Dataset for CDS BAX of Organism Lates calcarifer

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W6CZY5_BAX-01      atggc-tgacaaccgagaagaggagacaaaagaa------------ggag
A0A4W6CPK8_BAX-01      atggcatctcacccgggaggaggcgaccaaggaaataccaaagatcagat
A0A4W6CPK8_BAX-02      atggcatctcacccgggaggaggcgaccaaggtactgttaaattatatat
                       ***** *  ** *** ** **** *** ** * *              * 

A0A4W6CZY5_BAX-01      accaggagcctcagggcgccgtgggtggggaagatgta-----ttcgatg
A0A4W6CPK8_BAX-01      actggaagtc----ggagccgt------------tttg-----ttaaagg
A0A4W6CPK8_BAX-02      atta-----c----tgtgtctt------------tgtaatcccctatgta
                       *        *     * * * *            * *       *     

A0A4W6CZY5_BAX-01      atcccatcctggagcaaggagcagtggtcctcagagggtatgtaattgag
A0A4W6CPK8_BAX-01      atttcatc--------------------tatcagcggg-------ttcag
A0A4W6CPK8_BAX-02      gtttcatc--------------------tatcagcggg-------ttcag
                        *  ****                      **** ***       ** **

A0A4W6CZY5_BAX-01      cg-tataagcacag-aggaccctggtcgacaagtctgctctgaggatctg
A0A4W6CPK8_BAX-01      cgccatggagacagcaatactgtagtgaccagg--------gcacagctg
A0A4W6CPK8_BAX-02      cgccatggagacagcaatactgtagtgaccagg--------gcacagctg
                       **  **    **** *  **  * **   ** *        *   * ***

A0A4W6CZY5_BAX-01      ggaggaagaccaaacgaacaacaggatccacaagtcaaagaagtagtgga
A0A4W6CPK8_BAX-01      ggtggagga------gagctgcgtgatccaaaccacaagaagctcgctca
A0A4W6CPK8_BAX-02      ggtggagga------gagctgcgtgatccaaaccacaagaagctcgctca
                       ** *** **      ** *  *  ****** *   ***  *  * *   *

A0A4W6CZY5_BAX-01      acagctgctcaagattgcagatgagatgaacaggaatgctgagctccaac
A0A4W6CPK8_BAX-01      gtgtctacagcagattggagatgagctggatggcaatgttgagctccaga
A0A4W6CPK8_BAX-02      gtgtctacagcagattggagatgagctggatggcaatgttgagctccaga
                           ** *   ****** ******* ** *  * **** *********  

A0A4W6CZY5_BAX-01      agctgatcaaccaggttcaggggaactgtgcacaggacattttcatgaag
A0A4W6CPK8_BAX-01      ggatgataaatgactcttcactcagtcccacaaaagacatgttcctgaga
A0A4W6CPK8_BAX-02      ggatgataaatgactcttcactcagtcccacaaaagacatgttcctgaga
                        * **** **  *   *      *      ** * ***** *** ***  

A0A4W6CZY5_BAX-01      gtggccaggagtatctttgctgatggca---ttaactggggtcgagtggt
A0A4W6CPK8_BAX-01      gttgccgttgagatcttttcagatggaaaattcaattggggcagggtggt
A0A4W6CPK8_BAX-02      gttgccgttgagatcttttcagatggaaaattcaattggggcagggtggt
                       ** ***      ****** * ***** *   * ** *****  * *****

A0A4W6CZY5_BAX-01      ggctctctttcatctggcctacagactcatacacaaggcactgacgacca
A0A4W6CPK8_BAX-01      tgcactgttctactttgcctgcagacttgtcatcaaagctcttctgaccc
A0A4W6CPK8_BAX-02      tgcactgttctactttgcctgcagacttgtcatcaaagctcttctgaccc
                        ** ** **  *  * **** ******  *   *** ** **   **** 

A0A4W6CZY5_BAX-01      atcatttagagaacatcagaatggtcatcagctgggttctccaggtcatc
A0A4W6CPK8_BAX-01      aagttcctgatattatcagaaccatcatcagctggaccatggactacctc
A0A4W6CPK8_BAX-02      aagttcctgatattatcagaaccatcatcagctggaccatggactacctc
                       *   *   ** *  *******   ***********    *  *   * **

A0A4W6CZY5_BAX-01      agggagcagctctactcctggcttgtacagcagggaggctgggagggggt
A0A4W6CPK8_BAX-01      cgggaacatgtgatcaactggatcagggagcaaggtggctgggagggcat
A0A4W6CPK8_BAX-02      cgggaacatgtgatcaactggatcagggagcaaggtggctgggagggcat
                        **** **  *   *  **** *     **** ** ***********  *

A0A4W6CZY5_BAX-01      --gat----ctgtggcttttctcggtggaggacagtagccgtagtagcat
A0A4W6CPK8_BAX-01      tcgttcctacttcggcacccctacctggcagacggtgggggt--tttctt
A0A4W6CPK8_BAX-02      tcgttcctacttcggcacccctacctggcagacggtgggggt--tttctt
                         * *    **  ***    **   ***  *** ** *  **  *  * *

A0A4W6CZY5_BAX-01      cagtagtattggtagcaaccattgtttactaca---ggaagacacgctga
A0A4W6CPK8_BAX-01      ggctggtgtt----ctcaccactgttctagtcattcgcaagatg---tga
A0A4W6CPK8_BAX-02      ggctggtgtt----ctcaccactgttctagtcattcgcaagatg---tga
                          * ** **       **** ****     **   * ****     ***

© 1998-2023Legal notice