Dataset for CDS BCL-2-like of organism Cyprinus carpio

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C1IQE4_BCL2-01      atg------gcacaggagaatgtgtatgat------aaccgcagtat--a
A0A8C1YDY0_MCL1-01      atg------actc----taagttttgggattaaacgaacggccgcgttga
A0A8C1JXA4_BCL2L1-      atg------------------tcttactat------aacagagaact--g
X4ZGI8_BCL2-01          atg------gccaacgaaattcgctatgac------aatcggaatat--t
A0A8C1JUN1_MCL1-01      atgtttcctgggagtaaagtttcaaacgac------aa-cggccttt--g
A0A8C1JUN1_MCL1-02      atgtttcctgggagtaaagtttcaaacgac------aa-cggccttt--g
                        ***                         *       **  *     *   

A0A8C1IQE4_BCL2-01      gtg-------gagaagtacatccac----------------------cat
A0A8C1YDY0_MCL1-01      gtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgggcccgcgctc
A0A8C1JXA4_BCL2L1-      gtg-------gtattttttattaaa----------------------tat
X4ZGI8_BCL2-01          gtg-------gagaaatacctcaat----------------------cac
A0A8C1JUN1_MCL1-01      gc-----------------------------------------------c
A0A8C1JUN1_MCL1-02      gc-----------------------------------------------c
                        *                                                 

A0A8C1IQE4_BCL2-01      aagctctggaagaag------------gggtacgtg--tgg---------
A0A8C1YDY0_MCL1-01      aaaccgcgcacggaggacgagcttgacgggtacgcggatga---------
A0A8C1JXA4_BCL2L1-      aaactctcacagagg------------aactacccgtacaatcacattga
X4ZGI8_BCL2-01          aaactttcaaagaag------------ggatatgagtggaa---------
A0A8C1JUN1_MCL1-01      atgcattggaatagc------------agctcttaacgtca---------
A0A8C1JUN1_MCL1-02      atgcattggaatagc------------agctcttaacgtca---------
                        *  *                          *                   

A0A8C1IQE4_BCL2-01      ---------------------gaagaggaccgc-ggcggcacccgtcacg
A0A8C1YDY0_MCL1-01      ---------------------cacggaagccgc--gctgaagccgccgag
A0A8C1JXA4_BCL2L1-      atttacagaagacacacatcggactgatgcggt-ggaagggaatgatgat
X4ZGI8_BCL2-01          --------atttcaatcttccggggaggatgat-----gacactatcaat
A0A8C1JUN1_MCL1-01      --------acaacag--ctcgagcgggtttggtcgcaagccactagtaat
A0A8C1JUN1_MCL1-02      --------acaacag--ctcgagcgggtttggtcgcaagccactagtaat
                                                              *           

A0A8C1IQE4_BCL2-01      acccgtgcagcgcgcttcataaggtgctgcgggaggccggg---------
A0A8C1YDY0_MCL1-01      gcccgggacgaacggcttgaaagg-gctgcagctggacgggcggttcgtg
A0A8C1JXA4_BCL2L1-      gaggaggcagcagga---acaacgaccctcgttaa-----------tggc
X4ZGI8_BCL2-01          acgggagtggaggactcctctccgagctctgacaggaggctcc---aggc
A0A8C1JUN1_MCL1-01      gccagaaccgaaagc-ccagaacgagttcgcagggaacggtctgcagggc
A0A8C1JUN1_MCL1-02      gccagaaccgaaagc-ccagaacgagttcgcagggaacggtctgcagggc
                                 *             *                          

A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      tccgcgggggacggctctctaccggccaccccggacccga------agga
A0A8C1JXA4_BCL2L1-      tc-------------cctgaacggaa--------------------caag
X4ZGI8_BCL2-01          tc-------------cctcagccgga----gggggaa---------acaa
A0A8C1JUN1_MCL1-01      tcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacag
A0A8C1JUN1_MCL1-02      tcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacag
                                                                          

A0A8C1IQE4_BCL2-01      ----------gacgagctgga------------gcggctt----------
A0A8C1YDY0_MCL1-01      gctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatt
A0A8C1JXA4_BCL2L1-      tactggttcca-----ctgggaccccac-----caaggtcccccac---t
X4ZGI8_BCL2-01          ctctgaatgc------ctgatagcaaac-----cggg-----tcacacgt
A0A8C1JUN1_MCL1-01      ccccgtctgcgccgctctggaaatggacacgcgcgagattattgacattt
A0A8C1JUN1_MCL1-02      ccccgtctgcgccgctctggaaatggacacgcgcgagattattgacattt
                                        ***                 *             

