Dataset for CDS BCL-2-like of organism Cyprinus carpio

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A8C1IQE4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=573 residues).
atggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacatccaccataagctctggaagaaggggtacgt
gtgggaagaggaccgcggcggcacccgtcacgacccgtgcagcgcgcttcataaggtgctgcgggaggccggggacgagc
tggagcggctttatcagtcggactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcagcagcgcttt
accgcggtcatagacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgt
ttgtgtcgaatgcgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaatgggc
cgctgcacgcctggatccaggagaacggcggctgggaggcgtttgtggagctctacggcaggcagagggactcggtgttt
cgcagctcgtggtcatcaatagtaacggtcttcggtctagccgctctcggggctgttggcttgaccataggagcctacct
tgctcagaaatga
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=921 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggtaaagccatgtg
acaacacatgtactaatctgcacattcttgttctatggtaa
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=744 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A8C1JXA4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinus carpio GN=BCL2L1 (length=720 residues).
atgtcttactataacagagaactggtggtattttttattaaatataaactctcacagaggaactacccgtacaatcacat
tgaatttacagaagacacacatcggactgatgcggtggaagggaatgatgatgaggaggcagcaggaacaacgaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcagccccccagcgtcag
acgaacgggactgggggtcttgatgcagtaaaggaggcgcttcgcgattctgccaacgaatttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcgcattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcggagatctttggaaaagatgcagcggcagagagcagaaaatcgcaagaaaact
tcaagaagtggttgctggctggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C1YDY0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggaagccgcgctgaagccgccgaggc
ccgggacgaacggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcagtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggattggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|X4ZGI8_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio GN=BCL-2 (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttccggggaggatgatgacactatcaatacgggagtggaggactcctctccgagctctgacagga
ggctccaggctccctcagccggagggggaaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctaccgatcgttacgcgaggctggagaccagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccagatgacattcagtcccagtgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggacgc
ctttgtggagttatacagtcagcagagagaccctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
© 1998-2023Legal notice