Dataset for CDS BCL-2-like of organism Coregonus sp balchen

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A6F9BEN5_MCL1-02      atgaatctgtcgaagtcgtttacacgagccacaactacgatgttgaatat
A0A6F8ZUL6_BCL2L1-      ---a---tgtc--------ttaca--------------------------
A0A6F9CY91_BCL2L1-      ---a---tgtc--------ttaca--------------------------
A0A6F9B188_BCL2L1-      atga---tgac--------ttaca--------------------------
A0A6F9BJ02_BCL2L1-      atga---tgac--------ttaca--------------------------
                           *   ** *        *****                          

A0A6F9BEN5_MCL1-02      tcaaaatggagtcgtcggaggatcttcgtaccctgctggtgctagccctt
A0A6F8ZUL6_BCL2L1-      gtaacagggaactggtggtgttttttataag----------------cta
A0A6F9CY91_BCL2L1-      gtaacagggaactggtagtgttttttataag----------------cta
A0A6F9B188_BCL2L1-      acaacagagaactggtggtttactatattac----------------cta
A0A6F9BJ02_BCL2L1-      acaacagagaactggtggaatactatattac----------------cta
                          ** *  **   *   *       *   *                 ** 

A0A6F9BEN5_MCL1-02      tgtactatttcggcgcgaatggggccgtatgtgctggggcgtcaccgaag
A0A6F8ZUL6_BCL2L1-      taaactgtcccagagaaattatccatgttgtcaattggtgctggagggtg
A0A6F9CY91_BCL2L1-      tagactgtcccagaggaattattcattttgtcaattggggctggagggtg
A0A6F9B188_BCL2L1-      taaactatcacagagagactaccccttcaaccacactgggctcacagaag
A0A6F9BJ02_BCL2L1-      taaactatcacagagggactaccccttcaatcacattgggctcacggaat
                        *  *** *  * * *  * *                 *   *    *   

A0A6F9BEN5_MCL1-02      tctaaagtagatactgacttgggaaatg-----ggactggcgatactcca
A0A6F8ZUL6_BCL2L1-      caagtggacgg-actga---gggggaag-----aagccattg--------
A0A6F9CY91_BCL2L1-      taagtggacgg-actga---gggagatg-----aggccattg--------
A0A6F9B188_BCL2L1-      ctcccagtcag-actga---ggggggtgagggtggacaggtg--------
A0A6F9BJ02_BCL2L1-      cccagagtcgg-actga---gggg---------ggaccggtg--------
                              *     *****   ***             *    *        

A0A6F9BEN5_MCL1-02      ccacgacccacgaagttagcagtgaatgtcgtgaaaagcaacgtcctaga
A0A6F8ZUL6_BCL2L1-      ------------------caaatgggtctttggggaa-------------
A0A6F9CY91_BCL2L1-      ------------------caaatgggtctgtggggaa-------------
A0A6F9B188_BCL2L1-      ------------------gaagggggggcggcagtca-------------
A0A6F9BJ02_BCL2L1-      ------------------gacgggagtgcggcagtca-------------
                                               *            *             

A0A6F9BEN5_MCL1-02      taatcatttgtcagaccgaagcaaca--------atgacgactctgacga
A0A6F8ZUL6_BCL2L1-      --------caacagg----aatggca---------gaagcaatttgggta
A0A6F9CY91_BCL2L1-      --------caacagg----aacagca---------gaagcaatttaggga
A0A6F9B188_BCL2L1-      --------cgacacaccccaacggcacagtaaacgggacgagtcctggga
A0A6F9BJ02_BCL2L1-      --------tgacatacgtcaactgcacaatgaacgggacgagtcctggta
                                   **      *    **           *  * *      *

A0A6F9BEN5_MCL1-02      ct----------------ctttgccgtgcactcctcagatggcgtcagag
A0A6F8ZUL6_BCL2L1-      ag---------------------ccttcatctccacag------------
A0A6F9CY91_BCL2L1-      ag---------------------ccctcatctccactg------------
A0A6F9B188_BCL2L1-      ct---ccaccgcgacagtctcccccctctacccctcag------------
A0A6F9BJ02_BCL2L1-      ctccaccaccacggcagtcacccccctcctcccctcgg------------
                                               ** *   * ** * *            

