaaaatgatagaggacttagcaagtgtgtgagtctggtgggggaag
                            *        *                    *        *        

A0A8C2A7Q5_MCL1-04        cagtccccacctcctcgaattcctgtccaggagatctgccctgttaccca
A0A8C2A7Q5_MCL1-02        agatctcttcct-atcttctcacagaccaacggcactggctgctcaaaaa
A0A8C2A7Q5_MCL1-03        agatctcttcct-atcttctcacagaccaacggcactggctgctcaaaaa
A0A8C1JUN1_MCL1-01        agatctcttcct-atcttctcacagaccaacggcactggctgctcaaaaa
A0A8C2A7Q5_MCL1-01        agatctcttcct-atcttctcacagaccaacggcactggctgctcaaaaa
A0A8C1Y6A5_MCL1-01        agatctctaact-accttctcacagcccagcgggactggctgctcaaaaa
A0A8C1PPB3_MCL1-01        agatctcctcct-atctgatctcagaacagcacgactggctgctcaacaa
A0A8C1X8V5_MCL1-01        agatctcctcct-atctgatctcagaacagcacgactggctgctcaacaa
A0A8C1YDY0_MCL1-01        agatctcctcct-atctgatctcagaacagcacgactggctgctcaacaa
A0A8C2BAP8_MCL1-01        agatctcctcct-atctgatctcagaacagcacgactggctgctcaacaa
A0A8C2BAP8_MCL1-02        agatctcctcct-atctgatctcagaacagcacgactggctgctcaacaa
A0A8C1JXA4_BCL2L1-01      ggatgaccgtct-acctagacaacaaaattcagccctggatccagagcca
A0A8C2HNY8_BCL2L1-01      ggatgatcgtct-acctagacaacaaaattcagccctggatccagagcca
A0A8C1WYA7_BCL2-01        ggatgacagact-acctgaacgggccactggaaaactggatcgaggaaaa
X4ZGI8_BCL2-01            ggatgacagact-acctgaacgggccactggaaaactggatcgaggaaaa
A0A8C1IQE4_BCL2-01        ggatgaccgagt-atctgaatgggccgctgcacgcctggatccaggagaa
A0A8C1S8K5_BCL2-01        ggatgaccgagt-atctgaacgggccgctgcacgcctggatccaggagaa
A0A8C1JUN1_MCL1-02        agatctcttcct-atcttctcacagaccaacggcactggctgctcaaaaa
                             *       *   *                   ***           *

A0A8C2A7Q5_MCL1-04        taagccagcgctctaccgagaccccatcacagacattccctacgctaatg
A0A8C2A7Q5_MCL1-02        caaagcatggg---------------------------------------
A0A8C2A7Q5_MCL1-03        caaagcatggg---------------------------------------
A0A8C1JUN1_MCL1-01        caaagcatggg---------------------------------------
A0A8C2A7Q5_MCL1-01        caaagcatggg---------------------------------------
A0A8C1Y6A5_MCL1-01        caaagcatggg---------------------------------------
A0A8C1PPB3_MCL1-01        caagagctggc---------------------------------------
A0A8C1X8V5_MCL1-01        caagagctggc---------------------------------------
A0A8C1YDY0_MCL1-01        caagagctggc---------------------------------------
A0A8C2BAP8_MCL1-01        caagagctggc---------------------------------------
A0A8C2BAP8_MCL1-02        caagagctggg---------------------------------------
A0A8C1JXA4_BCL2L1-01      aggaggatggg---------------------------------------
A0A8C2HNY8_BCL2L1-01      aggaggatggg---------------------------------------
A0A8C1WYA7_BCL2-01        tggaggctggg---------------------------------------
X4ZGI8_BCL2-01            tggaggctggg---------------------------------------
A0A8C1IQE4_BCL2-01        cggcggctggg---------------------------------------
A0A8C1S8K5_BCL2-01        cggcggctggg---------------------------------------
A0A8C1JUN1_MCL1-02        caaagcatggg---------------------------------------
                                   *                                        

