Dataset for CDS BCL2L1 of organism Bos mutus grunniens

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9WB42_BCL2L1-      ------atgtctcag------------agcaatcgggaactagtggttga
A0A8B9X9C2_BCL2L1-      aaatttatcttacagggaaaggggtatagcaaccgacggctggtggttga
A0A8B9XQH5_BCL2L1-      ------atgtctcag------------agtaaccgggagctggtggttga
                              ** *  ***            ** ** **    ** ********

A0A8B9WB42_BCL2L1-      ctttctctcttacaagctttcccagaaaggatacagctggagtcagttta
A0A8B9X9C2_BCL2L1-      ctttctctcttacaagctttcccagaaaggatacagctggagtcgattta
A0A8B9XQH5_BCL2L1-      ctttctctcttacaagctttcccagaaaggatacagctggagtcagttta
                        ********************************************  ****

A0A8B9WB42_BCL2L1-      gtg-----------------------------------------tcagat
A0A8B9X9C2_BCL2L1-      atgatgtggaagagaacagaactgaggcctcggaagggacaaaatcagat
A0A8B9XQH5_BCL2L1-      gtgatgtggaagagaacagaactgaggccccagaagggacagaatcagat
                         **                                         ******

A0A8B9WB42_BCL2L1-      atggaaacccccagtg-gatcagtggcaacccatcctggcacctggcaga
A0A8B9X9C2_BCL2L1-      atggaaa-ccccaatgccatcaatgacaacccatctt-------------
A0A8B9XQH5_BCL2L1-      atggaaacccccagtgccatcaatggcaacgcatcctggcacctggcgga
                        ******* ***** **  **** ** **** **** *             

A0A8B9WB42_BCL2L1-      tagccccacagtgaatggagccactggccacagcagaagcttggatgccc
A0A8B9X9C2_BCL2L1-      -------------------gccactggccacagcagaagcttggacgcct
A0A8B9XQH5_BCL2L1-      tagccctgctgtgaatggagccactggccacagcagaagctcggatgccc
                                           ********************** *** *** 

A0A8B9WB42_BCL2L1-      agaaaacgatccccatgacaacagtaaagcaagccctgagggaggcaagc
A0A8B9X9C2_BCL2L1-      ggaaagtgatccccgtgacaacagaaaagcaagccctgagggaggcaggc
A0A8B9XQH5_BCL2L1-      gggaagtgatccccatggcagcggtgaagcaagccctgagggaggcaggc
                         * **  ******* ** ** * *  ********************* **

A0A8B9WB42_BCL2L1-      aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtccca
A0A8B9X9C2_BCL2L1-      aatga------------------------------cgaccagacgtccca
A0A8B9XQH5_BCL2L1-      gatgagtttgaactgaggtaccgacgggcattcagcgacctgacgtccca
                         ****                              ***** ** ******

A0A8B9WB42_BCL2L1-      gctccgcatcaccccagggacagcatgtcagagctttgaacaggtaataa
A0A8B9X9C2_BCL2L1-      gctccacatcaccccagggacagcatatcagagctttgaacagatgatgt
A0A8B9XQH5_BCL2L1-      gctccacatcaccccagggacagcatatcagagctttgaacaggtagtga
                        ***** ******************** **************** *  *  

A0A8B9WB42_BCL2L1-      atgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttc
A0A8B9X9C2_BCL2L1-      atgaactcctccaggacggggtgaactggggtcgcattgtggcctttttt
A0A8B9XQH5_BCL2L1-      atgaactcttccgggacggggtgaactggggtcgcattgtggcctttttc
                        ******** *** **** ******* ******* * ************* 

A0A8B9WB42_BCL2L1-      tccttcagtgggacactgtgcatgaaaagcatagacaaggagatacacgt
A0A8B9X9C2_BCL2L1-      tccttcagtggggcactatgcatggaaagcatagacaaggagacacaagt
A0A8B9XQH5_BCL2L1-      tccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcaggt
                        ****** ***** **** *** ** ***** ************  ** **

A0A8B9WB42_BCL2L1-      attggtgagtcaggtcacaacttcaatggccacttacctaaataaccacg
A0A8B9X9C2_BCL2L1-      attggtgagtcaaagcacaacttggatggccacctacctaaatgaccacc
A0A8B9XQH5_BCL2L1-      attggtgagtcggatcgcaacttggatggccacttacctgaatgaccacc
                        ***********    * ******  ******** ***** *** ***** 

A0A8B9WB42_BCL2L1-      tcaagccttggatccaagagaacggcgggtgggacacttttgtggaactc
A0A8B9X9C2_BCL2L1-      tagagtcttggatccaggagaacggcggctgggacacttctgtgaaactc
A0A8B9XQH5_BCL2L1-      tagagccttggatccaggagaacggcggctgggacacttttgtggaactc
                        *  ** ********** *********** ********** **** *****

A0A8B9WB42_BCL2L1-      tacgaaagcaatacaacaaacgagagccagaagggccaggagcgcttcaa
A0A8B9X9C2_BCL2L1-      tgtgaaaacaatacaaccaccgagagccaaaagggccaggagcgcttcaa
A0A8B9XQH5_BCL2L1-      tacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaa
                        *  *  * **** ** *   ********  ********************

A0A8B9WB42_BCL2L1-      ctcc---------atttacactactgctgctgttgcaggcctcgcaaacc
A0A8B9X9C2_BCL2L1-      cagctggtccctgacgggcatgacttcggctggtacagctc---------
A0A8B9XQH5_BCL2L1-      ccgctggttcctgacgggcatgactgtggctggtgtggttc---------
                        *  *         *    **  ***   **** *   *  *         

A0A8B9WB42_BCL2L1-      tcatttcaaacacaaaactttattcaaaattggaccaaagatgcccatac
A0A8B9X9C2_BCL2L1-      -----------------------------------------------tgc
A0A8B9XQH5_BCL2L1-      -----------------------------------------------tgc
                                                                       * *

A0A8B9WB42_BCL2L1-      tatgtgggccactcaggctcagacagatga
A0A8B9X9C2_BCL2L1-      tgggcttgctactcaact---catag----
A0A8B9XQH5_BCL2L1-      tgggctcgctcttcagtcggaaatga----
                        *  *   **   ***       *       

© 1998-2022Legal notice