A0A8C1IQE4_BCL2-01      -----------------------tatcagtcggact--------------
A0A8C1YDY0_MCL1-01      tctatcgcacgcacacgggaatgtgtccgccggaccggaagcgtcatcac
A0A8C1JXA4_BCL2L1-      tcagc-----------------cccccagcgtcagacgaacgggactggg
X4ZGI8_BCL2-01          tcaga-----------------cccttattcgagga--------------
A0A8C1JUN1_MCL1-01      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
A0A8C1JUN1_MCL1-02      tcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacag
                                                                          

A0A8C1IQE4_BCL2-01      ----------------------------------ttgcggagatgtccaa
A0A8C1YDY0_MCL1-01      gcgttaccgacaatgagg---------cgcgtcgtcgcggacattctgat
A0A8C1JXA4_BCL2L1-      ggtcttgatgcagtaaaggaggcgcttcgcgattctgccaacgaatttga
X4ZGI8_BCL2-01          --tctaccgatcgtta-----------cgcgaggctggagaccagataga
A0A8C1JUN1_MCL1-01      atcctatctacgatga-----------agcg-ggttgtggacagtctcgt
A0A8C1JUN1_MCL1-02      atcctatctacgatga-----------agcg-ggttgtggacagtctcgt
                                                            *   *         

A0A8C1IQE4_BCL2-01      acagctgca---tctcacgtcca--------tcacggcg-cagcagc---
A0A8C1YDY0_MCL1-01      aaagcacca---gatcacttacaaaggaatgttgcagcgtctgcagctgg
A0A8C1JXA4_BCL2L1-      gctgcgttattcccaagcattcaacgacctgtcctcgcagctccacatca
X4ZGI8_BCL2-01          aaggatgtaccagcgtgaatttgaggagatgtcccaccagatgacattca
A0A8C1JUN1_MCL1-01      ggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
A0A8C1JUN1_MCL1-02      ggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
                           *    *          *                 *            

A0A8C1IQE4_BCL2-01      ---------------------gctttaccgcggtcatagacgag---ctg
A0A8C1YDY0_MCL1-01      actctcaaccggacgacatgagcttcatcagctgtatagccaagaccatg
A0A8C1JXA4_BCL2L1-      cgcctgccacagcgtaccagagcttcga---gagcgtgatggatgaggtg
X4ZGI8_BCL2-01          gtcccagtgcagcacaacgcagcttctt---agctgtggctgaagagctc
A0A8C1JUN1_MCL1-01      aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctc
A0A8C1JUN1_MCL1-02      aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctc
                                             * **           *           * 

A0A8C1IQE4_BCL2-01      ttcaggg---acggcgtgaactggggcagaatcatcgcttttt-tcgagt
A0A8C1YDY0_MCL1-01      ttcaaggaccacaccacgaactggggccggatcgtgagtctgg-tggcgt
A0A8C1JXA4_BCL2L1-      ttccgcgacggcgt---caactggggccgcatcgtgggactgt-ttgcct
X4ZGI8_BCL2-01          ttcagagacggagt---gaactgggggcggatcgtc-gctttctttgagt
A0A8C1JUN1_MCL1-01      ttcagcgatggcatcacaaactgggggcgcattgccagcctgc--tgact
A0A8C1JUN1_MCL1-02      ttcagcgatggcatcacaaactgggggcgcattgccagcctgc--tgact
                        ***   *           ********  * **        *     *  *

A0A8C1IQE4_BCL2-01      ttggagggaccgtttgt-----gtcgaatgcgtgaataaggagatgacgg
A0A8C1YDY0_MCL1-01      tcggagccgtggtgtgcacgcagctgaaggagc---tgcagagagagcag
A0A8C1JXA4_BCL2L1-      tcggaggggctctgtgt-----gttgagtgcgtggagaaggagatgagcc
X4ZGI8_BCL2-01          ttggtgggaccatgtgt-----gtggagagcttcaaccgggagatggcgt
A0A8C1JUN1_MCL1-01      tt--tggggccat-tgt-----atgcaagcatcaaaatgatagaggactt
A0A8C1JUN1_MCL1-02      tt--tggggccat-tgt-----atgcaagcatcaaaatgatagaggactt
                        *    *      * **          *              ***      

A0A8C1IQE4_BCL2-01      cgcatgt-------------------ggataacatcgcgggctggatgac
A0A8C1YDY0_MCL1-01      tgc--gt-------------------ggaggcggtggccgagcagatctc
A0A8C1JXA4_BCL2L1-      cgctagt-------------------gggaagcatcgcgcattggatgac
X4ZGI8_BCL2-01          cccaggt-------------------agataatattgcacactggatgac
A0A8C1JUN1_MCL1-01      agcaagtgtgtgagtctggtgggggaagagatctcttcctatcttctcac
A0A8C1JUN1_MCL1-02      agcaagtgtgtgagtctggtgggggaagagatctcttcctatcttctcac
                          *  **                    *         *        *  *