A0A8C2A7Q5_MCL1-04        ttcaagctt---------tta--ggatc---------atccgggaagctt
A0A8C2A7Q5_MCL1-02        --atggctt---------cgaggaattt---------ttccatgtcccgg
A0A8C2A7Q5_MCL1-03        --atggctt---------cgaggaattt---------ttccatgtcccgg
A0A8C1JUN1_MCL1-01        --atggctt---------cgaggaattt---------ttccatgtcccgg
A0A8C2A7Q5_MCL1-01        --atggctt---------cgaggaattt---------ttccatgtcccgg
A0A8C1Y6A5_MCL1-01        --atggctt---------tgtggaattt---------tttcgtgtcccag
A0A8C1PPB3_MCL1-01        --atggatt---------tgtggagttt---------ttccgcgtggagg
A0A8C1X8V5_MCL1-01        --atggatt---------tgtggagttt---------ttccgcgtggagg
A0A8C1YDY0_MCL1-01        --atggatt---------cgtggagttt---------ttccgcgtggagg
A0A8C2BAP8_MCL1-01        --atggatt---------cgtggagttt---------ttccgcgtggagg
A0A8C2BAP8_MCL1-02        --tgagtgaccacacactcgtgtttccttcactgcgtaactcagagccgt
A0A8C1JXA4_BCL2L1-01      --aacgctt---------cgcggagatc---------tttggaaaagat-
A0A8C2HNY8_BCL2L1-01      --aacgctt---------cgcagagatc---------tttggaaaagat-
A0A8C1WYA7_BCL2-01        --atgcctt---------tgtggagtta---------tacagtcagcag-
X4ZGI8_BCL2-01            --acgcctt---------tgtggagtta---------tacagtcagcag-
A0A8C1IQE4_BCL2-01        --aggcgtt---------tgtggagctc---------tacggcaggcag-
A0A8C1S8K5_BCL2-01        --aggcgtt---------tgtggagctc---------tacggcaggcag-
A0A8C1JUN1_MCL1-02        --atggctt---------cgaggaattt---------ttccatgtcccgg
                                                                            

A0A8C2A7Q5_MCL1-04        ataaaaagtatgtggcggcccacggcctgc--------------------
A0A8C2A7Q5_MCL1-02        atacagagggagctgtgagaaacgcattga--------------------
A0A8C2A7Q5_MCL1-03        atacagagggagctgtgagaaacgcattga--------------------
A0A8C1JUN1_MCL1-01        atacagagggagctgtgagaaacgcattga--------------------
A0A8C2A7Q5_MCL1-01        atacagagggagctgtgagaaacgcattga--------------------
A0A8C1Y6A5_MCL1-01        atacagaaggggctgtgagaaacgcattga--------------------
A0A8C1PPB3_MCL1-01        acgtggagtctgtggttcgtaatgctttga--------------------
A0A8C1X8V5_MCL1-01        acgtggagtctgtggttcgtaatgctttga--------------------
A0A8C1YDY0_MCL1-01        acgtggagtctgtggttcgcagcgctctga--------------------
A0A8C2BAP8_MCL1-01        acgtggagtctgtggttcgcagcgctctga--------------------
A0A8C2BAP8_MCL1-02        tctgtgtgtgtgtggagtccagtccattca--------------------
A0A8C1JXA4_BCL2L1-01      --gcagcggcagagagcagaaaatcgcaaga-aaacttcaagaagtggtt
A0A8C2HNY8_BCL2L1-01      --gcagcagcagagagcagaaaatcacaaga-aaacttcaggaagtggtt
A0A8C1WYA7_BCL2-01        --agagactctatgttccacccattgtcg---tacctaacgaaagtgctt
X4ZGI8_BCL2-01            --agagaccctatgttccacccattgtcg---tacctaacgaaagtgctt
A0A8C1IQE4_BCL2-01        --agggactcggtgtttcgcagctcgtggtcatcaatagtaacggtcttc
A0A8C1S8K5_BCL2-01        --agggactcggtgtttcgcagctcgtggtcatcaatagtaacggtcttc
A0A8C1JUN1_MCL1-02        atacagagggagctgtgagaaacgcattga--------------------
                                                                            

