Dataset for CDS BAX-like of Organism Bubo bubo

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0FD77_BOK-01       atgg-------------aagtgctacgcc---gttcctcagtctttgctg
A0A8C0I8C0_BAK1-01      atggcctcagggaacaacggtgacccaccaagggcccacggac---gcca
                        ****               ***   * **   *  ** * * *   **  

A0A8C0FD77_BOK-01       cagaggtgatgg----aggtttttgacaggtctcccactgacaag-----
A0A8C0I8C0_BAK1-01      aggaagcaacgggcgcaggctgtc-acaagagctcaactcagaagaccag
                          ** *  * **    *** * *  *** *    * *** * ***     

A0A8C0FD77_BOK-01       ---------------gagcttgtgtcccaagccaaggctctctgcagaga
A0A8C0I8C0_BAK1-01      gtggcagaggagacagaggaggtgtttcggagctatgccttctaccgcta
                                       ***   ****  *    * * **  *** * *  *

A0A8C0FD77_BOK-01       cta---------------------------------cataaattcgaggc
A0A8C0I8C0_BAK1-01      ccaacaggagagagaggagagaggggaggaaatgcccatggacccagaga
                        * *                                 ***  *  *   * 

A0A8C0FD77_BOK-01       taattcgagcaggtgtcagctggagcaaacctgagcacaacacaccagtg
A0A8C0I8C0_BAK1-01      ----tcgcggagat-ccagcaggag-----ctgggcagcac---cgggag
                            *** * ** *  **** ****     *** ***  **   *  * *

A0A8C0FD77_BOK-01       cccggcggtaagctggctgaggtgtccaccatactgctgcgactggggga
A0A8C0I8C0_BAK1-01      cctggtgggaaggcgcctgg-----ccatcat-cggtgacgac--attaa
                        ** ** ** ***  * ***      *** *** * *   ****      *

A0A8C0FD77_BOK-01       tgagctggaatacattcgccccaacgtctaccggaatatcgcccgccaat
A0A8C0I8C0_BAK1-01      cgagcggta------------cgacg-----cggagtttcg-ctacatgc
                         **** * *            * ***     **** * *** *  *    

A0A8C0FD77_BOK-01       tgaacatctcgctgcac-tcggagacggtggtgacggatgccttcctggc
A0A8C0I8C0_BAK1-01      tgaaatccttgcagcccaccaaggagaacgcctatgagtacttcaccag-
                        ****   ** ** ** *  *   **    *   * *  * * *  *  * 

A0A8C0FD77_BOK-01       agtagctgcacaaattttcaccgcaggcataacgtggggcaaggtggtgt
A0A8C0I8C0_BAK1-01      aatagcctccagcttgttcgagagcggcattaactggggccgggtgattg
                        * ****  *     * ***      ***** *  ******  **** *  

A0A8C0FD77_BOK-01       ctct-ctacgcggtggcagcggggctggcggtggactgcgtgcggcacgc
A0A8C0I8C0_BAK1-01      cactgctgggttttggctaccgca-tggccatccacgtctaccagcacgg
                        * ** **  *   ****  * *   ****  *  **  *   * ***** 

A0A8C0FD77_BOK-01       gcagccagccatggttcacaccatcgtagactgcctgggagagtttgt--
A0A8C0I8C0_BAK1-01      cataccgggtttcctccgccggatcgcccgttacgtggcagaattcatgc
                            ** *   *  * * *   ****     * * *** *** **  *  

A0A8C0FD77_BOK-01       -------ccgcaagacc---ttggtggcatggctgagaaggagaggag--
A0A8C0I8C0_BAK1-01      tccggaaccgcatcgcccagtggatcgcccagcagggaagatgggtggct
                               *****   **   * * * **   ** * ****  * *  *  

A0A8C0FD77_BOK-01       --------gctgggcagacatcaca--aaatgcgtggtg--aatactgac
A0A8C0I8C0_BAK1-01      gcactcgagctggacaatgtttacatgaagtacatgctggtggtggtggc
                                ***** **    * ***  ** * * ** **    *  ** *

A0A8C0FD77_BOK-01       cccagccttcgctcccactggctcgtggctgctgtttgcagctttggtca
A0A8C0I8C0_BAK1-01      cctggtcatgg------------tggggcatttagtggta-----cgacg
                        **  * * * *             * ***   *  * * *      * * 

A0A8C0FD77_BOK-01       cttcctcaaggctatcttcttcgtcctgctgcctgagagatga
A0A8C0I8C0_BAK1-01      cttcttcaggccc---------------------------taa
                        **** *** * *                            * *

© 1998-2023Legal notice