A0A8C1IQE4_BCL2-01      cgagtatctgaatgggccgctgcacgcctggatccaggagaacggcggct
A0A8C1YDY0_MCL1-01      ctcctatctgatctcagaacagcacgactggctgctcaacaacaagagct
A0A8C1JXA4_BCL2L1-      cgtctacctagacaacaaaattcagccctggatccagagccaaggaggat
X4ZGI8_BCL2-01          agactacctgaacgggccactggaaaactggatcgaggaaaatggaggct
A0A8C1JUN1_MCL1-01      agaccaacggcactggctgctcaaaaac---------------aaagcat
A0A8C1JUN1_MCL1-02      agaccaacggcactggctgctcaaaaac---------------aaagcat
                             * *               *   *                     *

A0A8C1IQE4_BCL2-01      gggaggcgtttgtggagctctacggcaggcagag---ggactcggtgttt
A0A8C1YDY0_MCL1-01      ggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggtt
A0A8C1JXA4_BCL2L1-      gggaacgcttcgcggagatctttggaaaagatgc---agcggcagagagc
X4ZGI8_BCL2-01          gggacgcctttgtggagttatacagtcagcagag---agaccctatgttc
A0A8C1JUN1_MCL1-01      gggatggcttcgaggaatttt--------------------tccatgtcc
A0A8C1JUN1_MCL1-02      gggatggcttcgaggaatttt--------------------tccatgtcc
                        ** *    ** * ***  * *                     *   *   

A0A8C1IQE4_BCL2-01      cgcagctcg--tggtcatcaatagtaacggtcttcggtctagccgctctc
A0A8C1YDY0_MCL1-01      cgcag--------------------------------------cgctctg
A0A8C1JXA4_BCL2L1-      agaaaatcgcaagaaaacttcaagaag----------------tggttg-
X4ZGI8_BCL2-01          cacccattg--tcgtacctaacgaaag----------------tgcttgg
A0A8C1JUN1_MCL1-01      cggatacag--agggagctgtgagaaa----------------cgcattg
A0A8C1JUN1_MCL1-02      cggatacag--agggagctgtgagaaa----------------cgcattg
                                                                    *     

A0A8C1IQE4_BCL2-01      ggggctgttg--------gct--------tgaccataggagcctaccttg
A0A8C1YDY0_MCL1-01      atggctgttgtgggatgtgct--------ggg--attggcgccggtctcg
A0A8C1JXA4_BCL2L1-      -ctggctggaatgaccttgctcacgggtgtcgtggtcgggtcactcattg
X4ZGI8_BCL2-01          attggcagcactaggcttg---gcaggagtgaccatcggagcctttttcg
A0A8C1JUN1_MCL1-01      atggccattggtagtttt----------gcaacattcggagctgcacttg
A0A8C1JUN1_MCL1-02      atggccattggtagtttt----------gcaacattcggagctgcacttg
                           *                               * **  *     * *

A0A8C1IQE4_BCL2-01      ct---caga-----------------------------------------
A0A8C1YDY0_MCL1-01      ctctcctgatcc--------------------------------------
A0A8C1JXA4_BCL2L1-      caca---gaaacgcc-----------------------------------
X4ZGI8_BCL2-01          ctca---ga-----------------------------------------
A0A8C1JUN1_MCL1-01      cttatttgatacggccatccgtggggtctaatgaggactatggtaatgac
A0A8C1JUN1_MCL1-02      cttatttgatac--------------------------------------
                        *      **                                         

A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C1JUN1_MCL1-01      acacacagggcctcacctgatcctccagctcactgtggcagcacctgctg
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1IQE4_BCL2-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
X4ZGI8_BCL2-01          --------------------------------------------------
A0A8C1JUN1_MCL1-01      tggttacctgagccaggctgttaaactcagtggaatacaggtaaagccat
A0A8C1JUN1_MCL1-02      --------------------------------------------------
                                                                          

A0A8C1IQE4_BCL2-01      ---------------------------------------aatga
A0A8C1YDY0_MCL1-01      ---------------------------------------gatga
A0A8C1JXA4_BCL2L1-      ---------------------------------------tgtga
X4ZGI8_BCL2-01          ---------------------------------------agtga
A0A8C1JUN1_MCL1-01      gtgacaacacatgtactaatctgcacattcttgttctatggtaa
A0A8C1JUN1_MCL1-02      ---------------------------------------ggtga
                                                                 * *

© 1998-2023Legal notice