Dataset for CDS MCL-1 of organism Amphiprion ocellaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1BKL8_MCL1-01      atgaatatgattccgacgacgacgaagaggacggcgttcatgaactactt
A0A3Q1BKL8_MCL1-02      atgaatatgattccgacgacgacgaagaggacggcgttcatgaactactt

A0A3Q1BKL8_MCL1-01      aatttttcctcaaaatggagtcgtggagggaccgatgcactatggatccg
A0A3Q1BKL8_MCL1-02      aatttttcctcaaaatggagtcgtggagggaccgatgcactatggatccg

A0A3Q1BKL8_MCL1-01      gagattcctccccgcagattgccgtggcctcctccatagactctcacaac
A0A3Q1BKL8_MCL1-02      gagattcctccccgcagattgccgtggcctcctccatagactctcacaac

A0A3Q1BKL8_MCL1-01      gggaatgttggctccaatgaaaccccaaaacggccgaagaacctgggagt
A0A3Q1BKL8_MCL1-02      gggaatgttggctccaatgaaaccccaaaacggccgaagaacctgggagt

A0A3Q1BKL8_MCL1-01      gaatgggtatgcgtcaaaaaaccttcgacaagacagcgacagtatggagg
A0A3Q1BKL8_MCL1-02      gaatgggtatgcgtcaaaaaaccttcgacaagacagcgacagtatggagg

A0A3Q1BKL8_MCL1-01      agggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgac
A0A3Q1BKL8_MCL1-02      agggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgac

A0A3Q1BKL8_MCL1-01      gtctccagttgtccagcaggagacgagttgctggagaatgacacgaggca
A0A3Q1BKL8_MCL1-02      gtctccagttgtccagcaggagacgagttgctggagaatgacacgaggca

A0A3Q1BKL8_MCL1-01      actccttcgccgtttcttaagagactttactggactttcaaagccccggt
A0A3Q1BKL8_MCL1-02      actccttcgccgtttcttaagagactttactggactttcaaagccccggt

A0A3Q1BKL8_MCL1-01      ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgtt
A0A3Q1BKL8_MCL1-02      ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgtt

A0A3Q1BKL8_MCL1-01      ttggacaaacacagatacgcatacaatggtatgatcaacaaactgtcgct
A0A3Q1BKL8_MCL1-02      ttggacaaacacagatacgcatacaatggtatgatcaacaaactgtcgct

A0A3Q1BKL8_MCL1-01      ggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcc
A0A3Q1BKL8_MCL1-02      ggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcc

A0A3Q1BKL8_MCL1-01      tctttgcagacaggacgaccaactggggtcgtattacgagcctggtggcc
A0A3Q1BKL8_MCL1-02      tctttgcagacaggacgaccaactggggtcgtattacgagcctggtggcc

A0A3Q1BKL8_MCL1-01      tttggggcggtggtatgtcagtacctgaaggagaggggcagggagaactg
A0A3Q1BKL8_MCL1-02      tttggggcggtggtatgtcagtacctgaaggagaggggcagggagaactg

A0A3Q1BKL8_MCL1-01      cgtggacctggtcagccaggagatttccacatacctgctttctgaacagc
A0A3Q1BKL8_MCL1-02      cgtggacctggtcagccaggagatttccacatacctgctttctgaacagc

A0A3Q1BKL8_MCL1-01      gagactggctggtcaaaaacaactcatgggatggttttgtggagtttttt
A0A3Q1BKL8_MCL1-02      gagactggctggtcaaaaacaactcatgggatggttttgtggagtttttt

A0A3Q1BKL8_MCL1-01      cgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
A0A3Q1BKL8_MCL1-02      cgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc

A0A3Q1BKL8_MCL1-01      tggatttgctggtattggggcaacactggccctgctgatcag--------
A0A3Q1BKL8_MCL1-02      tggatttgctggtattggggcaacactggccctgctgatcagtggtcttg

A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      ctgctgtaggactaacacagagcactgaaaactcttgcaaggatgcacac

A0A3Q1BKL8_MCL1-01      -------gt----ga
A0A3Q1BKL8_MCL1-02      ataagttgttgcaga
                               **    **

© 1998-2022Legal notice