Dataset for CDS BCL-2 of organism Echeneis naucrates

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A665U7Y7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Echeneis naucrates GN=BCL-2 (length=687 residues).
atggagagcgagtggaaccgcaatattgtggaaaattatttacgctataaactcgccaaacggggctatgcgtggggatt
tgatgacgtccggaatgaagatgctgctactaatggctcaatagttgccccatccccgactttggtccgccggttccgcg
aagccagcagcgggcccgacaaccagagcgcgcccgagcggtacggacggcccccgcagtccgacccgaacgccgacatc
cacagagtcctccgggaggccggagacgaacttgagaggttgtaccagccggacttcacggagatgtcccggcagctgta
catctcctcctccgtggcgcagaggaggttcgccgaggtgatagacgaactcttccgggacggagtgaactggggccgga
ttatcgccttcttcgagttcgggggggccgtgtgcgtcgagtgcgcggccaaggaggagttgagcccgcaggtggacaac
gtcgcggagtggatgacggagtatttaaacggacctcttaacagctggataaaggataacgggggatgggatgcctttgt
ggagctgtatgacagacagggcgactccatcttcagctgctcctggccctccatcaagacggtcttcggtctggctgcac
tcggggccgccagcctcaccatcggagcataccttacacagaagtga
© 1998-2020Legal notice