Dataset for CDS BCL-2-like of organism Prolemur simus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9DF25_BCL2A1-      atgagtg-------------------------------------------
A0A8C9A798_BCL2L10      atgggcg-------------------------------acccgcttaggg
A0A8C9AC52_BCL2-01      atggcgcacgctgggagaacagggtatgata-------------------
A0A8C8YP84_MCL1-01      atggacg----------------ggttattacccgcaaagccc-------
A0A8C9AD42_MCL1-01      -------------------gtgcg-----------caactct--------
A0A8C9AD42_MCL1-02      atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgg
A0A8C9AD42_MCL1-03      atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgg
A0A8C8YN28_BCL2L1-      atgtc-----------------------------tcagagca--------
A0A8C8YZD8_BCL2L2-      atggcga-------------ccccagcctcagccccagacac--------
A0A8C8YZD8_BCL2L2-      atggcgg-------------cggcggcggcggcggcagcagc--------
                                                                          

A0A8C9DF25_BCL2A1-      ---------actgcgagttcggg---------tacacccacaggctggcc
A0A8C9A798_BCL2L10      agcgcacggagcgg---ctgctggccgactacttggggta-----ttgcg
A0A8C9AC52_BCL2-01      ---------accgggagatagtgatgaagtacatccactataagctgtcg
A0A8C8YP84_MCL1-01      -----------------cccgcagcag-------aggc-----------g
A0A8C9AD42_MCL1-01      -----------------ccggaagctg-------ccgcccttttccc---
A0A8C9AD42_MCL1-02      gggggccggactgggagccggcagcgg-------cggcgccacccccccg
A0A8C9AD42_MCL1-03      gggggccggactgggagccggcagcgg-------cggcgccacccccccg
A0A8C8YN28_BCL2L1-      ---------accgggagctggtggttgactttctctcctacaagctttcc
A0A8C8YZD8_BCL2L2-      ---------a-cgggctctggtggcagactttgtaggctataagctgagg
A0A8C8YZD8_BCL2L2-      ---------agcgggggctgcgggcggtc----ggggctccgggccgggg
                                                                          

A0A8C9DF25_BCL2A1-      caggac--------------------------------------------
A0A8C9A798_BCL2L10      caagggagccg---------------------------------------
A0A8C9AC52_BCL2-01      cagaggggctatga------------------------------------
A0A8C8YP84_MCL1-01      gaagaggaccattt------------------------------------
A0A8C9AD42_MCL1-01      ---------ctttt------------------------------------
A0A8C9AD42_MCL1-02      ggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggt
A0A8C9AD42_MCL1-03      ggagggcggctttt------------------------------------
A0A8C8YN28_BCL2L1-      cagaaaggata---------------------------------------
A0A8C8YZD8_BCL2L2-      cagaagggtta---------------------------------------
A0A8C8YZD8_BCL2L2-      cggcggcgccatct------------------------------------
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      agggggaggggaagccggcacggtgattggcggaagccccggcgcaagcc
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      ccccggcctccctctcgccagacgcccggagggtcgcgcggccggcgccc
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      attggtgccgaggtccccgacgtcaccgcgacccccgaaaggctgctgtt
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      tttcgcgcccacccgccgcgcgttgccgtccgaggagatggaggcccctg
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      ccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccg
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
A0A8C8YZD8_BCL2L2-      --------------------------------------------------
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      gagcctctcgggaagcggcctgctgtcctgcctttactggagttggtcgg
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      ----------------------------cagctggagtcagt--------
A0A8C8YZD8_BCL2L2-      --------------------------tgtctgtggagctggccctgggga
A0A8C8YZD8_BCL2L2-      --------------------------tgtgcccggggccggt----gggg
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      -----------------------------gtgggatgccggagacgcagg
A0A8C8YP84_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      ggaggccagtaatggctccagcatggacgggtcactaccctcgacgccgc
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      ----------------------------------ttatcgatgcagaaga
A0A8C8YZD8_BCL2L2-      gggcccagcagctgaccc-----gctgcaccaagccatgcgggcagctgg
A0A8C8YZD8_BCL2L2-      aggccggggagggggccccggggggcgcaggggactacgggaacggcctg
                                                                          