A0A8C2A7Q5_MCL1-04        ----cctccactggcacagtgactccagccgacactactg--------ca
A0A8C2A7Q5_MCL1-02        ----tggccattggtagtttt---------------------------gc
A0A8C2A7Q5_MCL1-03        ----tggccattggtagtttt---------------------------gc
A0A8C1JUN1_MCL1-01        ----tggccattggtagtttt---------------------------gc
A0A8C2A7Q5_MCL1-01        ----tggccattggtagtttt---------------------------gc
A0A8C1Y6A5_MCL1-01        ----tggccattggtagtgtg---------------------------gc
A0A8C1PPB3_MCL1-01        ----tggctgtagtcggatgc---------------------------gc
A0A8C1X8V5_MCL1-01        ----tggctgtagtcggatgc---------------------------gc
A0A8C1YDY0_MCL1-01        ----tggctgttgtgggatgt---------------------------gc
A0A8C2BAP8_MCL1-01        ----tggctgttgtgggatgt---------------------------gc
A0A8C2BAP8_MCL1-02        ----acacacgagaaacatgt-atcagaccg------cctgagaaaccac
A0A8C1JXA4_BCL2L1-01      gc--tggctggaatgaccttg----------------ctc--------ac
A0A8C2HNY8_BCL2L1-01      gc--tggcgggaataaccttg----------------ctc--------ac
A0A8C1WYA7_BCL2-01        ggattggcagcactaggcttg---------------------------gc
X4ZGI8_BCL2-01            ggattggcagcactaggcttg---------------------------gc
A0A8C1IQE4_BCL2-01        ggtctagccgctctcggggct---------------------------gt
A0A8C1S8K5_BCL2-01        ggtctagccgctctcggggct---------------------------gt
A0A8C1JUN1_MCL1-02        ----tggccattggtagtttt---------------------------gc
                                 *                                          

A0A8C2A7Q5_MCL1-04        aagaatctgcgccagaagatc-attatta-aaca----------------
A0A8C2A7Q5_MCL1-02        aacattcggagctgcacttgcttatttga-tacggccatccgtggggtct
A0A8C2A7Q5_MCL1-03        aacattcggagctgcacttgcttatttga-tacggccatccgtggggtct
A0A8C1JUN1_MCL1-01        aacattcggagctgcacttgcttatttga-tacggccatccgtggggtct
A0A8C2A7Q5_MCL1-01        aacattcggagctgcacttgcttatttga-tacggccatccgtggggtct
A0A8C1Y6A5_MCL1-01        tacattcggagctgcacttgcttatttga-ttcgg---------------
A0A8C1PPB3_MCL1-01        tgggatcggcgccggtctcgctttcctga-tccg----------------
A0A8C1X8V5_MCL1-01        tgggatcggcgccggtctcgctttcctga-tccg----------------
A0A8C1YDY0_MCL1-01        tgggattggcgccggtctcgctctcctga-tccg----------------
A0A8C2BAP8_MCL1-01        tgggatcggcgccggtctcgctctcctga-tccg----------------
A0A8C2BAP8_MCL1-02        tgttaaact---cacccacgtcttcatcagcccc----------------
A0A8C1JXA4_BCL2L1-01      gggtgtcgtggtcgggtcactcattgcac-agaa----------------
A0A8C2HNY8_BCL2L1-01      gggtgtcgtggtcgggtcactcattgcac-agaa----------------
A0A8C1WYA7_BCL2-01        aggagtgaccatcggagcctttttcgctc-agaa----------------
X4ZGI8_BCL2-01            aggagtgaccatcggagcctttttcgctc-agaa----------------
A0A8C1IQE4_BCL2-01        tggcttgaccataggagcctaccttgctc-agaa----------------
A0A8C1S8K5_BCL2-01        tggcttgaccataggagcctaccttgctc-agaa----------------
A0A8C1JUN1_MCL1-02        aacattcggagctgcacttgcttatttga-tacgg---------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        aatgaggactatggtaatgacacacacagggcctcacctgatcctccagc
A0A8C2A7Q5_MCL1-03        aatgaggactatggtaatgacacacacagggcctcacctgatcctccagc
A0A8C1JUN1_MCL1-01        aatgaggactatggtaatgacacacacagggcctcacctgatcctccagc
A0A8C2A7Q5_MCL1-01        aatgaggactatggtaatgacacacacagggcctcacctgatcctccagc
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        tcactgtggcagcacctgctgtggttacctgagccaggctgttaaactca
A0A8C2A7Q5_MCL1-03        tcactgtggcagcacctgctgtggttacctgagccaggctgttaaactca
A0A8C1JUN1_MCL1-01        tcactgtggcagcacctgctgtggttacctgagccaggctgttaaactca
A0A8C2A7Q5_MCL1-01        tcactgtggcagcacctgctgtggttacctgagccaggctgttaaactca
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        gtggaatacagggattgataagtgagccatc---------------tcca
A0A8C2A7Q5_MCL1-03        gtggaatacaggaaaaaagaagtcatgatgt-------------------
A0A8C1JUN1_MCL1-01        gtggaatacaggtaaagccatgtgacaaca--------------------
A0A8C2A7Q5_MCL1-01        gtggaatacaggaatcaggtgatgaagaatataagggtgacttgtctgaa
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        caagaatcagtctctttcagtgtgactgccctggaa---------aaaat
A0A8C2A7Q5_MCL1-03        ---------------------------------gag---------tgagc
A0A8C1JUN1_MCL1-01        --------------------------------------------------
A0A8C2A7Q5_MCL1-01        acggaagatgaggtggacagtgactttgacattgatgaaggggatgaacc
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        ggtctgcatgca------tttttggacgtcacgacatgccaacgtgcaaa
A0A8C2A7Q5_MCL1-03        ggtgggctggac------atctgagacatcacgtcagacaaaacaggtca
A0A8C1JUN1_MCL1-01        -------------------------------catg-tactaa--------
A0A8C2A7Q5_MCL1-01        cgacagcgagcaggaggaggatgggccacgtcgcaagagcagagtggtga
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        acaatgaccatggaatgttgcttgcatttctgattaatacagtagcctat
A0A8C2A7Q5_MCL1-03        --------------------------------------------------
A0A8C1JUN1_MCL1-01        -------------------------------------------------t
A0A8C2A7Q5_MCL1-01        ccaaagcctacaaggagccagttaaagtggtgaggcaaaaaccaaaacaa
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        ctgaacttttttagggtttcattgttttttttgttttgttttttgaccaa
A0A8C2A7Q5_MCL1-03        aa------------------------------------------------
A0A8C1JUN1_MCL1-01        ct------------------------------------------------
A0A8C2A7Q5_MCL1-01        cggaaactggctgaactgcccaggaggacagtcaagacaaagatcaacaa
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        --------------------------------------------------
A0A8C2A7Q5_MCL1-02        atgctatgcacaaatgtcattgccaggcattaaaatgatcatcaaatta-
A0A8C2A7Q5_MCL1-03        -------------------------------------------------g
A0A8C1JUN1_MCL1-01        -------------------------------------------------g
A0A8C2A7Q5_MCL1-01        atacaacccccctgaactacaggaggacatcaacaagagtgagacttttg
A0A8C1Y6A5_MCL1-01        --------------------------------------------------
A0A8C1PPB3_MCL1-01        --------------------------------------------------
A0A8C1X8V5_MCL1-01        --------------------------------------------------
A0A8C1YDY0_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-01        --------------------------------------------------
A0A8C2BAP8_MCL1-02        --------------------------------------------------
A0A8C1JXA4_BCL2L1-01      --------------------------------------------------
A0A8C2HNY8_BCL2L1-01      --------------------------------------------------
A0A8C1WYA7_BCL2-01        --------------------------------------------------
X4ZGI8_BCL2-01            --------------------------------------------------
A0A8C1IQE4_BCL2-01        --------------------------------------------------
A0A8C1S8K5_BCL2-01        --------------------------------------------------
A0A8C1JUN1_MCL1-02        --------------------------------------------------
                                                                            

