Dataset for CDS BAX of Organism Lates calcarifer

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A4W6CPK8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lates calcarifer GN=BAX (length=579 residues).
atggcatctcacccgggaggaggcgaccaaggaaataccaaagatcagatactggaagtcggagccgttttgttaaagga
tttcatctatcagcgggttcagcgccatggagacagcaatactgtagtgaccagggcacagctgggtggaggagagctgc
gtgatccaaaccacaagaagctcgctcagtgtctacagcagattggagatgagctggatggcaatgttgagctccagagg
atgataaatgactcttcactcagtcccacaaaagacatgttcctgagagttgccgttgagatcttttcagatggaaaatt
caattggggcagggtggttgcactgttctactttgcctgcagacttgtcatcaaagctcttctgacccaagttcctgata
ttatcagaaccatcatcagctggaccatggactacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggcattcgttcctacttcggcacccctacctggcagacggtgggggttttcttggctggtgttctcaccactgttct
agtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A4W6CPK8_BAX-02 BCL2-associated X gene OS=[Eukaryota] Lates calcarifer GN=BAX (length=579 residues).
atggcatctcacccgggaggaggcgaccaaggtactgttaaattatatatattactgtgtctttgtaatcccctatgtag
tttcatctatcagcgggttcagcgccatggagacagcaatactgtagtgaccagggcacagctgggtggaggagagctgc
gtgatccaaaccacaagaagctcgctcagtgtctacagcagattggagatgagctggatggcaatgttgagctccagagg
atgataaatgactcttcactcagtcccacaaaagacatgttcctgagagttgccgttgagatcttttcagatggaaaatt
caattggggcagggtggttgcactgttctactttgcctgcagacttgtcatcaaagctcttctgacccaagttcctgata
ttatcagaaccatcatcagctggaccatggactacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggcattcgttcctacttcggcacccctacctggcagacggtgggggttttcttggctggtgttctcaccactgttct
agtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A4W6CZY5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lates calcarifer GN=BAX (length=618 residues).
atggctgacaaccgagaagaggagacaaaagaaggagaccaggagcctcagggcgccgtgggtggggaagatgtattcga
tgatcccatcctggagcaaggagcagtggtcctcagagggtatgtaattgagcgtataagcacagaggaccctggtcgac
aagtctgctctgaggatctgggaggaagaccaaacgaacaacaggatccacaagtcaaagaagtagtggaacagctgctc
aagattgcagatgagatgaacaggaatgctgagctccaacagctgatcaaccaggttcaggggaactgtgcacaggacat
tttcatgaaggtggccaggagtatctttgctgatggcattaactggggtcgagtggtggctctctttcatctggcctaca
gactcatacacaaggcactgacgaccaatcatttagagaacatcagaatggtcatcagctgggttctccaggtcatcagg
gagcagctctactcctggcttgtacagcagggaggctgggagggggtgatctgtggcttttctcggtggaggacagtagc
cgtagtagcatcagtagtattggtagcaaccattgtttactacaggaagacacgctga
© 1998-2023Legal notice