A0A8C9DF25_BCL2A1-      --------------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      cgctgcgcc-------------cccgggggccgcccccgcgccgggtatc
A0A8C8YP84_MCL1-01      ----------------------------gtactggcagtcgctggagatt
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8C9AD42_MCL1-02      ctccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatt
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      gaacaggactgaggccccaga----agggactgaatcggagatgga----
A0A8C8YZD8_BCL2L2-      ggatgagtttga-gacccgcttccggcgtaccttctctgatctggcggct
A0A8C8YZD8_BCL2L2-      ----gagtctgaggaactggagcctggggagctgct----gctggagccc
                                                                          

A0A8C9DF25_BCL2A1-      -----------tacctgcagtatgtcctgcaggtaccgcagcccgggtcg
A0A8C9A798_BCL2L10      ------------------------------------ggcgccccggggcc
A0A8C9AC52_BCL2-01      ttctcttcccagcccgggcgcaccc-ccgctcccgctgcgcctcgggacc
A0A8C8YP84_MCL1-01      -----------atctctcagtactt-----------------ttgggagc
A0A8C9AD42_MCL1-01      ------------------------------------------------at
A0A8C9AD42_MCL1-02      -----------atctctcggtacct-----------------tcgggagc
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A8C8YN28_BCL2L1-      -----------gacccccagtgcca-ttaatggcaacccatcctggcacc
A0A8C8YZD8_BCL2L2-      cagctgcatgtgaccccgggctcagcccagcagcgcttcacccaggtctc
A0A8C8YZD8_BCL2L2-      gagccg-----gagcccgagcccga---agaggagc--cgccccggcccc
                                                                          

A0A8C9DF25_BCL2A1-      ggtc------------caaacaagacgtccagagtgctgcaaaa------
A0A8C9A798_BCL2L10      --gccaccgt-----------------cctcgctcgaggcagccatgctg
A0A8C9AC52_BCL2-01      cggccgccaggacctcgcccccggccgcccccgctgccgccgcg----gg
A0A8C8YP84_MCL1-01      aggcgaccgg------cgccaagg-------gcccaaaaccaat----gg
A0A8C9AD42_MCL1-01      gggattccg-----------------------------------------
A0A8C9AD42_MCL1-02      aggcaaccgg------cgccaagg-------aggcaaagccaat----gg
A0A8C9AD42_MCL1-03      -ggcaaccgg------cgccaagg-------aggcaaagccaat----gg
A0A8C8YN28_BCL2L1-      tggcagacag------ccctccag------cgaatggagccact----gg
A0A8C8YZD8_BCL2L2-      cgatgaactt------ttccaagggggccccaactggggccgccttgtgg
A0A8C8YZD8_BCL2L2-      ------gcgc------ccccccgggagctccgg--------gccctg-gg
                                                                          

A0A8C9DF25_BCL2A1-      -----catcgcattctcagtccaa--------------------------
A0A8C9A798_BCL2L10      cgc----------tccgccgccac--------------------------
A0A8C9AC52_BCL2-01      gcc-tgcgctcagcccggtgccac------------------ctgtggtc
A0A8C8YP84_MCL1-01      tca--------ggtttgggggcgc------------------cagc----
A0A8C9AD42_MCL1-01      --------------ctgacgccgc------------------c-------
A0A8C9AD42_MCL1-02      gca--------ggtctggggccgc------------------cagc----
A0A8C9AD42_MCL1-03      gca--------ggtctggggccgc------------------cagc----
A0A8C8YN28_BCL2L1-      cca-cagcagcagtttggatgcccgggaggtgatccctatggcagcagtg
A0A8C8YZD8_BCL2L2-      ccttcttcgtc--tttggggccgcactgtgtgctgagagcgtcaac----
A0A8C8YZD8_BCL2L2-      cct-----ggc--tcgggagcccc---------------cggcagc----
                                             *                            

