Dataset for CDS Unclassified of organism Sinocyclocheilus anshuiensis

[Download (right click)]

10 sequence(s)

>gnl|bcl2dbcds|A0A671KNQ2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=633 residues).
atggcacaggagaatgtgtatgataaccggagaatagtggtgaagtacatccaccataagctctggaagaagggatacgt
gtgggaagagaacggacacgatgacagcgtctcgaatggactgatgatggagaggcaggaggacggcggcatctctccca
gctcccgtcacgacccgtgcagggctcttcataaggtgctgcgggaggccggggatgaactggagcggctttatcagtcg
gactttgcggagatgtccaaacggctgcacctcacgtccatcacggcgcatcagcgcttcactgcggtcatagacgagct
gttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggactgtttgtgtcgaatgcgtgaata
aggagatgacggcgcatgtggataacattgcgggctggatgaccgagtatctgaacggaccgctgcacggctggattcag
gagaacggcggatgggaggcgtttgtggagctctacggcaggcagagggactctgtgtttcgcagctcgtggtcatcaat
agtaacggtcttcggtctagcggctctcggggctgttggcttgaccataggagcctaccttgctcagaaatga
>gnl|bcl2dbcds|A0A671L8S3_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=693 residues).
atgggtttattccagccacagccagttcgaaataactcgaagggaacaaatgaagtaattcccgggaaaaggctagtagg
aagcccatataaggctttaaggggaggagttatggaacacgccatgacgcggggactctataaaagcgttcagcgtcgca
gctacttccgcttcgctctccaaacaagagtgtcgaccaacacgagcactatctccttcacagactacgctttaaccttc
aactctattttaagttttttttttttacatatatcgctttctttccgtcatcacgcgttaccgacaatgaaacgcgtcgt
cgcggacgtcttgctgaagtgtttgggcttttctgcagggatgctgcagcatctgcagctggactctcagccggacgact
tgagcttcatcggctgtatagcaaagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggcc
ttcggagccgtggtgtgctcccagatgaaggagctgcagagggagcggtgcgtggagacggtggcccagcagatctcctc
ttatctgatctcagaacagcacgactggctgctcaacaacaagggctgggtgagtgacaccagaggaaaatctcactcct
attggattaggccggtatttcactcgtttcagctccattttatggcagtttga
>gnl|bcl2dbcds|A0A671L8S3_uncMCL1-02 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=627 residues).
atgactctgagtttggggaatagaccgatggctgcgttgggtgtcctcgcggaggaagcggacgccgcgctgaagccgct
gaggcccgggaccaacggcctgaaaggcctgcagctggacggacggttcgtgtccgcgggagacggctctctaccggcca
ccccggacccgcaggagctcggttccgacacgcggcagcttctgttggatttctatcgcacgcacaccggaatgagtctc
ccggaccggaagcgtcatcacgcgttaccgacaatgaaacgcgtcgtcgcggacgtcgtcataaagcaccagatcactta
cagagggatgctgcagcatctgcagctggactctcagccggacgacttgagcttcatcggctgtatagcaaagacgatgt
tcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggagccgtggtgtgctcccagatgaaggag
ctgcagagggagcggtgcgtggagacggtggcccagcagatctcctcttatctgatctcagaacagcacgactggctgct
caacaacaaggtaatctgcgttacttcatggtctctctggcttgctgttaatagcacagcttgttaa
>gnl|bcl2dbcds|A0A671L8S3_uncMCL1-03 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=891 residues).
atgggtttattccagccacagccagttcgaaataactcgaagggaacaaatgaagtaattcccgggaaaaggctagtagg
aagcccatataaggctttaaggggaggagttatggaacacgccatgacgcggggactctataaaagcgttcagcgtcgca
gctacttccgcttcgctctccaaacaagagtgtcgaccaacacgagcactatctccttcacagactacgctttaaccttc
aactctattttaagttttttttttttacatatatcgctttctttccgtcatcacgcgttaccgacaatgaaacgcgtcgt
cgcggacgtcttgctgaagtgtttgggcttttctgcagggatgctgcagcatctgcagctggactctcagccggacgact
tgagcttcatcggctgtatagcaaagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggcc
ttcggagccgtggtgtgctcccagatgaaggagctgcagagggagcggtgcgtggagacggtggcccagcagatctcctc
ttatctgatctcagaacagcacgactggctgctcaacaacaagggctggtcaactaaaactgaaaccaaaatcaaaacca
tattaacatttgcttcacttgaaacaatcgttaacgaatataaaataaagatattattttttacatgtatttatttttac
atttctttgtgtattaatttatatatttatttatttctaattttgtcaggtgtggcattccatactttcacaggaaaagt
aaagttaagactctcccagtttctctcagcagtcaataaatggggaaacaaagtaacttgtgttacttatttgaaaaata
ttttgttgtaa
>gnl|bcl2dbcds|A0A671MWU9_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=801 residues).
atgtttcatttttcggagctcttctctgtgagagaacgttttttccgttacgatgtacttcgaataaccgactttttcct
gctcgcgctcgttttatcgcgtttaataacgatggccaccgaaattcgctttgacaataggaatattgtggagaaataca
tcaatcacaaactttcaaagaagggatatgtgtggaaatctcaatcttctggggaggatgatgacaccgtcaataaagga
gtcgagggttcctctctaaactctgacaggaggcttcaggctccctcagccggaggggggaacaactctgaatgcctgat
