Dataset for CDS BCL-2-like of organism Neovison vison

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C7BPR9_BCL2L1-      atgtc-------tcagagcaaccggg--------------agctggtggt
A0A8C7BPR9_BCL2L1-      atgtc-------tcagagcaaccggg--------------agctggtggt
A0A8C7B9K2_BCL2-01      atggcgcac---gctgggagaacagggtatgataaccgggagatagtgat
U6CQS8_BCL2A1-01        atgacag-----acggtgagttcggg------------------------
A0A8C7AU04_BCL2L10      atggcggac---gcgttga----ggg------------------------
A0A8C7EW82_BCL2L2-      atggcgaccccggcctcagccccaga------------------------
A0A8C7BMW8_MCL1-01      atg-----tttggcctcaa---aaga------------------------
A0A8C7BMW8_MCL1-02      atg-----tttggcctcaa---aaga------------------------
                        ***          *          *                         

A0A8C7BPR9_BCL2L1-      tgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
A0A8C7BPR9_BCL2L1-      tgactttctctcctacaagctttcccagaaaggatacagctggagtcagt
A0A8C7B9K2_BCL2-01      gaagtacatccactataagctgtcgcagaggggctacgagtgggatgccg
U6CQS8_BCL2A1-01        --------tacacg-----ctgtcgctggctcaggac-------------
A0A8C7AU04_BCL2L10      --------agcgcacggcgcagctgctgaccgactac-------------
A0A8C7EW82_BCL2L2-      --------cacacgggctctagtggc--ag-----ac-------------
A0A8C7BMW8_MCL1-01      --------aacgcagtaatcggactc--aacctctac-------------
A0A8C7BMW8_MCL1-02      --------aacgcagtaatcggactc--aacctctac-------------
                                    *            *         **             

A0A8C7BPR9_BCL2L1-      ttagtgatgcagaagagaacagaactgaggccccagaagggactgaatca
A0A8C7BPR9_BCL2L1-      ttagtgatgcagaagagaacagaactgaggccccagaagggactgaatca
A0A8C7B9K2_BCL2-01      gcgacg------------------------------------------cg
U6CQS8_BCL2A1-01        ----ta------------------------------------------cg
A0A8C7AU04_BCL2L10      ----ct------------------------------------------gg
A0A8C7EW82_BCL2L2-      ----tt------------------------------------------tg
A0A8C7BMW8_MCL1-01      ----tg------------------------------------------tg
A0A8C7BMW8_MCL1-02      ----tg------------------------------------------tg

A0A8C7BPR9_BCL2L1-      gagatggagacccccagtgccatca-------atggcaacccatcctggc
A0A8C7BPR9_BCL2L1-      gagatggagacccccagtgccatca-------atggcaacccatcctggc
A0A8C7B9K2_BCL2-01      ggcgccgcgccccc-gggggccgcccccgcgccgggcatcttctcctccc
U6CQS8_BCL2A1-01        tgaggcatgtcctgcagatcccgcagcccggcccggc--cgccagcagag
A0A8C7AU04_BCL2L10      agtattgcgcccgc-ggccccggcacccccgcgcggt--cgccgtctacg
A0A8C7EW82_BCL2L2-      taggctataagctg-a-----ggca-----gaaggg-------ttatgtt
A0A8C7BMW8_MCL1-01      ggggggccgggctg-ggggccggca-----gcggggg--cgcctcctctt
A0A8C7BMW8_MCL1-02      ggggggccgggctg-ggggccggca-----gcggggg--cgcctcctctt
                                   *           *          **              

A0A8C7BPR9_BCL2L1-      acttggcggacagccctgcggtgaatggagccactggccacagcagcagc
A0A8C7BPR9_BCL2L1-      acttggcggacagccctgcggtgaatggagccactggccacagcagcagc
A0A8C7B9K2_BCL2-01      agcccgggcgcacccccgcgccc---------------------------
U6CQS8_BCL2A1-01        tgtcccg----ggtcctgcg------------------------------
A0A8C7AU04_BCL2L10      cgcgaggccgcggtgctgcgctc---------------------------
A0A8C7EW82_BCL2L2-      tgtggag--ctggccctggg------------------------------
A0A8C7BMW8_MCL1-01      cgggagg--gcggcttttggcttcggggaaggaggccacggcccggcggg
A0A8C7BMW8_MCL1-02      cgggagg--gcggctttt--------------------------------