A0A6F9BEN5_MCL1-02      tgtgggcctgacatatcgaattgtccatcgggcgatgaagtattggaaca
A0A6F8ZUL6_BCL2L1-      ---------------------gg------gggcattgaggcagtgaaa--
A0A6F9CY91_BCL2L1-      ---------------------gg------gggaattgaggcagtgaaa--
A0A6F9B188_BCL2L1-      ---------------------cggacaatgggcctggatgcagtgaaa--
A0A6F9BJ02_BCL2L1-      ---------------------cggacagagggcctggacgcagtgaaa--
                                              *      ***    ** * * ** **  

A0A6F9BEN5_MCL1-02      tgataccagacaactcattgagaacgtcttgggggactacacaggactgt
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------

A0A6F9BEN5_MCL1-02      ctccgtctcgttggaagcaaagcaagactcttacgacgatgaagcgagtg
A0A6F8ZUL6_BCL2L1-      -------------gcagcactacgggactcagtggatga-----------
A0A6F9CY91_BCL2L1-      -------------gcagcactacgggactcagcggatga-----------
A0A6F9B188_BCL2L1-      -------------gaggcactgcgggactctgccaatga-----------
A0A6F9BJ02_BCL2L1-      -------------gaggcactgcgggactctgccaacga-----------
                                     *  ***   *  *****     * **           

A0A6F9BEN5_MCL1-02      gtggaggatgtaatagcgaagcaccgatacgcatacaatggtatgatcga
A0A6F8ZUL6_BCL2L1-      ------gtttgagctgcgctacaccc--gcgccttcagtgacctttcctc
A0A6F9CY91_BCL2L1-      ------gtttgagctgcgctacacca--gagccttcagtgacctcgcctc
A0A6F9B188_BCL2L1-      ------gtttgagctgcgttatgcca--gagcgttcagtgacctgtcctc
A0A6F9BJ02_BCL2L1-      ------gtttgagctgcgttatgcca--gagcgttcagtgacctggcctc
                              * *  *   ***     **     ** * ** **   *   *  

A0A6F9BEN5_MCL1-02      caaacttgactt------------ggatgatcgtagcgatgacatgagcg
A0A6F8ZUL6_BCL2L1-      ccagctccacatcacccctgccacagcctaccacagctttga---gagcg
A0A6F9CY91_BCL2L1-      ccaactccacatcacccctgccacagcctaccacagctttga---gagcg
A0A6F9B188_BCL2L1-      ccagctgcacatcacgccggccacagcctaccagagcttcga---gaacg
A0A6F9BJ02_BCL2L1-      ccagctgcacatcacgccgtccacagcctaccagagcttcga---gaacg
                        * * **  ** *             *   * *  ***   **   ** **

A0A6F9BEN5_MCL1-02      tcatcaagtctgtggccaagaccctgttcagtgatgggatcacgaactgg
A0A6F8ZUL6_BCL2L1-      tga---------tggacgaag---tgttcagggacggggt---caactgg
A0A6F9CY91_BCL2L1-      tga---------tggacgaag---tgttcagggacggggt---caactgg
A0A6F9B188_BCL2L1-      tga---------tggacgagg---ttttccgggacggtgt---gaactgg
A0A6F9BJ02_BCL2L1-      tga---------tggacgagg---tgttccgggacggtgt---gaactgg
                        * *         *** * *     * *** * ** **  *    ******

A0A6F9BEN5_MCL1-02      ggtcgcatcgccagcctagtggcatttggagcagtggtgagccagcacct
A0A6F8ZUL6_BCL2L1-      ggtcgcgtggtgggcctgtttgctttcggcggggccctgtgcattgagtg
A0A6F9CY91_BCL2L1-      ggccgcgtggtgggcctatttgcttttggcggggccctgtgtgttgaatg
A0A6F9B188_BCL2L1-      ggacgggtggtgggcctgtttgccttcggaggggccctctgtgtagagtg
A0A6F9BJ02_BCL2L1-      ggacgggtggttggcctgtttgccttcggaggggccctctgtgtagagtg
                        ** **  * *   ****  * ** ** ** *  *   *  *     *   