agctcaccgggtcactcgttcagacgcttattcaaggatctaccgggcgctacacgaggctggagacgagatagaaagga
tataccagcgtgaatttgaggagatgtcccaccgcatgatattcagtcccaatacaacgcaacgcagcttcttagccgtg
gcagaagagctctttaaagacggagtgaactgggggcggatcatcgctttctttgagtttggtgggaccatgtgtgtgga
gagcgttaaccgggagatggcgtcccaggtagataatattgcacactggatgacagactacctgaacggacctctggaaa
actggatcgaggaaaatggaggctgggatgccttcgtggagttgtacagtcagcagagagactcaatgttccacccattt
tcgtacctaactaaagtacttggattggcagtgctcggcttggcaggagtgaccatcggagcctttttcgctcagaagtg
a
>gnl|bcl2dbcds|A0A671Q0S3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttctggggaggatgatgacaccatcaatacaggagtggaggactcctctccaaactcaggcagga
ggctccaggctccctcagccggaggggggaacaactctgaatgcctgatagcaaaccgggtcacacgttcagacccttat
tcgaggatctacggggcgttacgcgaggctggagaccagatagaaaggatgcaccagcgtgaatttgaggagatgtccca
ccagatgatattcagtcctaatgcagcacaacgcagcttcttagctgtggctgaagagctcttcagagacggagtgaact
gggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggatgc
cttcgtggagttgtacagtcagcagagagactctatgttccacccattttcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A0A671QD94_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=603 residues).
atgtgtaatgtgtatgataaccgcagtatagtggtgaagtacatccaccataagctctggaagaagggatacgtgtggga
agtgaacggacacgatgacagtgtctcgaatggactgatgatggagaggcaggaggaccgcggcggctcccgtcacgacc
cgttcagcgctcttcacacggtgctacgggaggctggggacgaactggagcggctttatcagtcggactttgcggagatg
tccaaacagctgcatctcacgtccatcacggcgcatcagcgcttcaccgcggtcatagacgagctgttcagggacggcgt
gaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgcgtcgaatgcgtgaataaggagatgacggtgc
atgtggataacatcgcgggctggatgaccgagtatctgaacgggccgctgcacggctggatccaggagaacggcggctgg
tgctctctaaatgccaatggctttcttactcaacacaacccagcccaatcacaacattccttgcattaccatgacagcag
aagaggaaaaatacagtgcatgcataattattatgcaagttga
>gnl|bcl2dbcds|A0A671QD94_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=606 residues).
atgaagggggcagtgaacggacacgatgacagtgtctcgaatggactgatgatggagaggcaggaggaccgcggcggctc
ccgtcacgacccgttcagcgctcttcacacggtgctacgggaggctggggacgaactggagcggctttatcagtcggact
ttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcatcagcgcttcaccgcggtcatagacgagctgttc
agggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgcgtcgaatgcgtgaataagga
gatgacggtgcatgtggataacatcgcgggctggatgaccgagtatctgaacgggccgctgcacggctggatccaggaga
acggcggctgggtatacgcagggtcgctcgctccgccccttctcctgcgttcgaagcatctctgccacaactctgcacac
gaaagatcatattttgagcgtgcaaaagtgcgttttgctcacgcgcaaactgagttttgtggagaaaatgtttgtctcac
aaagaagaaagtatttcgagcgcacgaaaatcaattttgcatttaa
>gnl|bcl2dbcds|A0A671QNL7_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=540 residues).
aaggaccaggtacagagagcgggaacatgtgcaccgtctcttcctgaaccgcagccaatgagttggcaatttcataatat
aaagtcaaaattgaacgtcgcaattacggtaaataaaattgaaatgttttattttatcatgtttaatttcagcttgattg
atgggtttgcacatgtggtggatagacagagtttccagaggcttgcagaaaaagtgtttgttgatgacatcacctgggcg
aaaattgttactctgatctgtgttgttgggaaaacagttgcaaagattcttgctaattcagtcccaggtattgtatcttg
gacattggattacttccagaataacctacagaactggatctgcagtatgggaggatggatcaacagtagctcttccttgg
ctcattactcgtttgagcgagagtttggttccttatcagaaatcaggcttactgaccagatctccctctcctctggtgtc
ctcctcatcagtgcagtgctgagtggctttatcatctggagaataaccagaggtgactga
>gnl|bcl2dbcds|A0A671QSU5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis (length=522 residues).
atgaccaaatctcaaatcaatatacacaaccccctaaaacttaagtggcaatttcataatataaagtcaaaattgaacgt
cgcaattacggtaaataaaattgaaatgttttattttatcatgtttaatttcagcttgattgatgggtttgcacatgtgg
tggatagacagagtttccagaggcttgcagaaaaagtgtttgttgatgacatcacctgggcgaaaattgttactctgatc
tgtgttgttgggaaaacagttgcaaagattcttgctaattcagtcccaggtattgtatcttggacattggattacttcca
gaataacctacagaactggatctgcagtatgggaggatggatcaacagtagctcttccttggctcattactcgtttgagc
gagagtttggttccttatcagaaatcaggcttactgaccagatctccctctcctctggtgtcctcctcatcagtgcagtg
ctgagtggctttatcatctggagaataaccagaggtgactga
© 1998-2020Legal notice