A0A8C7BPR9_BCL2L1-      tt------------------------------------------------
A0A8C7BPR9_BCL2L1-      tt------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      aggtagggggaggggaagccggtgcggtgattggcggaagcgccggcgcg
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      agtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctc
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      gcccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgc
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      tgttcttcgagcctacccgccgcgcgtcgccgcctgaagagatggaaggc
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      ccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacga
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      gccggaacctttggggaagaggcctgctgtcctgcctttgctggagttgg
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      tgggggaggccagcagtggcccctgcacggacggctcactgccctcgacg
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A8C7B9K2_BCL2-01      --------------------------------------------------
U6CQS8_BCL2A1-01        --------------------------------------------------
A0A8C7AU04_BCL2L10      --------------------------------------------------
A0A8C7EW82_BCL2L2-      --------------------------------------------------
A0A8C7BMW8_MCL1-01      ccacccccagcagaggaggaggaagacgagttgtaccggcagtccctgga
A0A8C7BMW8_MCL1-02      --------------------------------------------------

A0A8C7BPR9_BCL2L1-      ---------------------------------ggatgcccgggaggtga
A0A8C7BPR9_BCL2L1-      ---------------------------------ggatgcccgggaggtga
A0A8C7B9K2_BCL2-01      -------gccaggacctcgccgcccccgccccccgccgccctcgccgccg
U6CQS8_BCL2A1-01        ---------------------------------ggacgtg------gcct
A0A8C7AU04_BCL2L10      ---------------------------------ggtggcc------gccg
A0A8C7EW82_BCL2L2-      ---------------------------------gagggcccagca-gctg
A0A8C7BMW8_MCL1-01      gattatttctcggtacctgcgggagcaggcaacgggcgccaaggacgcga
A0A8C7BMW8_MCL1-02      ---------------------------ggcaacgggcgccaaggacgcga
                                                             *        *   

A0A8C7BPR9_BCL2L1-      tccccatggcagcggtaaagcaagcgctaag-----------------gg
A0A8C7BPR9_BCL2L1-      tccccatggcagcggtaaagcaagcgctaag-----------------gg
A0A8C7B9K2_BCL2-01      --ct----gccgccgcgggccctgcgctcagcccggtgccacctgtggtc
U6CQS8_BCL2A1-01        cctc----cgtgcagcggg-------------------------------
A0A8C7AU04_BCL2L10      acgt----gcggcagcgtcacgagcgct--------------------tc
A0A8C7EW82_BCL2L2-      accc----actgcaccaagcc--atgcg--------------------gg
A0A8C7BMW8_MCL1-01      aacc----actg-ggcgggcctggggct--------------------gc
A0A8C7BMW8_MCL1-02      aacc----actg-ggcgggcctggggct--------------------gc

A0A8C7BPR9_BCL2L1-      aggctggggatgagtttgaactgaggtacc----------------ggcg
A0A8C7BPR9_BCL2L1-      aggctggggatgagtttgaactgaggtacc----------------ggcg
A0A8C7B9K2_BCL2-01      cacctgaccctgcgccaggccggcgacgacttctcccgtcgctaccgccg
U6CQS8_BCL2A1-01        -aggtggaacagaactt-------gaaaccatgcttggacagctttgacg
A0A8C7AU04_BCL2L10      ttgtcgga------tta------------c---------cgcggctaccg
A0A8C7EW82_BCL2L2-      cagctggagatgagttt-------gagacc---------cgcttccggcg
A0A8C7BMW8_MCL1-01      cagccgga-aggcgtta-------gagacc---------c---tccgacg
A0A8C7BMW8_MCL1-02      cagccgga-aggcgtta-------gagacc---------c---tccgacg
                             *                       *                  **

A0A8C7BPR9_BCL2L1-      ggcattcagtgacctga--catctcagcttcacatcacc---------cc
A0A8C7BPR9_BCL2L1-      ggcattcagtgacctga--catctcagcttcacatcacc---------cc
A0A8C7B9K2_BCL2-01      cgacttcgcgga-gatgtccagc-cagctgcacctgacgcccttc-----
U6CQS8_BCL2A1-01        tg------------gggtccatcgacactgc-cagaaccatcttcaatca
A0A8C7AU04_BCL2L10      cg---------------------gcaaccgcgtggagctggtggc---tc
A0A8C7EW82_BCL2L2-      taccttctctgatttgg--cagcccagctgcatgtgac------c---cc
A0A8C7BMW8_MCL1-01      gg---tcggggacggggtacagcgcaac--cacgagacggccttc---ca
A0A8C7BMW8_MCL1-02      gg---tcggggacggggtacagcgcaac--cacgagacggccttc---ca
                                                   *  *      *            

