Dataset for CDS BCL-2-like of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


Q0KFR9_MCL1-01          ------atgagtctgtcgaactcgattacacgagcc---acaactacgat
A0A1S3NR66_MCL1-01      ------atgagtctg------tcgtttacacgagcc---acaactacgat
A0A1S3NR66_MCL1-02      gtcaagatgagtctg------tcgtttacacgagcc---acaactacgat
C0HAD8_BCL2L1-01        ---------a-----------tgtcttaca---------gtaacagggaa
A0A1S3MED7_BCL2L1-      ---------a-----------tgacttaca---------acaacagagaa
B5XAY3_BCL2L1-01        ------atga-----------tgacttaca---------acaacagagaa
A0A1S3LY44_BCL2-01      ---------a-----------tggcaaacg---------acgacaaccgc
A0A1S3R1W1_BCL2-01      ---------a-----------tggcaaacg---------acgacaaccgc
A0A1S3NIV8_BCL2-01      ------atga-----------tggcaaacgagaatccttacaacagtcgc
A0A1S3Q9V5_BCL2-01      ------atga-----------tggcgaacgataatccttataacagtcgc
                                 *           *     **             **      

Q0KFR9_MCL1-01          gttgcattttcaaaat---------ggaggatcttcgtacctagctgatg
A0A1S3NR66_MCL1-01      tttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgctgg--
A0A1S3NR66_MCL1-02      tttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgctgg--
C0HAD8_BCL2L1-01        ct-----------------------ggtggtgttttttata---------
A0A1S3MED7_BCL2L1-      ct-----------------------ggtggtatactatatt---------
B5XAY3_BCL2L1-01        ct-----------------------ggtggtgtactatatt---------
A0A1S3LY44_BCL2-01      tgtat--------------------agtggaaaagtacatt---------
A0A1S3R1W1_BCL2-01      ttcat--------------------agtggaaaagtacatt---------
A0A1S3NIV8_BCL2-01      tttat--------------------tgtcgaaaaatacatc---------
A0A1S3Q9V5_BCL2-01      tttat--------------------tgttgaaaaatacatc---------
                                                  *  *        *           

Q0KFR9_MCL1-01          atgctaggccgttgtactatttccagggggctggggccatatgtgctggg
A0A1S3NR66_MCL1-01      ----tacccctttgtgctatttcggcgagactg------tatgtgctggg
A0A1S3NR66_MCL1-02      ----tacccctttgtgctatttcggcgagactg------tatgtgctggg
C0HAD8_BCL2L1-01        -------agctatagactgtcccagaggaattattcatgttgtcaattgg
A0A1S3MED7_BCL2L1-      -------acctataaactatcacagagagactaccccttcaaccacattg
B5XAY3_BCL2L1-01        -------acctataaactatcacagagggactaccccttcaaccacatgg
A0A1S3LY44_BCL2-01      -------tgtcacaaactcttgaaaaggggatatgcgt---------ggg
A0A1S3R1W1_BCL2-01      -------tgtcacaaactcttgaaacgaggatatgcgt---------ggg
A0A1S3NIV8_BCL2-01      -------catcacaaactgttgaacatgggatttgtat---------gga
A0A1S3Q9V5_BCL2-01      -------catcacaaactgttgaagaagggatttgtat---------ggg
                                        ** *           *                  

Q0KFR9_MCL1-01          gcgtcaccgaagtctaaagtg------gacttgggaaatg---------g
A0A1S3NR66_MCL1-01      gcgtcacctaagtcaaaagtggatactgacttgggtaatg---------g
A0A1S3NR66_MCL1-02      gcgtcacctaagtcaaaagtggatactgacttgggtaatg---------g
C0HAD8_BCL2L1-01        ggctggagggtgcaagtggacg-----gactgagg--------------g
A0A1S3MED7_BCL2L1-      ggctcacagaagctcccagtcg-----gactgaggggggacaggcggaag
B5XAY3_BCL2L1-01        agctcacggaagcccagaatcg-----gactgaggtgggacaggtggaag
A0A1S3LY44_BCL2-01      atttcgagaatgccgaggat-------gaggaagatgctgataataatgg
A0A1S3R1W1_BCL2-01      atttcgaggatgccgaggag-------gaggaaggtgccgctaataatgg
A0A1S3NIV8_BCL2-01      aattt---caagcagaaaac-------ga------ttctccaaataatgg
A0A1S3Q9V5_BCL2-01      aattt---aatccagaaaat-------ga------ttccccaaataatgg
                           *                       **                    *