A0A6F9BEN5_MCL1-02      gaaggagaggggcaggggacactgcgttgagttggtgggccaagagatcg
A0A6F8ZUL6_BCL2L1-      tgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatgg
A0A6F9CY91_BCL2L1-      tgttgagaaggatatgagccccctggtggcacgcatcgcagactggatga
A0A6F9B188_BCL2L1-      cgtggagaaggagatgagcccactagtgggacggattgcagaatggatga
A0A6F9BJ02_BCL2L1-      tgtggacaaggagatgagccctctggtgggaaggatcacagactggatga
                            ** * **  * * * *     **        *     *   ***  

A0A6F9BEN5_MCL1-02      ccacatacct-------cctctctgaccaaagggactggct----ggtca
A0A6F8ZUL6_BCL2L1-      ccacctacctggacaaccatatccagcc-------ctggatccagagcca
A0A6F9CY91_BCL2L1-      ccacctacctggacaaccatatccagcc-------ctggatccagagcca
A0A6F9B188_BCL2L1-      ccgtctacctggacaaccacatccagcc-------ttggatccagagcca
A0A6F9BJ02_BCL2L1-      cagtctacctggacaaccacatccagcc-------ctggatccagagcca
                        *    *****       *   **   **        *** *     * **

A0A6F9BEN5_MCL1-02      aaaacaatgcatgga-----------------------------------
A0A6F8ZUL6_BCL2L1-      aggaggatggg---------------------------------------
A0A6F9CY91_BCL2L1-      aggaggatggg---------------------------------------
A0A6F9B188_BCL2L1-      aggaggatggatgaaagcagcgttttctctggggtcagctgagagagggg
A0A6F9BJ02_BCL2L1-      aggaggatgggtga------------------------------------
                        *  *  ***                                         

A0A6F9BEN5_MCL1-02      ---------------------------------------------atgga
A0A6F8ZUL6_BCL2L1-      ---------------------------------------------actgt
A0A6F9CY91_BCL2L1-      ---------------------------------------------accgt
A0A6F9B188_BCL2L1-      ttgtcctgttcctggtgggtgggtgtgttatgggatggaaggaggacact
A0A6F9BJ02_BCL2L1-      --------------------------------------------------

A0A6F9BEN5_MCL1-02      tttgtagagttctttcatgtgcagg-----------atccagagtcctca
A0A6F8ZUL6_BCL2L1-      tttgcggagatcttcggcagagatgcagctgcagacgtccgacggtccca
A0A6F9CY91_BCL2L1-      tttgcagagatctttggcagagatgctgctgcagatgtccgacggtccca
A0A6F9B188_BCL2L1-      gttaaagagatctttgggaaggacgctgcagccgagagcaggaagtctca
A0A6F9BJ02_BCL2L1-      --------------------------------------------------

A0A6F9BEN5_MCL1-02      gtaaggaacaccctcatagcctttgctggagttgctgggatt----gggg
A0A6F8ZUL6_BCL2L1-      ggagagcttaagaaaatggctgctagttggggtgatgctgctttcaggag
A0A6F9CY91_BCL2L1-      ggagagcgtaataaaatggctgctagttggggtgattctgttttcaggag
A0A6F9B188_BCL2L1-      ggagagctttaagaagtggctgctggcggggatgacgctggtcacaggag
A0A6F9BJ02_BCL2L1-      ----------------------------------------gtcacga---

A0A6F9BEN5_MCL1-02      caacactcgccatgttgatcag------------gtga
A0A6F8ZUL6_BCL2L1-      tactggtcggcactctcatcatgaagaaacgccagtga
A0A6F9CY91_BCL2L1-      tgctggtcggcactctcatcatgaagaaacgccagtga
A0A6F9B188_BCL2L1-      tcgtcgtagggtcactcatcgctcagaaacgcctgtga
A0A6F9BJ02_BCL2L1-      ----------------------------------ctga

© 1998-2021Legal notice