Dataset for CDS BCL2L1 of organism Bos mutus grunniens

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8B9WB42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccagaaaacgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactgtgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccacttaccta
aataaccacgtcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgttgcaggcctcgcaaacctcatttcaa
acacaaaactttattcaaaattggaccaaagatgcccatactatgtgggccactcaggctcagacagatga
>gnl|bcl2dbcds|A0A8B9X9C2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=654 residues).
aaatttatcttacagggaaaggggtatagcaaccgacggctggtggttgactttctctcttacaagctttcccagaaagg
atacagctggagtcgatttaatgatgtggaagagaacagaactgaggcctcggaagggacaaaatcagatatggaaaccc
caatgccatcaatgacaacccatcttgccactggccacagcagaagcttggacgcctggaaagtgatccccgtgacaaca
gaaaagcaagccctgagggaggcaggcaatgacgaccagacgtcccagctccacatcaccccagggacagcatatcagag
ctttgaacagatgatgtatgaactcctccaggacggggtgaactggggtcgcattgtggcctttttttccttcagtgggg
cactatgcatggaaagcatagacaaggagacacaagtattggtgagtcaaagcacaacttggatggccacctacctaaat
gaccacctagagtcttggatccaggagaacggcggctgggacacttctgtgaaactctgtgaaaacaatacaaccaccga
gagccaaaagggccaggagcgcttcaacagctggtccctgacgggcatgacttcggctggtacagctctgctgggcttgc
tactcaactcatag
>gnl|bcl2dbcds|A0A8B9XQH5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
© 1998-2022Legal notice