Q0KFR9_MCL1-01          gactggcgatactccaccacga-----cccacgacgttaggagtgaatg-
A0A1S3NR66_MCL1-01      gactggcgacactccaccacga-----cccacgaagttaggagtgaatg-
A0A1S3NR66_MCL1-02      gactggcgacactccaccacga-----cccacgaagttaggagtgaatg-
C0HAD8_BCL2L1-01        agatgacgccatt-----------------------------gcaaatgg
A0A1S3MED7_BCL2L1-      ggggggcggcagtc--acgaca-----caccccaacggcgcagcgaacgg
B5XAY3_BCL2L1-01        ggggtgcggcagtc--ctaaca-----tac------------gtcaacgg
A0A1S3LY44_BCL2-01      gtcgatgatttctcctccgcct------------ggtttggcacggcggt
A0A1S3R1W1_BCL2-01      gtcgatgatttctcctcggctg------------ggtttggcacggcggt
A0A1S3NIV8_BCL2-01      ctttggggacccctctacacccaactcccccgaagtttttgcacggaggt
A0A1S3Q9V5_BCL2-01      ctttggggagccctctccccctaactcccctgaagtttttgcacggaggt
                                                                        * 

Q0KFR9_MCL1-01          ------tcgtgaaaagcaacggcctcgataatcatttgtcagaccgaagc
A0A1S3NR66_MCL1-01      ------tcgtgaaaagcaacgtcctgggtaatcatatgtcagaccgaagc
A0A1S3NR66_MCL1-02      ------tcgtgaaaagcaacgtcctgggtaatcatatgtcagaccgaagc
C0HAD8_BCL2L1-01        gtc---tgtgggga----acagcagaagcaatttg---------------
A0A1S3MED7_BCL2L1-      gacgagtcctgggact---ccaccgcgacagtctc---------------
B5XAY3_BCL2L1-01        gacgagtcccgggactccaccaccacggcagtcgc---------------
A0A1S3LY44_BCL2-01      gccacggggccaataacgccagaccgggcagcgt----------------
A0A1S3R1W1_BCL2-01      gccacggggccaataacgccggcccgagcagcgt----------------
A0A1S3NIV8_BCL2-01      ccca---gcccaccgccgcgggcgaggacaccga----------------
A0A1S3Q9V5_BCL2-01      ccca---gccctccgctgaaggcgtggacactga----------------
                                                     *                    

Q0KFR9_MCL1-01          aacaatgacgac---------tctttgccgtgcactccccagatggcgtc
A0A1S3NR66_MCL1-01      aacgatgacgactctgacggttctttgccgtgcactccacagatggcttc
A0A1S3NR66_MCL1-02      aacgatgacgactctgacggttctttgccgtgcactccacagatggcttc
C0HAD8_BCL2L1-01        ---------------------gcgaagccctcatctccacag-------g
A0A1S3MED7_BCL2L1-      ---------------------cc----ccctcgtcccctcag-------c
B5XAY3_BCL2L1-01        ---------------------cc----ccctcctcccctcgg-------c
A0A1S3LY44_BCL2-01      ---------------------------cccccatctttccaaacggctct
A0A1S3R1W1_BCL2-01      ---------------------------ccctagtctttccaaatggctct
A0A1S3NIV8_BCL2-01      ---------------------------ccctccttaccaaaacaggagtc
A0A1S3Q9V5_BCL2-01      ---------------------------ctctccgctcccaaacaggatcc
                                                   *                      

Q0KFR9_MCL1-01          agaatgtgggcctgaactatcgaattgtccatcgggcgatgaagtattgg
A0A1S3NR66_MCL1-01      agaatgtgggcctgaactatcgaattgtccatcgggcgatgaagtattag
A0A1S3NR66_MCL1-02      agaatgtgggcctgaactatcgaattgtccatcgggcgatgaagtattag
C0HAD8_BCL2L1-01        g------gggcatggag------------------ccagtgaa-------
A0A1S3MED7_BCL2L1-      ggacaatgggcctggac------------------gcagtgaa-------
B5XAY3_BCL2L1-01        ggacagcgggcctggac------------------gcagtgaa-------
A0A1S3LY44_BCL2-01      cccaaacggacccgcat------------------gcagctattca----
A0A1S3R1W1_BCL2-01      cccaaccggacccgcat------------------gcagctattca----
A0A1S3NIV8_BCL2-01      cgcaacctgacccacat------------------gccaggctcca----
A0A1S3Q9V5_BCL2-01      cgcaaccggaccgacat------------------gcccggctcca----
                                * *    *                    *             

