Dataset for CDS BCL-2-like of organism Cyprinus carpio

[Download (right click)] [Alignment] [Repertoires]

27 sequence(s)

>gnl|bcl2dbcds|A0A8C1IQE4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=573 residues).
atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacatccaccataagctctggaagaaggggtacgt
gtgggaagaggaccgcggcggcacccgtcacgacccgtgcagcgcgcttcataaggtgctgcgggaggccggggacgagc
tggagcggctttatcagtcggactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcagcagcgcttt
accgcggtcatagacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgt
ttgtgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaatgggc
cgctgcacgcctggatccaggagaacggcggctgggaggcgtttgtggagctctacggcaggcagagggactcggtgttt
cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcggggctgttggcttgaccataggagcctacct
tgctcagaaatga
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=921 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggtaaagccatgtg
acaacacatgtactaatctgcacattcttgttctatggtaa
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=744 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A8C1JXA4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinus carpio GN=BCL2L1 (length=720 residues).
atgtcttactataacagagaactggtggtattttttattaaatataaactctcacagaggaactacccgtacaatcacat
tgaatttacagaagacacacatcggactgatgcggtggaagggaatgatgatgaggaggcagcaggaacaacgaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcagccccccagcgtcag
acgaacgggactgggggtcttgatgcagtaaaggaggcgcttcgcgattctgccaacgaatttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcgcattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcggagatctttggaaaagatgcagcggcagagagcagaaaatcgcaagaaaact
tcaagaagtggttgctggctggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C1PPB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=774 residues).
atgactttgagtttgatgagaagaacagctacggtgagtctcctcggcgcgcacacggcgctcgcgcccgcgcccgcact
caaagcgcggaccgaggacgagctcgacgggtgcgcggatgaaacggacgccgcgatgaagccgttcagaccgggaacga
acggcctgaaaggactgcatctggacggacgctatgtgtccgcggcggacgggtctctcccgaacacaccggacccgcag
gagttcggttccgccgagctgggtcgcgacacgaggcggcttttactggatttctatcgcacgcacacgggactgtgtcc
gcgggaccggaagcagcatcacgcgttaccgacaatgactcgcgttgtcgcggacattctcctaaagcacgagatcgcgt
acaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagccaagaccatg
ttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgcatctgaagga
gctgcagagagagcggtgtgtggagacggtggccgagcagatctcctcctatctgatctcagaacagcacgactggctgc
tcaacaacaagagctggcatggatttgtggagtttttccgcgtggaggacgtggagtctgtggttcgtaatgctttgatg
gctgtagtcggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A8C1S8K5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=624 residues).
atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacatccaccataagctctggaagaaggggtacgt
gtgggaagtgaacggacacgatgacagcgtctcgaatggactgatgatggagaggcaggaggaccgcggcggcacccgtc
acgacccgtgcagcgccctccacacggtgctacgggaggctggggacgaactggagcggctttatcagtcggactttgcg
gagatgtccaaacagctgcatatcacgtccatcacggcgcagcagcgcttcaccgcggtcatagacgagctgttcaggga
cggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaatgcgtgaataaggagatga
cggcgcatgtggataacatcgcgggctggatgaccgagtatctgaacgggccgctgcacgcctggatccaggagaacggc
ggctgggaggcgtttgtggagctctacggcaggcagagggactcggtgtttcgcagctcgtggtcatcaatagtaacggt
cttcggtctagccgctctcggggctgttggcttgaccataggagcctaccttgctcagaaatga
>gnl|bcl2dbcds|A0A8C1WYA7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggatgc
ctttgtggagttatacagtcagcagagagactctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A0A8C1X8V5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=774 residues).
atgactttgagtttgatgagaagaacagctacggtgagtctcctcggcgcgcacacggcgctcgcgcccgcgcccgcact
caaagcgcggaccgaggacgagctcgacgggtgcgcggatgaaacggacgccgcgatgaagccgttcagaccgggaacga
acggcctgaaaggactgcatctggacggacgctatgtgtccgcggcggacgggtctctcccgaacacaccggacccgcag
gagttcggttccgccgagctgggtcgcgacacgaggcggcttttactggatttctatcgcacgcacacgggactgtgtcc
gcgggaccggaagcagcatcacgcgttaccgacaatgactcgcgttgtcgcggacattctcctaaagcacgagatcgcgt
acaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagccaagaccatg
ttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgcagctgaagga
gctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacgactggctgc
tcaacaacaagagctggcatggatttgtggagtttttccgcgtggaggacgtggagtctgtggttcgtaatgctttgatg
gctgtagtcggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A8C1Y6A5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=741 residues).
atgttccctgggagtaaagtttcaaacgacaacggcttttggccatgcatcggaataacagctcttaacgtctccagcag
atccagcaagccacagataatgccagaactgaaaacccagaacccgtttacaaggaacggactccagggctcggtaccat
cttcgcctgagtcggattgcgagaaaacaccagatgaatacacgtctaaccgtatctacgacgccctggaaatggacaca
cgagagattattgacattttcttaaaaaactttaatggattgcctcattctaaacgtgggaataaacaggttctggaaac
gatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgatcgcacggctgaatctggagc
agaaaggagaagatgtgagttttgttaagactgtggcaacagaactcttcagcgatggcatcacaaactggggtcgcatt
gccagcctgcttacatttggggcaatggtatgcaagcatcagaaggataaaggacttaccaattgtgtgagtctggtggg
gaaagagatctctaactaccttctcacagcccagcgggactggctgctcaaaaacaaagcatgggatggctttgtggaat
tttttcgtgtcccagatacagaaggggctgtgagaaacgcattgatggccattggtagtgtggctacattcggagctgca
cttgcttatttgattcggtga
>gnl|bcl2dbcds|A0A8C1YDY0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggaagccgcgctgaagccgccgaggc
ccgggacgaacggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcagtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggattggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1182 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaatcaggtgatg
aagaatataagggtgacttgtctgaaacggaagatgaggtggacagtgactttgacattgatgaaggggatgaacccgac
agcgagcaggaggaggatgggccacgtcgcaagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgag
gcaaaaaccaaaacaacggaaactggctgaactgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctg
aactacaggaggacatcaacaagagtgagacttttgcactttatttacacatgcacatgtga
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1149 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacagggattgataagtg
agccatctccacaagaatcagtctctttcagtgtgactgccctggaaaaaatggtctgcatgcatttttggacgtcacga
catgccaacgtgcaaaacaatgaccatggaatgttgcttgcatttctgattaatacagtagcctatctgaacttttttag
ggtttcattgttttttttgttttgttttttgaccaaatgctatgcacaaatgtcattgccaggcattaaaatgatcatca
aattaatgatattttctaaaaatatataa
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=960 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaaaaaagaagtc
atgatgtgagtgagcggtgggctggacatctgagacatcacgtcagacaaaacaggtcaaagcataagtttggtctctga
>gnl|bcl2dbcds|A0A8C2A7Q5_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1158 residues).
atgagtttagctttcagcagggctcctcgaaagactgcgggaaaccgcatgtccagactgctggatgcagaagaggagga
tgagttctacaagaccacctatggaggatttcacgacgaatcaggtgatgaagaatataagggtgacttgtctgaaacgg
aagatgaggtggacagtgactttgacattgatgaaggggatgaacccgacagcgagcaggaggaggatgggccacgtcgc
aagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgaggcaaaaaccaaaacaacggaaactggctga
actgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctgaactacaggaggacatcaacaagaacagga
agtcggtgcgtcagtcaacaacagaacacacaaggttgacgtacctgaggctgcaggagaggcaggttgctccgcgtcga
aggaagggtacaagacatgagcgacctttgacccaagctgaacttttagcagaggccaaggtcacagcacagattaacct
tcgatcactggaaaactatgagcgtttggaggcagataagaaacgtcaggttcatatgaagcgtcagtgtgtgggatctg
ttatccgatatcactccgtgctcatgccactggtgtctgacgtcactcttaaagaggaaaacgtggatgtagagggtttg
gaccaagatgcccaacagaatccaggccctcacccttcacaagctctttcccagtcagaatcaacccttactgcgcctcc
tagtgtcttctcttctaacacagctgctgtaaacccttccctgtcatcagggcctgccaaatgctcccgcacctacatca
cattcagtgatgatgaatccttgcagcgtttctttccccagtccccacctcctcgaattcctgtccaggagatctgccct
gttacccataagccagcgctctaccgagaccccatcacagacattccctacgctaatgttcaagcttttaggatcatccg
ggaagcttataaaaagtatgtggcggcccacggcctgccctccactggcacagtgactccagccgacactactgcaaaga
atctgcgccagaagatcattattaaacaaggcatgtag
>gnl|bcl2dbcds|A0A8C2BAP8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcgctgaagccgccgaggc
ccgggacgaatggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A8C2BAP8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=819 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcgctgaagccgccgaggc
ccgggacgaatggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctgggtgagtgaccacacactcgtgtttccttcactgcgtaactcagagccgttctgt
gtgtgtgtggagtccagtccattcaacacacgagaaacatgtatcagaccgcctgagaaaccactgttaaactcacccac
gtcttcatcagccccgtga
>gnl|bcl2dbcds|A0A8C2BPF9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggacgccgcgctgaagccgccgaggc
ccgggacgaacggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccaaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgctggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctgaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcggtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A8C2BR28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=741 residues).