A0A8C9DF25_BCL2A1-      ------------aacgaagttgaaaagcatctgaaac-------------
A0A8C9A798_BCL2L10      ------------caagatacggcgaaag----------------------
A0A8C9AC52_BCL2-01      cacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccg
A0A8C8YP84_MCL1-01      ------------aggaaggcgctagagaccttacgacgtgtcggggagag
A0A8C9AD42_MCL1-01      -----------------gccgcctaggacc--------------------
A0A8C9AD42_MCL1-02      ------------aggaaggcgctagagaccttacgacgtgtcggggacgg
A0A8C9AD42_MCL1-03      ------------aggaaggcgctagagaccttacgacgtgtcggggacgg
A0A8C8YN28_BCL2L1-      aagcaagcactgaaggaggcgggcgacgagtttgaactgcggtaccggcg
A0A8C8YZD8_BCL2L2-      ------------aaggagatggagccactggtgggacaagtgcaggagtg
A0A8C8YZD8_BCL2L2-      ------------caggaggaggaggaggagccgggactggtcgaggg---
                                                                          

A0A8C9DF25_BCL2A1-      -----------------------------catgcttggacaatttca---
A0A8C9A798_BCL2L10      -----------------------------cacgcgtccttcttctccgcc
A0A8C9AC52_BCL2-01      cgacttcgccga-----------------gatgtccagccagctgcacct
A0A8C8YP84_MCL1-01      tgtgcagcgcagacacgatattgccttccaaggcatggttcgcag-actg
A0A8C9AD42_MCL1-01      -------------------------------ggcatgcttcggaa-actg
A0A8C9AD42_MCL1-02      ggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaa-actg
A0A8C9AD42_MCL1-03      ggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaa-actg
A0A8C8YN28_BCL2L1-      ggcattcagtgacctga------------catcccagctccacatcacc-
A0A8C8YZD8_BCL2L2-      gatggtgacctacctggacacacggctggccgactggatccacagcagcg
A0A8C8YZD8_BCL2L2-      ---------cgacccgg------------------gggacggcgccattg
                                                                          

A0A8C9DF25_BCL2A1-      -atgttgcgtccatagatgctgccagaacagtgttcaatcaagtga----
A0A8C9A798_BCL2L10      tacgtcggctacccggggaaccgcgtctacctgatggagcggatgg----
A0A8C9AC52_BCL2-01      gacgcccttcaccgcgaggg----gacgctttgccacggtgg--------
A0A8C8YP84_MCL1-01      gacatcagaaacgtagatggtgtgaaagatttgtctgaagtgatggtctg
A0A8C9AD42_MCL1-01      gacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcca
A0A8C9AD42_MCL1-02      gacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcca
A0A8C9AD42_MCL1-03      gacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcca
A0A8C8YN28_BCL2L1-      ----ctagggac-agca---tatcaaagctttgaacaggtag--------
A0A8C8YZD8_BCL2L2-      ggggctgggagc-tggaagccatcaaagctcgggtcagggagatggagga
A0A8C8YZD8_BCL2L2-      aggacccggagc-tggaagccatcaaagctcgggtcagggagatggagga
                                   *                    *                 

A0A8C9DF25_BCL2A1-      --------------tggaaaaggaatttgaagatggcgtc---------a
A0A8C9A798_BCL2L10      --------------cggaggccgtgctctccaacagcctc----------
A0A8C9AC52_BCL2-01      --------------tggaggagctcttcagggatggggtg----------
A0A8C8YP84_MCL1-01      cg---------------------ttttgaatgagagcgta---------a
A0A8C9AD42_MCL1-01      tg---------------------ttttcagtgacggcgta---------a
A0A8C9AD42_MCL1-02      tg---------------------ttttcagtgacggcgta---------a
A0A8C9AD42_MCL1-03      tg---------------------ttttcagtgacggcgta---------a
A0A8C8YN28_BCL2L1-      --------------tgaatgaactcttccgggatggggta----------
A0A8C8YZD8_BCL2L2-      agaagctgagaagctaaaggagc---tacagaacgaggtagagaagcaga
A0A8C8YZD8_BCL2L2-      agaagctgagaagctaaaggagc---tacagaacgaggtagagaagcaga
                                                  *     *     *           