Q0KFR9_MCL1-01          aacatgataccagacaactcattgagaattttttgggggactacacagga
A0A1S3NR66_MCL1-01      aacatgatacaagacaactaattgaaaacttattgggggactatatagga
A0A1S3NR66_MCL1-02      aacatgatacaagacaactaattgaaaacttattgggggactatatagga
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A1S3MED7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A1S3LY44_BCL2-01      --------------------------------------------------
A0A1S3R1W1_BCL2-01      --------------------------------------------------
A0A1S3NIV8_BCL2-01      --------------------------------------------------
A0A1S3Q9V5_BCL2-01      --------------------------------------------------
                                                                          

Q0KFR9_MCL1-01          ctgtctcagcctcgatggacgcaaagcaagcctcttacgacgatgaagcg
A0A1S3NR66_MCL1-01      ctgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcg
A0A1S3NR66_MCL1-02      ctgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcg
C0HAD8_BCL2L1-01        ----------------agcagcactacgggactcagtggatga-------
A0A1S3MED7_BCL2L1-      ----------------agaggcattgcgggactctgccaacga-------
B5XAY3_BCL2L1-01        ----------------agaggcattgcgggactctgccaacga-------
A0A1S3LY44_BCL2-01      ----------------cagagttttgcgtgaggccggggacga-------
A0A1S3R1W1_BCL2-01      ----------------cagagttttgcgtgaggccggggatga-------
A0A1S3NIV8_BCL2-01      ----------------cagggtcctgcgcgatgcgggtggcga-------
A0A1S3Q9V5_BCL2-01      ----------------tagggtgctgcgcgaggcgggggacga-------
                                            *     *  *   *       **       

Q0KFR9_MCL1-01          agtggtggaggacgtaatagcaaagcaccgatacgcatacaatggtatgg
A0A1S3NR66_MCL1-01      agtggtgaaggatataatagcgaagcaccaatacgcatacaatggtatga
A0A1S3NR66_MCL1-02      agtggtgaaggatataatagcgaagcaccaatacgcatacaatg------
C0HAD8_BCL2L1-01        ----------gtttgagctgcgctacaccc--gcgccttcagtgacctct
A0A1S3MED7_BCL2L1-      ----------gtttgagctgcgttatgcca--gagcgttcagtgacctgt
B5XAY3_BCL2L1-01        ----------gtttgagctgcgttatgcca--gagcgttcagtgacctgt
A0A1S3LY44_BCL2-01      ----------actcgaacgac--tgtaccagcccgactttgcggagatgt
A0A1S3R1W1_BCL2-01      ----------actcgaaagac--tgtaccagcccgacttcgcagagatgt
A0A1S3NIV8_BCL2-01      ----------gattgaaagaa--tgtatcagcgggactttgcagagatgt
A0A1S3Q9V5_BCL2-01      ----------gattgaaataa--tgtatcagcgggactttgcagagatgt
                                       *            *     *  *     *      

Q0KFR9_MCL1-01          tcgccaaacttgacttggatgaccgatgcgatgacat----gggcgtcat
A0A1S3NR66_MCL1-01      tcgccaaacttgaactcgatgaccgaagcgacgacat----gagtttcat
A0A1S3NR66_MCL1-02      -------actt-------------------------------attttttt
C0HAD8_BCL2L1-01        cctcccagctccac----atcacccctgccacagcctaccacagctttga
A0A1S3MED7_BCL2L1-      cctcccagctgcac----atcacgccggccacagcctaccagagcttcga
B5XAY3_BCL2L1-01        cctcccagctacac----atcacgccgtccacagcctaccagagctttga
A0A1S3LY44_BCL2-01      cacaccaattgtat----ctcacgtcttctatggcagaaaggagattcag
A0A1S3R1W1_BCL2-01      cacaccagctgtat----ctcacatcctccacggctgagaggagatttag
A0A1S3NIV8_BCL2-01      cggggcagttgcat----tttacacccagcacggcacagagaaggtttac
A0A1S3Q9V5_BCL2-01      cggggcagttgcat----tttacgcccagtacagcacagagaaggtttac
                                 *                                    *   