atgttccctgggagtaaagtttcaaacgacaacggcttttggccatgcatcggaataacagctcttaacgtctccagcag
atccagcaagccacaggtaatgccagaactgaaaacccagaacccgtttacaaggaacggactccagggctcggtaccat
ctttgcctgagtcggattgcgagaaaacaccagatgaatacacgtctaaccgtatctacgacgccctggaaatggacaca
cgagagattattgacattttcttaaaaaactttactggattgcctcattctaaacgtgggaataaacaggttctggaaac
gatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgatcgcacggctgaatctggagc
agaaaggagaagatgtgagttttgttaagactgtggcaacagaactcttcagcgatggcatctcaaactggggtcgcatt
gccagcctgcttacatttggggcaatggtatgcaagcatcagaaggataaaggacttagcaattgtgtgagtctggtggg
gaaagagatctctaactaccttctcacagcccagcgggactggctgctcaaaaacaaagcatgggatggctttgtggaat
tttttcgtgtcccagatacagaaggggctgtgagaaacgcattgatggccattggtagtgtggctacattcggagctgca
cttgcttatttgattcggtga
>gnl|bcl2dbcds|A0A8C2G339_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinus carpio GN=BCL2L1 (length=744 residues).
gccattgcaccatccctgagcgtcggcagaagcctgagaaggacgcaagggtgtgcactgtgttctaagaacaagcgagt
ggatatccagacatcggagaacgacgagcaacgacaagacacacatcggactgatgcggcggaagggaatgatgatgagg
aggcagcaggaaggacgaccctcgttaatggctccctgaacggaacaagtactggttccactgggaccccaccaaggtcc
cccacttcagccccccagcgtcagacgaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaa
cgaatttgagctgcgttattcccaagcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccaga
gcttcgagagcgtgatggatgaggtgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggg
gctctgtgtgttgagtgcgtggagaaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctaga
caacaaaattcagccctggatccagagccaaggaggatgggaacgcttcgcggagatctttggaaaagatgcagcggcag
agagcagaaaatcgcaagaaaacttcaagaagtggttgctggctggaatgaccttgctcacgggtgtcgtggtcgggtca
ctcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C2HNY8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinus carpio GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtgttttttattaaatacaaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacgacgaccctcg
ttaatggatccctgaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggacgctgtaaaggaggcacttcgtgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtccttgcagctccacatcacgcctgccacggcgtaccagagctttgagagcgtaatggatgagg
tgttccgcgacggtgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaagagatgagcccactagtgggaagcatcgcggaatggatgatcgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcagcagagagcagaaaatcacaagaaaact
tcaggaagtggttgctggcgggaataaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1908 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaacagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaatcaggtgatg
aagaatataagggtgacttgtctgaaacggaagatgaggtggacagtgactttgacattgatgaaggggatgaacccgac
agcgagcaggaggaggatgggccacgtcgcaagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgag
gcaaaaaccaaaacaacggaaactggctgaactgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctg
aactacaggaggacatcaacaagaacaggaagtcggtgcgtcagtcaacaacagaacacacaaggttgacgtacctgagg
ctgcaggagaggcaggttgctccgcgtcgaaggaagggtacaagacatgagcgacctttgacccaagctgaacttttagc
agaggccaaggtcacagcacagattaaccttcgatcactggaaaactatgagcgtttggaggcagataagaaacgtcagg
ttcatatgaagcgtcagtgtgtgggatctgttatccgatatcactccgtgctcatgccactggtgtctgacgtcactctt
aaagaggaaaacgtggatgtagagggtttggaccaagatgcccaacagaatccaggccctcacccttcacaagctctttc
ccagtcagaatcaacccttactgcgcctcctagtgtcttctcttctaacacagctgctgtaaacccttccctgtcatcag
ggcctgccaaatgctcccgcacctacatcacattcagtgatgatgaatccttgcagcgtttctttccccagtccccacct
cctcgaattcctgtccaggagatctgccctgttacccataagccagcgctctaccgagaccccatcacagacattcccta
cgctaatgttcaagcttttaggatcatccgggaagcttataaaaagtatgtggcggcccacggcctgccctccactggca
cagcgactccagccgacactactgcaaagaatctgcgccagaagatcattattaaacaaggcatgtag
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1161 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaacagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacagggattgataagtg
agccatctccacaagaatcagtctctttcagtgtgactgccctggaaaaaatggtctgcatgcatttttggacgtcacga
catgccaacgtgcaaaacaatgaccatggaatgttgcttgcatttctgattaatacagtaggctatctgaacttttttag
ggtttcattgtttttttttttttgttttttttttttgaccaaatgctatgcacaaatgtcattgccagtcattaaaatga
tcatcaaattaatgatattttctaaaaatatatatgagtaa
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=960 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctccagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaacagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggaaaaaagaagtc
atgatgtgagtgagcggtgggctggacatctgagacatcacgtcagacaaaacaggtcaaaacataagtttggtctctga
>gnl|bcl2dbcds|A0A8C2KHZ4_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=1158 residues).
atgagtttagctttcagcagggctcctcgaaagactgcgggaaaccgcatgtccagactgctggatgcagaagaggagga
tgagttctacaagaccacctatggaggatttcacgacgaatcaggtgatgaagaatataagggtgacttgtctgaaacgg
aagatgaggtggacagtgactttgacattgatgaaggggatgaacccgacagcgagcaggaggaggatgggccacgtcgc
aagagcagagtggtgaccaaagcctacaaggagccagttaaagtggtgaggcaaaaaccaaaacaacggaaactggctga
actgcccaggaggacagtcaagacaaagatcaacaaatacaacccccctgaactacaggaggacatcaacaagaacagga
agtcggtgcgtcagtcaacaacagaacacacaaggttgacgtacctgaggctgcaggagaggcaggttgctccgcgtcga
aggaagggtacaagacatgagcgacctttgacccaagctgaacttttagcagaggccaaggtcacagcacagattaacct
tcgatcactggaaaactatgagcgtttggaggcagataagaaacgtcaggttcatatgaagcgtcagtgtgtgggatctg
ttatccgatatcactccgtgctcatgccactggtgtctgacgtcactcttaaagaggaaaacgtggatgtagagggtttg
gaccaagatgcccaacagaatccaggccctcacccttcacaagctctttcccagtcagaatcaacccttactgcgcctcc
tagtgtcttctcttctaacacagctgctgtaaacccttccctgtcatcagggcctgccaaatgctcccgcacctacatca
cattcagtgatgatgaatccttgcagcgtttctttccccagtccccacctcctcgaattcctgtccaggagatctgccct
gttacccataagccagcgctctaccgagaccccatcacagacattccctacgctaatgttcaagcttttaggatcatccg
ggaagcttataaaaagtatgtggcggcccacggcctgccctccactggcacagcgactccagccgacactactgcaaaga
atctgcgccagaagatcattattaaacaaggcatgtag
>gnl|bcl2dbcds|A0A8C2KJQ5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=624 residues).
atggcacaggagaatgtgtatgataaccgcagtatagtggtgaagtacatccaccataagctctggaagaaggggtacgt
gtgggaagtgaacggacacgatgaccgcgtctcgaatggactgatgatggggaggcaggaggaccgcggcggcacccgtc
acgacccgtgcagcgcgcttcataaggtgctgcgggaggccggggacgagctggagcggctttatcagtccgactttgcg
gagatgtccaaacagctgcatctcacgtccatcacggcgcagcagcgcttcaccgcggtcatagacgagctgttcaggga
cggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaatgcgtgaataaggagatga
cggcgcatgtggataacatcgcgggctggatgaccgagtatctgaacgggccgctgcacgcctggatccaggagaacggc
ggctgggaggcgtttgtggagctctacggcaggcagagggactctgtgtttcgcagctcgtggtcatcaatagtaacggt
cttcggtctagccgctctcggggctgttggcttgaccataggagcctaccttgcgcagaaatga
>gnl|bcl2dbcds|A0A8C2KJQ5_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=573 residues).
atggcacaggagaatgtgtatgataaccgcagtatagtggtgaagtacatccaccataagctctggaagaaggggtacgt
gtgggaagaggaccgcggcggcacccgtcacgacccgtgcagcgcgcttcataaggtgctgcgggaggccggggacgagc
tggagcggctttatcagtccgactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcagcagcgcttc
accgcggtcatagacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgt
ttgtgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaacgggc
cgctgcacgcctggatccaggagaacggcggctgggaggcgtttgtggagctctacggcaggcagagggactctgtgttt
cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcggggctgttggcttgaccataggagcctacct
tgcgcagaaatga
>gnl|bcl2dbcds|X4ZGI8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggacgc
ctttgtggagttatacagtcagcagagagaccctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
© 1998-2022Legal notice