A0A8C9DF25_BCL2A1-      ttaactggggaa---------ggattg-tgaccg-----tatttgcattc
A0A8C9A798_BCL2L10      --agctggggcc---------gggtgg-tgatgc-----tcgtgaccttc
A0A8C9AC52_BCL2-01      --aactggggga---------ggattg-tggcct-----tctttgagttc
A0A8C8YP84_MCL1-01      taagctggggca---------ggatta-cgactc-----taatttctttt
A0A8C9AD42_MCL1-01      caaactggggca---------ggattg-tgactc-----taatttctttt
A0A8C9AD42_MCL1-02      caaactggggca---------ggattg-tgactc-----taatttctttt
A0A8C9AD42_MCL1-03      caaactggggca---------ggattg-tgactc-----taatttctttt
A0A8C8YN28_BCL2L1-      --aactggggtc---------gcattg-tggcct-----ttttctccttc
A0A8C8YZD8_BCL2L2-      tgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccatt
A0A8C8YZD8_BCL2L2-      tgaatatgagtccacctccaggcaatgctggcccagtgatcatgtccatt
                          *    * *           *       *         *  *     * 

A0A8C9DF25_BCL2A1-      g--------------gaggtattctcat--------------caagaaac
A0A8C9A798_BCL2L10      gcagggacgcttctagagagagggccgccggtga--------ccgcctgg
A0A8C9AC52_BCL2-01      g--------------gtgggg---------------------tcatgtgt
A0A8C8YP84_MCL1-01      g--------------gtgcctgtgtgg---------------cgaaacac
A0A8C9AD42_MCL1-01      g--------------gtgcctttgtgg---------------ccaaacac
A0A8C9AD42_MCL1-02      g--------------gtgcctttgtgg---------------ccaaacac
A0A8C9AD42_MCL1-03      g--------------gtgcctttgtgg---------------ccaaacac
A0A8C8YN28_BCL2L1-      g--------------gcgggg---------------------ccctatgc
A0A8C8YZD8_BCL2L2-      g--------------aagagaaaatggaggctgatgcccgttccatctac
A0A8C8YZD8_BCL2L2-      g--------------aagagaaaatggaggctgatgcccgttccatctac
                        *                *                                

A0A8C9DF25_BCL2A1-      ttctacaggagcggactgccctggatgtggatacttacaaggagatttct
A0A8C9A798_BCL2L10      tggaagaag-tgggacctca--ggccgcagctgaaggagagcgagac---
A0A8C9AC52_BCL2-01      gtggagagc-gtcaaccggg--agatgtcgcccctggtggacaacatcgc
A0A8C8YP84_MCL1-01      ttgaagagc-ataaatcaagaaagatgcatcgaaccattagcagaaa---
A0A8C9AD42_MCL1-01      ttgaagagc-ataaaccaagaaagctgcatcgaaccattagcagaaa---
A0A8C9AD42_MCL1-02      ttgaagagc-ataaaccaagaaagctgcatcgaaccattagcagaaa---
A0A8C9AD42_MCL1-03      ttgaagagc-ataaaccaagaaagctgcatcgaaccattagcagaaa---
A0A8C8YN28_BCL2L1-      gtggaaagc-gtagacaagg--agatgcaggtattggtgagtcggatcgc
A0A8C8YZD8_BCL2L2-      gttggcaat-gtggacta----cggtgcaacagcagaagagctggaagct
A0A8C8YZD8_BCL2L2-      gttggcaat-gtggacta----cggtgcaacagcagaagagctggaagct
                              *       *        *  *                       

A0A8C9DF25_BCL2A1-      tattttattg-------ctgagttcataatgaataacacaggagaatgga
A0A8C9A798_BCL2L10      -----------------cgaagtcgccagggactgccagcgcctggtggc
A0A8C9AC52_BCL2-01      cctgtggatgactgagtacc---tgaaccgg--cacctgcacacctgga-
A0A8C8YP84_MCL1-01      -------------gcatcacagacgttattg--taacgataaaacgtgac
A0A8C9AD42_MCL1-01      -------------gtatcacagacgttcttg--taaggacaaaacgagac
A0A8C9AD42_MCL1-02      -------------gtatcacagacgttcttg--taaggacaaaacgagac
A0A8C9AD42_MCL1-03      -------------gtatcacagacgttcttg--taaggacaaaacgagac
A0A8C8YN28_BCL2L1-      aacttggatgg-------ccacttacctgaa--tgacca-----------
A0A8C8YZD8_BCL2L2-      cactttcatggttgtggctcagtcaaccgtg--ttaccatactgtgtgac
A0A8C8YZD8_BCL2L2-      cactttcatggttgtggctcagtcaaccgtg--ttaccatactgtgtgac
                                                                          

A0A8C9DF25_BCL2A1-      ------------------------------------------tacggcaa
A0A8C9A798_BCL2L10      cctgctgtgcgctctgctcgcagggcagcaccgcgcctggctgcaggcgc
A0A8C9AC52_BCL2-01      ------------------------------------------tccaggat
A0A8C8YP84_MCL1-01      t---------------------ggctag--------------tcgaacaa
A0A8C9AD42_MCL1-01      t---------------------ggctag--------------tcaaacaa
A0A8C9AD42_MCL1-02      t---------------------ggctag--------------tcaaacaa
A0A8C9AD42_MCL1-03      t---------------------ggctag--------------tcaaacaa
A0A8C8YN28_BCL2L1-      ----------------cctagagccttggat-----------ccagg-ag
A0A8C8YZD8_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
A0A8C8YZD8_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
                                                                          

A0A8C9DF25_BCL2A1-      aacggaggctgggaacacggcttcg--------taaagaagttt------
A0A8C9A798_BCL2L10      aggg-cggctggg---atggcttt---------tgtgacttatt------
A0A8C9AC52_BCL2-01      aacggaggctggg---acgcctttg--------tggaattgtat------
A0A8C8YP84_MCL1-01      agag---gctggg---atgggtttg--------tggagtacttccatgta
A0A8C9AD42_MCL1-01      agag---gctggg---atgggtttg--------tggagttcttccatgta
A0A8C9AD42_MCL1-02      agag---gctggg---atgggtttg--------tggagttcttccatgta
A0A8C9AD42_MCL1-03      agag---gctggg---atgggtttg--------tggagttcttccatgta
A0A8C8YN28_BCL2L1-      aacggcggctggg---acacttttg--------tggaactctac------
A0A8C8YZD8_BCL2L2-      agagtcagtgagg---acttccctggccttagatgagtccctatttagag
A0A8C8YZD8_BCL2L2-      agagtcagtgagg---acttccctggccttagatgagtccctatttagag
                        *  *   *   **   *                *                

A0A8C9DF25_BCL2A1-      --gaac--------------------------------------------
A0A8C9A798_BCL2L10      --------------------------------------------------
A0A8C9AC52_BCL2-01      --ggcc---ccagcatgcggcctctatttgattt----------------
A0A8C8YP84_MCL1-01      gatgac---ctagaaggtga------------------------------
A0A8C9AD42_MCL1-01      gaggac---ctagaaggagg------------------------------
A0A8C9AD42_MCL1-02      gaggac---ctagaaggagg------------------------------
A0A8C9AD42_MCL1-03      gaggac---ctagaaggagg------------------------------
A0A8C8YN28_BCL2L1-      gggaacaatgcagcagctga---------gagccggaagggccagg----
A0A8C8YZD8_BCL2L2-      gaagacaaatca--aggtgatcccaaaacgaacc-aacagaccaggcatc
A0A8C8YZD8_BCL2L2-      gaagacaaatca--aggtgatcccaaaacgaacc-aacagaccaggcatc
                                                                          

A0A8C9DF25_BCL2A1-      ------ctagacctggctggctgacttttctg-----gaagttacagg--
A0A8C9A798_BCL2L10      ----caggagacccttaccgctagctgtttggaggagactg---ctgg--
A0A8C9AC52_BCL2-01      ----ctcctggc---tgtctctgaagactctgctcagcctggccctgg--
A0A8C8YP84_MCL1-01      ----catcagaaatgtgttgctggctg--ttgca---attgttgctgg--
A0A8C9AD42_MCL1-01      ----catcagaaatgtgctgctggctt--ttgca---ggtgttgctgg--
A0A8C9AD42_MCL1-02      ----catcagaaatgtgctgctggctt--ttgca---ggtgttgctgg--
A0A8C9AD42_MCL1-03      ----catcagaaatgtgctgctggctt--ttgca---ggtgttgctgg--
A0A8C8YN28_BCL2L1-      aacgcttcaaccgctggttcctgacgggcatg-----actgtggctgg--
A0A8C8YZD8_BCL2L2-      agcacaacagaccggggtttcccacgagcccgct---accgtgcccggac
A0A8C8YZD8_BCL2L2-      agcacaacagaccggggtttcccacgagcccgct---accgtgcccggac
                                            *          *        *   * **  

A0A8C9DF25_BCL2A1-      -----------------------------------------gaagatctg
A0A8C9A798_BCL2L10      -------------------cccaggttcttttgtcatgctttt-----ta
A0A8C9AC52_BCL2-01      ------------------------------------------------tg
A0A8C8YP84_MCL1-01      ----------------------------------------------aata
A0A8C9AD42_MCL1-01      ----------------------------------------------agta
A0A8C9AD42_MCL1-02      ----------------------------------------------agta
A0A8C9AD42_MCL1-03      ----------------------------------------------agta
A0A8C8YN28_BCL2L1-      ----------------------------------cgtggttctg------
A0A8C8YZD8_BCL2L2-      taccaactacaacagttcccgctctcgattctacagtggttttaacagca
A0A8C8YZD8_BCL2L2-      taccaactacaacagttcccgctctcgattctacagtggttttaacagca
                                                                          

A0A8C9DF25_BCL2A1-      tgacatgctgtccctcct---------caacta--------ctga-----
A0A8C9A798_BCL2L10      gcaacggctgtcatctatttctgtacacgatta------ttatga-----
A0A8C9AC52_BCL2-01      ggagcttgcatcaccctg---ggtgcctatctgggccacaagtga-----
A0A8C8YP84_MCL1-01      gcagctggtttggtgtat--------ctatcta------atgggatgacc
A0A8C9AD42_MCL1-01      ggagctggtttggca------------tatcta------ataagatag--
A0A8C9AD42_MCL1-02      ggagctggtttggca------------tatcta------ataagatag--
A0A8C9AD42_MCL1-03      ggagctggtttggca------------tatcta------ataagatag--
A0A8C8YN28_BCL2L1-      ----ctgggctcgctttt--------cagtcgg------aaatga-----
A0A8C8YZD8_BCL2L2-      ggccccggggtcgcgtctacaggggccgggcta------gagcgacatca
A0A8C8YZD8_BCL2L2-      ggccccggggtcgcgtctacaggggccgggcta------gagcgacatca
                                  *                                **     

A0A8C9DF25_BCL2A1-      ------------------
A0A8C9A798_BCL2L10      ------------------
A0A8C9AC52_BCL2-01      ------------------
A0A8C8YP84_MCL1-01      ttctaa------------
A0A8C9AD42_MCL1-01      ------------------
A0A8C9AD42_MCL1-02      ------------------
A0A8C9AD42_MCL1-03      ------------------
A0A8C8YN28_BCL2L1-      ------------------
A0A8C8YZD8_BCL2L2-      tggtattccccttactaa
A0A8C8YZD8_BCL2L2-      tggtattccccttactaa
                                          

© 1998-2023Legal notice