Dataset for CDS BCL-2 of organism Sinocyclocheilus rhinocerous

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673HVU7_BCL2-01      atggccaccgaaattcgctttgacaatcggaatattgtggagaaatacat
A0A673LV42_BCL2-01      atggcacaggagaatgtgtatgataaccggagcatagtggtgaagtacat
                        *****    ** * *   * *** ** ****  ** **** *** *****

A0A673HVU7_BCL2-01      caatcacaaactttcaaagaagggatatgtgtggaaatctcaatcttctg
A0A673LV42_BCL2-01      ccaccataagctctggaagaagggatacgtgtgggaagtgaa------cg
                        * * ** ** ** *  *********** ****** **    *       *

A0A673HVU7_BCL2-01      gggaggatgatgacaccgccaataaaggaatcgagggttcctctctaaac
A0A673LV42_BCL2-01      gacacgatgacagcgtctcgaatggactgatgatgg----------agag
                        *  * *****   *  * * ***  *   **   **          * * 

A0A673HVU7_BCL2-01      tctggcaggaggcttcaggctccctcagccggaggggggaacaactctga
A0A673LV42_BCL2-01      gcgggaggacggcggca-tctctcccagctcccgtcacgacccgtgcagg
                         * **  *  ***  **  *** * ****    *    ** *    * * 

A0A673HVU7_BCL2-01      atgcctgatagctcaccgggtcactcgttcagacccttattcaaggatct
A0A673LV42_BCL2-01      gctcttcataaggtgc----tctcccgtcacgaccc--gtgcagggctct
                           * * ***     *    ** * ***   *****   * ** ** ***

A0A673HVU7_BCL2-01      --accgggcgctacgcgaggctggagacgagatagaaaggctataccagc
A0A673LV42_BCL2-01      tcataaggtgctgcgggaggccggggatgaactggagcggctttatcagt
                          *   ** *** ** ***** ** ** **  * **  **** ** *** 

A0A673HVU7_BCL2-01      gtgaatttgaggagatgtcccaccgcatgatattcagtcccaatacaacg
A0A673LV42_BCL2-01      cggactttgcggagatgtccaaacggctgcacctcacgtccatcacggcg
                          ** **** ********** * **  **    ***   ***  **  **

A0A673HVU7_BCL2-01      caacgcagcttcttagccgtggcagaagagctctttaaagacggagtgaa
A0A673LV42_BCL2-01      catcagcgcttcaccgcggtcatagacgagctgttcggggacggcgtgaa
                        ** *   *****   ** **   *** ***** **    ***** *****

A0A673HVU7_BCL2-01      ctgggggcggatcatcgctttctttgagtttggtgggaccatgtgtgtgg
A0A673LV42_BCL2-01      ctggggcagaatcatcgcttttttcgagtttggagggactgtttgtgtcg
                        ******  * *********** ** ******** *****  * ***** *

A0A673HVU7_BCL2-01      agagcgtcaaccgggagatggcgtcccaggtagataatattgcacactgg
A0A673LV42_BCL2-01      aatgcgtgaataaggagatgatggcgcatgtggataacattgcgggctgg
                        *  **** **   *******  * * ** ** ***** *****   ****

A0A673HVU7_BCL2-01      atgacagactacctgaacgggcctctggaaaactggatcgaggaaaatgg
A0A673LV42_BCL2-01      atgaccgagtatctgaacgggccgctgcacggctggatccaggagaacgg
                        ***** ** ** *********** *** *   ******* **** ** **

A0A673HVU7_BCL2-01      aggctgggatgccttcgtggagttgtacagtcagcagagagactcagtgt
A0A673LV42_BCL2-01      cggatgggaggcgtttgtggagctctacggcaggcagagggactctgtgt
                         ** ***** ** ** ****** * *** *   ****** ***** ****

A0A673HVU7_BCL2-01      tcc---acccattttcgtacctaactaaagtacttggattggcagtgctc
A0A673LV42_BCL2-01      ttcgcagctcgtggtcatcgatagtaacggtcttcggtctagcggctctc
                        * *    * * *  ** *   **   *  **  * **  * ** *  ***

A0A673HVU7_BCL2-01      ggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
A0A673LV42_BCL2-01      ggggccgttggcttgaccataggagcctaccttgctcagaaatga
                        **    *  **  ******* *******   * ******** ***

© 1998-2021Legal notice