Dataset for CDS BCL-2-like of organism Salmo salar

[Download (right click)] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


Q0KFR9_MCL1-01        atgagyctgtcgaactcgattacacgagccacaactacgatgttgcattt
B5XAY3_BCL2L1-01      atgatgacttacaacaacagagaact------------ggtggtgtacta
C0HAD8_BCL2L1-01      ---atgtcttacagtaacagggaact------------ggtggtgttttt
                         *     *  *     *    **             * ** **   * 

Q0KFR9_MCL1-01        tcaaaatggaggatcttcgtacctagctgatgatgctaggccgttgtact
B5XAY3_BCL2L1-01      tat-----------------------------------tacctataaact
C0HAD8_BCL2L1-01      tat-----------------------------------aagctatagact
                      *                                        *  *  ***

Q0KFR9_MCL1-01        atttccagggggctggggccatatgtgctggggcgtcaccgaagtctaaa
B5XAY3_BCL2L1-01      atcacagagggactaccccttcaaccacatggagctcacggaagcccaga
C0HAD8_BCL2L1-01      gtcccagaggaattattcatgttgtcaattggggctggagggtgcaagtg
                       *  *   **   *                **   *    *  *      

Q0KFR9_MCL1-01        gtggactt-----gggaaatg----ggactggcgatactccaccacgac-
B5XAY3_BCL2L1-01      atcggactgaggtgggacagg----tggaagggggtgcggcagtcctaac
C0HAD8_BCL2L1-01      gacggactgagggagatgacgccattgcaaatgggtctgtggggaacagc
                         *   *      *   * *     *      * *           *  

Q0KFR9_MCL1-01        ---ccacgacgttaggagtgaatgtcgtgaaaagcaacggccttgataat
B5XAY3_BCL2L1-01      atacgtcaacgggacgagtcccgggac-----------------------
C0HAD8_BCL2L1-01      agaagc-aatttggcga---------------------------------
                              *      **                                 

Q0KFR9_MCL1-01        catttgtctgaccgaagcaacaatgacgactctt--tgccgtgcactccc
B5XAY3_BCL2L1-01      ----------------tccaccaccacggcagtcgcccccctcctcccc-
C0HAD8_BCL2L1-01      ------------------------------------agccctcatctcc-
                                                            ** *   * ** 

Q0KFR9_MCL1-01        cagatggcgtcagaatgtgggcctgaact-atcgaattgtcc--------
B5XAY3_BCL2L1-01      ------tcggcggacagcgggcctggacgcagtgaaagaggcattgcggg
C0HAD8_BCL2L1-01      ------aca------ggggggcatggagccagtgaaagcagcactacggg
                             *        * **** ** *   *  ***     *        

Q0KFR9_MCL1-01        -atcgggcgatgaagtattggaacatgataccagacaactcattgagaat
B5XAY3_BCL2L1-01      actctgccaacgagtttgagctgcgttatgccagagcgttcagtgac---
C0HAD8_BCL2L1-01      actcagtggatgagtttgagctgcgctacacccgcgccttcagtgac---
                        ** *   * **  *   *   *   *  ** *     *** ***    

Q0KFR9_MCL1-01        tttttgggggactacacaggactgtctcagcctcgatggacgcaaagcaa
B5XAY3_BCL2L1-01      --------------------------------------------------
C0HAD8_BCL2L1-01      --------------------------------------------------
                                                                        

Q0KFR9_MCL1-01        gcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcacc
B5XAY3_BCL2L1-01      --------------------------------------------------
C0HAD8_BCL2L1-01      --------------------------------------------------
                                                                        

Q0KFR9_MCL1-01        gatacgcatacaatggtatggtcgccaaacttgacttggatgaccgatgc
B5XAY3_BCL2L1-01      -----------------ctgtcctcccagctacacatc----acgccgtc
C0HAD8_BCL2L1-01      -----------------ctctcctcccagctccacatc----acccctgc
                                        *   * ** * **  ** *     **     *

Q0KFR9_MCL1-01        gatgac-atgggcgtcatcaattctgtggccaagaccatgttcagtgacg
B5XAY3_BCL2L1-01      cacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacg
C0HAD8_BCL2L1-01      cacagcctaccacagctttgagagtgtgatggacgaagtgttcagggacg
                       *   *         * *  *    ***    *     ***** * ****

Q0KFR9_MCL1-01        ggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtg
B5XAY3_BCL2L1-01      gtgtc---aactggggacgggtggtgggcctgttttccttcggaggggcc
C0HAD8_BCL2L1-01      gggtc---aactggggtcgcgtggtgggtctgtttgctttcggcggggcc
                      *  **   ******** **  * *   * *** *  * ** ** *  *  

Q0KFR9_MCL1-01        gtgagccagcacctgaaggagaggggcaggggacactgcgttgagttggt
B5XAY3_BCL2L1-01      ctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggat
C0HAD8_BCL2L1-01      ttgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcat
                       *  *     *       ** * **  * *   *     ** *      *

Q0KFR9_MCL1-01        gggccaagagattgccaaatacctcctctctgaccaaagtgactggctga
B5XAY3_BCL2L1-01      cacagactggatgaccgtctacctggacaaccacatccagccctggatcc
C0HAD8_BCL2L1-01      cgcagactggatgaccacctacctggacaaccatatccagccctggatcc
                           *   ***  **   *****   *    *         **** *  

Q0KFR9_MCL1-01        tcaaaaacaatgcttggaatggatttgtagagttctttcatgtacaagat
B5XAY3_BCL2L1-01      agagccaaggaggatgggaccggtttgcagagatctttggaatggacgct
C0HAD8_BCL2L1-01      agagccaaggaggatgggaccgttttgcagagatctttggcagagatgct
                        *   *    *  *** *  * **** **** *****       * * *

Q0KFR9_MCL1-01        cctgag-----------tcctcagtaaggaacaccctcctagccttt---
B5XAY3_BCL2L1-01      gcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggc
C0HAD8_BCL2L1-01      gctgcagacgttcgacggtctcaggagagcataattaaatggctgctagt
                       * *               ***** *  *          * **   *   

Q0KFR9_MCL1-01        -------------gctggagttgctggaattggggcaacactcgccatgt
B5XAY3_BCL2L1-01      agggatgaccctggtcacaggagtcgtcgtagggtcactcttcgctcaga
C0HAD8_BCL2L1-01      tggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
                                        **  *      * **  *     **     * 

Q0KFR9_MCL1-01        tcatcaggtga
B5XAY3_BCL2L1-01      aacgcctgtga
C0HAD8_BCL2L1-01      aacgccagtga
                          *  ****

© 1998-2024Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice