Dataset for CDS BAK1 of Organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6PMP8_BAK1-03      atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtct
F6PMP8_BAK1-01      atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtct
F6PMP8_BAK1-02      atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtct
Q52HB2_BAK1-01      atggcatccgggcaaggcccagggcctcccaggcgggagtgtggagaggctgccccgtct
                    ************************************************************

F6PMP8_BAK1-03      tctacttctgaggagcaggtagcccgggacaccgaggaggttttccgcagctatgttttt
F6PMP8_BAK1-01      tctacttctgaggagcaggtagcccgggacaccgaggaggttttccgcagctatgttttt
F6PMP8_BAK1-02      tctacttctgaggagcaggtagcccgggacaccgaggaggttttccgcagctatgttttt
Q52HB2_BAK1-01      tctacttctgaggagcaggtagcccgggacaccgaggaggttttccgcagctatgttttt
                    ************************************************************

F6PMP8_BAK1-03      taccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgacccagaaatg
F6PMP8_BAK1-01      taccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgacccagaaatg
F6PMP8_BAK1-02      taccgccatcggcag---------------------------------------------
Q52HB2_BAK1-01      taccgccatcggcaggagcaggaggctgagggggcggctgtgccagctgacccagaaatg
                    ***************                                             

F6PMP8_BAK1-03      gtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
F6PMP8_BAK1-01      gtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
F6PMP8_BAK1-02      ---------------gaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
Q52HB2_BAK1-01      gtcaccttgcccctagaacctagcagcaccatggggcaggtgggtcggcagctcgctatc
                                   *********************************************

F6PMP8_BAK1-03      attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcaccta
F6PMP8_BAK1-01      attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcaccta
F6PMP8_BAK1-02      attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcaccta
Q52HB2_BAK1-01      attggggacgacatcaaccagcgctatgactcggagttccaggccatgctgcagcaccta
                    ************************************************************

F6PMP8_BAK1-03      cagccgacagcagagaatgcctatgagtacttcaccaagattgcctcgaggccagcagca
F6PMP8_BAK1-01      cagccgacagcagagaatgcctatgagtacttcaccaagattgcctcg------------
F6PMP8_BAK1-02      cagccgacagcagagaatgcctatgagtacttcaccaagattgcctcg------------
Q52HB2_BAK1-01      cagccgacagcagagaatgcctatgagtacttcaccaagattgcctcg------------
                    ************************************************            

F6PMP8_BAK1-03      acacccacagcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
F6PMP8_BAK1-01      --------agcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
F6PMP8_BAK1-02      --------agcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
Q52HB2_BAK1-01      --------agcctatttgagagcggcatcaactggggccgagtggtggctctcctgggct
                            ****************************************************

F6PMP8_BAK1-03      ttggctaccgcctggccctgcatgtctaccaacgcggcctga------------------
F6PMP8_BAK1-01      ttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccagg
F6PMP8_BAK1-02      ttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccagg
Q52HB2_BAK1-01      ttggctaccgcctggccctgcatgtctaccaacgcggcctgaccggcttcctgggccagg
                    ******************************************                  

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      tgacccgcttcgtggccgacttcatgctgcatcattgcattgcccggtggatcgcgcaga
F6PMP8_BAK1-02      tgacccgcttcgtggccgacttcatgctgcatcattgcattgcccggtggatcgcgcaga
Q52HB2_BAK1-01      tgacccgcttcgtggccgacttcatgctgcatcattgcattgcccggtggatcgcgcaga
                                                                                

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      ggggtggctgggtggcagccctgaacttgggaaacggccccatcctgaacgtgctgatag
F6PMP8_BAK1-02      ggggtggctgggtggcagccctgaacttgggaaacggccccatcctgaacgtgctgatag
Q52HB2_BAK1-01      ggggtggctgggtggcagccctgaacttgggaaacggccccatcctgaacgtgctgatag
                                                                                

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      tgctgtctgtggttctgttgggccagtttgtgcctacaggtctgggggaaaggagagaga
F6PMP8_BAK1-02      tgctgtctgtggttctgttgggccagtttgtg----------------------------
Q52HB2_BAK1-01      tgctgtctgtggttctgttgggccagtttgtg----------------------------
                                                                                

F6PMP8_BAK1-03      ------------------------------------------------------------
F6PMP8_BAK1-01      agttcatgattaagccaaatgcagggagcggatgcagatggagcccgctgaccagccccc
F6PMP8_BAK1-02      -----------------------------gtacgaagat---------------------
Q52HB2_BAK1-01      -----------------------------gtacgaagat---------------------
                                                                                

F6PMP8_BAK1-03      --------------------------------
F6PMP8_BAK1-01      accctctgagtgtgtctgaaaataaactgtaa
F6PMP8_BAK1-02      -tcttc-----------------aaatcatga
Q52HB2_BAK1-01      -tcttc-----------------aaatcatga
                                                    

© 1998-2020Legal notice