A0A8C7BPR9_BCL2L1-      cgggacagcgtatcagagctttgagcaggtggtgaacgaact--------
A0A8C7BPR9_BCL2L1-      cgggacagcgtatcagagctttgagcaggtggtgaacgaact--------
A0A8C7B9K2_BCL2-01      ----accgcgaggggacgctttgccacggtggtggaggagct--------
U6CQS8_BCL2A1-01        agtcatggaaaaggaa----------------------------------
A0A8C7AU04_BCL2L10      agg--tggagcgggagatactcgcccac----------------------
A0A8C7EW82_BCL2L2-      aggctcggcccagcagcgcttcacccaggtctctgacgaactc-------
A0A8C7BMW8_MCL1-01      aggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctt
A0A8C7BMW8_MCL1-02      aggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctt

A0A8C7BPR9_BCL2L1-      ----------------------cttccgggatgggg---tgaactggggt
A0A8C7BPR9_BCL2L1-      ----------------------cttccgggatgggg---tgaactggggt
A0A8C7B9K2_BCL2-01      ----------------------cttcagggatgggg---tgaactggggg
U6CQS8_BCL2A1-01        ----------------------tttgaa-gacggcatcattaactggggg
A0A8C7AU04_BCL2L10      ----------------------ccccaa-------gccctaagctggggc
A0A8C7EW82_BCL2L2-      ----------------------ttccaa----gggggccccaactggggc
A0A8C7BMW8_MCL1-01      tgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggc
A0A8C7BMW8_MCL1-02      tgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggc
                                                                 * ****** 

A0A8C7BPR9_BCL2L1-      cgcattgtggcctttttctccttcggtggggctctg-tgcg---------
A0A8C7BPR9_BCL2L1-      cgcattgtggcctttttctccttcggtggggctctg-tgcg---------
A0A8C7B9K2_BCL2-01      aggattgtggccttctttgagttcggtggggtcatg-tgtg---------
U6CQS8_BCL2A1-01        aggattgtgaccgtatttgcctttgaaggcattctc-tccaagaagctcc
A0A8C7AU04_BCL2L10      cgtgtggtggcgctcttgaccttcgcgggaacgctgctggagcgcccgcc
A0A8C7EW82_BCL2L2-      cgccttgtggccttctttgtctttggagccgcactg-tgtg---------
A0A8C7BMW8_MCL1-01      aggattgtgactcttatttcttttggtgc----ctt-tgtggccaaacac
A0A8C7BMW8_MCL1-02      aggattgtgactcttatttcttttggtgc----ctt-tgtggccaaacac
                         *  * *** *  *  *    ** *  *      *  *            

A0A8C7BPR9_BCL2L1-      -tggagagcgtagacaaggag------atgcaggcattggtgagtcggat
A0A8C7BPR9_BCL2L1-      -tggagagcgtagacaaggag------atgcaggcattggtgagtcggat
A0A8C7B9K2_BCL2-01      -tggagagcgtcaaccgggag------atgtcgcccctggtggacaacat
U6CQS8_BCL2A1-01        tccgggag------cgaatttccccggacgtggatgcttccagg----gt
A0A8C7AU04_BCL2L10      gccgggggcctgctcgaa--------cttggggccggacgcgga----ac
A0A8C7EW82_BCL2L2-      -ctgagagtgtcaacaaagag------atggagccacttgtggg----cc
A0A8C7BMW8_MCL1-01      ttgaagagtataaaccaagaaagctgcatcgaaccattagcaga------
A0A8C7BMW8_MCL1-02      ttgaagagtataaaccaagaaagctgcatcgaaccattagcaga------
                             * *      *                                   

A0A8C7BPR9_BCL2L1-      cgcaacttggatggccact--------tacctgaacga-----ccaccta
A0A8C7BPR9_BCL2L1-      cgcaacttggatggccact--------tacctgaacga-----ccaccta
A0A8C7B9K2_BCL2-01      cgccctatggatgactgag--------tacctgaa-----ccggcacttg
U6CQS8_BCL2A1-01        ttcttactttgtggcagag--------ttcatcacgac-----aaacatg
A0A8C7AU04_BCL2L10      tggagctgggggagtgggaggccaccgttcgccaggactgccggcgcctg
A0A8C7EW82_BCL2L2-      aagtgcaagagtggatggtggcc----tacctggagac-----gcggctg
A0A8C7BMW8_MCL1-01      ------aagcatcacagatgttc----t-cgtaaggac-----aaaacga
A0A8C7BMW8_MCL1-02      ------aagcatcacagatgttc----t-cgtaaggac-----aaaacga
                                                   * *                    

