Dataset for CDS BAX-like of Organism Bubo bubo

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C0FD77_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Bubo bubo GN=BOK (length=642 residues).
atggaagtgctacgccgttcctcagtctttgctgcagaggtgatggaggtttttgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctctgcagagactacataaattcgaggctaattcgagcaggtgtcagctggagcaaacctg
agcacaacacaccagtgcccggcggtaagctggctgaggtgtccaccatactgctgcgactgggggatgagctggaatac
attcgccccaacgtctaccggaatatcgcccgccaattgaacatctcgctgcactcggagacggtggtgacggatgcctt
cctggcagtagctgcacaaattttcaccgcaggcataacgtggggcaaggtggtgtctctctacgcggtggcagcggggc
tggcggtggactgcgtgcggcacgcgcagccagccatggttcacaccatcgtagactgcctgggagagtttgtccgcaag
accttggtggcatggctgagaaggagaggaggctgggcagacatcacaaaatgcgtggtgaatactgaccccagccttcg
ctcccactggctcgtggctgctgtttgcagctttggtcacttcctcaaggctatcttcttcgtcctgctgcctgagagat
ga
>gnl|bcl2dbcds|A0A8C0I8C0_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Bubo bubo GN=BAK1 (length=654 residues).
atggcctcagggaacaacggtgacccaccaagggcccacggacgccaaggaagcaacgggcgcaggctgtcacaagagct
caactcagaagaccaggtggcagaggagacagaggaggtgtttcggagctatgccttctaccgctaccaacaggagagag
aggagagaggggaggaaatgcccatggacccagagatcgcggagatccagcaggagctgggcagcaccgggagcctggtg
ggaaggcgcctggccatcatcggtgacgacattaacgagcggtacgacgcggagtttcgctacatgctgaaatccttgca
gcccaccaaggagaacgcctatgagtacttcaccagaatagcctccagcttgttcgagagcggcattaactggggccggg
tgattgcactgctgggttttggctaccgcatggccatccacgtctaccagcacggcataccgggtttcctccgccggatc
gcccgttacgtggcagaattcatgctccggaaccgcatcgcccagtggatcgcccagcagggaagatgggtggctgcact
cgagctggacaatgtttacatgaagtacatgctggtggtggtggccctggtcatggtggggcatttagtggtacgacgct
tcttcaggccctaa
© 1998-2023Legal notice