Q0KFR9_MCL1-01          caattctgtggccaagaccatgttcagtgacgggatcacaaactggggtc
A0A1S3NR66_MCL1-01      caattctgtggccaagaccctgttcagtgatgggaccacgaactggggtc
A0A1S3NR66_MCL1-02      taggtatg-----atcaccctgttcagtgatgggaccacgaactggggtc
C0HAD8_BCL2L1-01        gagtgtgatggacgaag---tgttcagggacggggtc---aactggggtc
A0A1S3MED7_BCL2L1-      gaacgtgatggatgagg---ttttccgtgacggtgtg---aactggggac
B5XAY3_BCL2L1-01        gaacgtgatggacgagg---tgttccgggacggtgtc---aactggggac
A0A1S3LY44_BCL2-01      agaggtgatagacgagc---tgttcagggacggggtt---aactggggac
A0A1S3R1W1_BCL2-01      agaggtgatagacgagc---tgttcagggatggggtt---aactggggac
A0A1S3NIV8_BCL2-01      cgctgtaatagatgagc---tcttcagcgacggggta---aactggggtc
A0A1S3Q9V5_BCL2-01      tgctgtaatagaggagc---tcttccgcgacggtgta---aactggggtc
                                            * *** * ** **       ******** *

Q0KFR9_MCL1-01          gcatcgccagcctggtggcatttggag-------cagtggtgagccagca
A0A1S3NR66_MCL1-01      gcatcgccagcctggtggcatttggag-------cagtggtgagccagcg
A0A1S3NR66_MCL1-02      gcatcgccagcctggtggcatttggag-------cagtggtgagccagcg
C0HAD8_BCL2L1-01        gcgtggtgggtctgtttgctttcggcggggccttgtgtgttgagtgtgtt
A0A1S3MED7_BCL2L1-      gtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtg
B5XAY3_BCL2L1-01        gggtggtgggcctgttttccttcggaggggccctctgtgtagaatgtgtg
A0A1S3LY44_BCL2-01      gaattgtcgccttcttcgagttcgggggcacaatatgtgtggaatgcgtg
A0A1S3R1W1_BCL2-01      ggattatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtg
A0A1S3NIV8_BCL2-01      ggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtc
A0A1S3Q9V5_BCL2-01      ggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtc
                        *  *        *  *    ** ** *         * *  **    *  

Q0KFR9_MCL1-01          cctgaaggagaggggc------aggggacactgcgttgagttggtgggcc
A0A1S3NR66_MCL1-01      cttgaaggagatgggc------aggggacactgcattgagttggtgggcc
A0A1S3NR66_MCL1-02      cttgaaggagatgggc------aggggacactgcattgagttggtgggcc
C0HAD8_BCL2L1-01        -gagaaggatatgagcccactggtggcgcgcatcgcagactggatgacca
A0A1S3MED7_BCL2L1-      -gagaaggagatgagcccactagtgggacggattgcagactggatgactg
B5XAY3_BCL2L1-01        -gacaaggagatgaaccccttggtgggaaggatcacagactggatgaccg
A0A1S3LY44_BCL2-01      -aacaaggaaatgacgtcgcaggttgaccacatcgccgggtggatgacgg
A0A1S3R1W1_BCL2-01      -aacaaggagatgacgtcgcaggtggatcacatcgcggtgtggatgacag
A0A1S3NIV8_BCL2-01      -aaccgggagatgacgtcccaggtagacaacatcgctcgttggatgatgg
A0A1S3Q9V5_BCL2-01      -aaccgggagatgacgacccaggtagacaacattgcccattggatgacag
                              *** * *            *              * * **    

Q0KFR9_MCL1-01          aagagattgccaaatacctcc-tctctga--ccaaagtgactggctgatc
A0A1S3NR66_MCL1-01      aaaacatcgccacatacctcc-tctctga--ccaaagggactggctggtc
A0A1S3NR66_MCL1-02      aaaacatcgccacatacctcc-tctctga--ccaaagggactggctggtc
C0HAD8_BCL2L1-01        cctacctggacaaccatatccagccctggatccagag-----------cc
A0A1S3MED7_BCL2L1-      tctacctggacaaccacatccaaccctggatccagag-----------cc
B5XAY3_BCL2L1-01        tctacctggacaaccacatccagccctggatccagag-----------cc
A0A1S3LY44_BCL2-01      agtatctaaatggaccgctgcacagctggattcaa---------------
A0A1S3R1W1_BCL2-01      agtatctaaatggaccactgctcagctggattcag---------------
A0A1S3NIV8_BCL2-01      agtacttgaacggacccctacagaactggatccag---------------
A0A1S3Q9V5_BCL2-01      agtacctgaacggacccctgcagaactggatccag---------------
                           *  *           * *    ***    **                