A0A8C7BPR9_BCL2L1-      gagccttggatccaggagaacggcggctgggac---actttcgtggaact
A0A8C7BPR9_BCL2L1-      gagccttggatccaggagaacggcggctggg-------------------
A0A8C7B9K2_BCL2-01      cacacctggatccaggacaacggaggctgggat---gcctttgtggagct
U6CQS8_BCL2A1-01        agggagtggataagacaaaacggaggctgggaggacggctttgtaaagaa
A0A8C7AU04_BCL2L10      gtggacttcct---------------ctgcggt---cggctcgcagggca
A0A8C7EW82_BCL2L2-      gccgactggatccacagcagtgggggctgggcg---gagttcacagctct
A0A8C7BMW8_MCL1-01      ---gactggctagtcaaacaaagaggctgggat---gggtttgtggagtt
A0A8C7BMW8_MCL1-02      ---gactggctagtcaaacaaagaggctgggat---gggtttgtggagtt
                              *   *               *** *                   

A0A8C7BPR9_BCL2L1-      ctacgggaacaatgcagcag-----------ccgagagccggaagggcca
A0A8C7BPR9_BCL2L1-      -------------------------------------tccggactggctt
A0A8C7B9K2_BCL2-01      gtacggccccag---------------------------cgtgcagcctc
U6CQS8_BCL2A1-01        gttcgagcccaagtccggctggctgacctttctggaagttacaggaaaga
A0A8C7AU04_BCL2L10      gcaccgcgcctgg------------------ctggagg-cgcacggcggc
A0A8C7EW82_BCL2L2-      atacggggacggggcc---------------ctggaggaggcgcggcgtc
A0A8C7BMW8_MCL1-01      cttccatgtagaggac---------------ctagaag----gtggcatc
A0A8C7BMW8_MCL1-02      cttccatgtagaggac---------------ctagaag----gtggcatc

A0A8C7BPR9_BCL2L1-      --------------------------ggagcgcttcaaccgctggttcct
A0A8C7BPR9_BCL2L1-      --------------------------a------ttttaccccgagttcct
A0A8C7B9K2_BCL2-01      tgtttgacttctcctggctgtccctgaaggccctgctcagtctggccctg
U6CQS8_BCL2A1-01        tctg----------------------tgaaatgttct------ctctcct
A0A8C7AU04_BCL2L10      --tgggatggcttttgtctcttcttcacacccgtgctgct---gtcttct
A0A8C7EW82_BCL2L2-      tgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtg
A0A8C7BMW8_MCL1-01      --------------------------agaaatgtgctgct---ggctttt
A0A8C7BMW8_MCL1-02      --------------------------agaaatgtgctgct---ggctttt

A0A8C7BPR9_BCL2L1-      g-acaggcatgactgtggctgg-------cgtggttctgctgggctcact
A0A8C7BPR9_BCL2L1-      g-gcacacg-gcctgaggttgg-----gtaagggcttagccagcat--ct
A0A8C7B9K2_BCL2-01      gtgggagcttgcatcaccctgg---------gtgcctacctgg-----gc
U6CQS8_BCL2A1-01        gaagcaatac------tactga----------------------------
A0A8C7AU04_BCL2L10      tggaaaagac------tgctgg------tccaggctcttctgtcatgctt
A0A8C7EW82_BCL2L2-      gcactggggg------ccctggtaactgtaggggccttttttg-----ct
A0A8C7BMW8_MCL1-01      gca--ggtgt------tgctgg----agtaggagctggtttggcatatct
A0A8C7BMW8_MCL1-02      gca--ggtgt------tgctgg----agtaggagctggtttggcatatct

A0A8C7BPR9_BCL2L1-      cttca--------------gtcggaaatga--------------
A0A8C7BPR9_BCL2L1-      gctca--------------gt-gaacatgaagggttattattag
A0A8C7B9K2_BCL2-01      cacaa----------------------------------gtga-
U6CQS8_BCL2A1-01        --------------------------------------------
A0A8C7AU04_BCL2L10      tacggcagtgatcttaatctacttctggaaaagattaccgtga-
A0A8C7EW82_BCL2L2-      agcaa----------------------------------gtga-
A0A8C7BMW8_MCL1-01      aataa----------------------------------gatag
A0A8C7BMW8_MCL1-02      aataa----------------------------------gatag

© 1998-2023Legal notice