Dataset for CDS BCL-2-like of organism Prolemur simus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A8C8YN28_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Prolemur simus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcagacagccctccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccctatggcagcagtgaagcaagcactgaaggaggcgggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C8YP84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=600 residues).
atggacgggttattacccgcaaagccccccgcagcagaggcggaagaggaccatttgtactggcagtcgctggagattat
ctctcagtacttttgggagcaggcgaccggcgccaagggcccaaaaccaatggtcaggtttgggggcgccagcaggaagg
cgctagagaccttacgacgtgtcggggagagtgtgcagcgcagacacgatattgccttccaaggcatggttcgcagactg
gacatcagaaacgtagatggtgtgaaagatttgtctgaagtgatggtctgcgttttgaatgagagcgtaataagctgggg
caggattacgactctaatttcttttggtgcctgtgtggcgaaacacttgaagagcataaatcaagaaagatgcatcgaac
cattagcagaaagcatcacagacgttattgtaacgataaaacgtgactggctagtcgaacaaagaggctgggatgggttt
gtggagtacttccatgtagatgacctagaaggtgacatcagaaatgtgttgctggctgttgcaattgttgctggaatagc
agctggtttggtgtatctatctaatgggatgaccttctaa
>gnl|bcl2dbcds|A0A8C8YZD8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Prolemur simus GN=BCL2L2 (length=1002 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggccctggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggggatgagtttg
agacccgcttccggcgtaccttctctgatctggcggctcagctgcatgtgaccccgggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggccgcactgtg
tgctgagagcgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtgacctacctggacacacggc
tggccgactggatccacagcagcgggggctgggagctggaagccatcaaagctcgggtcagggagatggaggaagaagct
gagaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaagagaaaatggaggctgatgcccgttccatctacgttggcaatgtggactacggtgcaacagcagaag
agctggaagctcactttcatggttgtggctcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctatttagaggaag
acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctacc
gtgcccggactaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctac
aggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C8YZD8_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Prolemur simus GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctggggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctgggcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
cgacccgggggacggcgccattgaggacccggagctggaagccatcaaagctcgggtcagggagatggaggaagaagctg
agaagctaaaggagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgatc
atgtccattgaagagaaaatggaggctgatgcccgttccatctacgttggcaatgtggactacggtgcaacagcagaaga
gctggaagctcactttcatggttgtggctcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctatttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctaccg
tgcccggactaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A8C9A798_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Prolemur simus GN=BCL2L10 (length=579 residues).
atgggcgacccgcttagggagcgcacggagcggctgctggccgactacttggggtattgcgcaagggagccgggcgcccc
ggggccgccaccgtcctcgctcgaggcagccatgctgcgctccgccgccaccaagatacggcgaaagcacgcgtccttct
tctccgcctacgtcggctacccggggaaccgcgtctacctgatggagcggatggcggaggccgtgctctccaacagcctc
agctggggccgggtggtgatgctcgtgaccttcgcagggacgcttctagagagagggccgccggtgaccgcctggtggaa
gaagtgggacctcaggccgcagctgaaggagagcgagaccgaagtcgccagggactgccagcgcctggtggccctgctgt
gcgctctgctcgcagggcagcaccgcgcctggctgcaggcgcagggcggctgggatggcttttgtgacttattcaggaga
cccttaccgctagctgtttggaggagactgctggcccaggttcttttgtcatgctttttagcaacggctgtcatctattt
ctgtacacgattattatga
>gnl|bcl2dbcds|A0A8C9AC52_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Prolemur simus GN=BCL-2 (length=711 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctatgagtgggatgccggagacgcaggcgctgcgcccccgggggccgcccccgcgccgggtatcttctcttcccagcccg
ggcgcacccccgctcccgctgcgcctcgggacccggccgccaggacctcgcccccggccgcccccgctgccgccgcgggg
cctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggcgggcgatgacttctcccgccgctaccgccg
cgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggacgcctttgtggaattgtatggccccagcatgcggcctctatttgatttctcctggctgtctc
tgaagactctgctcagcctggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
>gnl|bcl2dbcds|A0A8C9AD42_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=441 residues).
gtgcgcaactctccggaagctgccgcccttttccccttttatgggattccgctgacgccgccgccgcctaggaccggcat
gcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcg
taacaaactggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaa
agctgcatcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagagg
ctgggatgggtttgtggagttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtg
ttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C9AD42_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgggggggccggactgggagccggcagcggcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctctcgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgaaaggctgctgtttttcgcgcccacccgccgcgcgttgcc
gtccgaggagatggaggcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggcctgctgtcctgcctttactggagttggtcggggaggccagtaatggctccagcatggacgggtcacta
ccctcgacgccgcctccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggaggcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C9AD42_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgggggggccggactgggagccggcagcggcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggaggcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C9DF25_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Prolemur simus GN=BCL2A1 (length=522 residues).
atgagtgactgcgagttcgggtacacccacaggctggcccaggactacctgcagtatgtcctgcaggtaccgcagcccgg
gtcgggtccaaacaagacgtccagagtgctgcaaaacatcgcattctcagtccaaaacgaagttgaaaagcatctgaaac
catgcttggacaatttcaatgttgcgtccatagatgctgccagaacagtgttcaatcaagtgatggaaaaggaatttgaa
gatggcgtcattaactggggaaggattgtgaccgtatttgcattcggaggtattctcatcaagaaacttctacaggagcg
gactgccctggatgtggatacttacaaggagatttcttattttattgctgagttcataatgaataacacaggagaatgga
tacggcaaaacggaggctgggaacacggcttcgtaaagaagtttgaacctagacctggctggctgacttttctggaagtt
acagggaagatctgtgacatgctgtccctcctcaactactga
© 1998-2023Legal notice