Q0KFR9_MCL1-01          aaaaacaatgcttggaatggatttgtagagttctttcatgtaca------
A0A1S3NR66_MCL1-01      aaaaacaatgcttggaatggatttgttgagttctttcatgtgca------
A0A1S3NR66_MCL1-02      aaaaacaatgcttggaatggatttgttgagttctttcatgtgca------
C0HAD8_BCL2L1-01        aaggagga----tgggaccgttttgcagagatctttggcagagatgctgc
A0A1S3MED7_BCL2L1-      aaggagga----tgggaccggtttgcagaaatctttgggaaggacgctgc
B5XAY3_BCL2L1-01        aaggagga----tgggaccggtttgcagagatctttggaatggacgctgc
A0A1S3LY44_BCL2-01      gagaacgggggatgggaggcctttgttgagctctatgacagacagaggga
A0A1S3R1W1_BCL2-01      gagaacgggggatgggaggcctttgttgagctctatgacagacagaggga
A0A1S3NIV8_BCL2-01      gagaatggtggctgggacgcctttgtggagatctatgagcagcagaggat
A0A1S3Q9V5_BCL2-01      gagaatggtgactgggacgcctttgtggagatctatgggcagcagaggat
                         *  *       *** *    ****  **  *** *       *      

Q0KFR9_MCL1-01          -----agatcctgagtcctcagtaaggaacaccctcctagcctttgctgg
A0A1S3NR66_MCL1-01      -----agatccagagtcctcagtaaggaacgccctcatagcctttgctgg
A0A1S3NR66_MCL1-02      -----agatccagagtcctcagtaaggaacgccctcatagcctttgctgg
C0HAD8_BCL2L1-01        tgcagacgttcgacggtctcaggagagcataattaaatggctgctagttg
A0A1S3MED7_BCL2L1-      agctgagagcaggaagtctcaggagaactttaagaagtggttgctggcgg
B5XAY3_BCL2L1-01        agccgagagcaggaagtctcaggagagctttaagaagtggcttctggcag
A0A1S3LY44_BCL2-01      ctccgtgttctg-----ttcgtggccgtccatcaagactgtctttggcct
A0A1S3R1W1_BCL2-01      ctctgtgttctg-----ttcgtggccatccatcaagaccgtcttcggcct
A0A1S3NIV8_BCL2-01      ctct------ca-----ctcctggccgtacctaaagacagtgttcggcct
A0A1S3Q9V5_BCL2-01      ctctgtcttcca-----ctcctggccctacctaaagacagtgttcggcct
                                          **                   *          

Q0KFR9_MCL1-01          agttg---ctgga---attggg----------gcaacactcgccatgttc
A0A1S3NR66_MCL1-01      atttg---ctggg---cttggg----------gcaacgctcgccatgttg
A0A1S3NR66_MCL1-02      atttg---ctggg---cttggg----------gcaacgctcgccatgttg
C0HAD8_BCL2L1-01        gggtgattctgct---ttcaggagtgctggtcggcactctcatcatgaag
A0A1S3MED7_BCL2L1-      ggatgacgctggt---tacaggagtcatcgtagggtcactcattgctcag
B5XAY3_BCL2L1-01        ggatgaccctggt---cacaggagtcgtcgtagggtcactcttcgctcag
A0A1S3LY44_BCL2-01      ggctg-cactgggggctgcaagccttaccatcggagcttaccttacacag
A0A1S3R1W1_BCL2-01      ggctg-cactgggggccgcaagccttaccattggagcataccttacacag
A0A1S3NIV8_BCL2-01      ggccg-ccctgggagccgctggagtcaccatcggagccttgttcacccag
A0A1S3Q9V5_BCL2-01      ggccg-ccctgggtgcagccggagtcaccattggagcgttgttcatccag
                            *   ***          *          *   *             

Q0KFR9_MCL1-01          a---tcaggtga
A0A1S3NR66_MCL1-01      a---tcaggtga
A0A1S3NR66_MCL1-02      a---tcaggtga
C0HAD8_BCL2L1-01        aaacgccagtga
A0A1S3MED7_BCL2L1-      aaacgcctgtga
B5XAY3_BCL2L1-01        aaacgcctgtga
A0A1S3LY44_BCL2-01      a------agtga
A0A1S3R1W1_BCL2-01      a------agtga
A0A1S3NIV8_BCL2-01      a------agtga
A0A1S3Q9V5_BCL2-01      a------agtga
                        *       ****

© 1998-2022Legal notice