A0A8C2A7Q5_MCL1-04        ----------------aggcatgtag
A0A8C2A7Q5_MCL1-02        -atgatattttc-taaaaatatataa
A0A8C2A7Q5_MCL1-03        cata-----a---gtttggtctctga
A0A8C1JUN1_MCL1-01        caca-----ttcttgttctatggtaa
A0A8C2A7Q5_MCL1-01        cactttatttacacatgcacatgtga
A0A8C1Y6A5_MCL1-01        -----------------------tga
A0A8C1PPB3_MCL1-01        ----------------------gtga
A0A8C1X8V5_MCL1-01        ----------------------gtga
A0A8C1YDY0_MCL1-01        ----------------------atga
A0A8C2BAP8_MCL1-01        ----------------------atga
A0A8C2BAP8_MCL1-02        ----------------------gtga
A0A8C1JXA4_BCL2L1-01      ----------------acgcctgtga
A0A8C2HNY8_BCL2L1-01      ----------------acgcctgtga
A0A8C1WYA7_BCL2-01        ----------------------gtga
X4ZGI8_BCL2-01            ----------------------gtga
A0A8C1IQE4_BCL2-01        ----------------------atga
A0A8C1S8K5_BCL2-01        ----------------------atga
A0A8C1JUN1_MCL1-02        -----------------------tga
                                                 *  

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice