Dataset for CDS BCL-2-like of organism Neovison vison

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C7AU04_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Neovison vison GN=BCL2L10 (length=582 residues).
atggcggacgcgttgagggagcgcacggcgcagctgctgaccgactacctggagtattgcgcccgcggccccggcacccc
cgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgccgacgtgcggcagcgtcacgagcgcttct
tgtcggattaccgcggctaccgcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccaa
gccctaagctggggccgtgtggtggcgctcttgaccttcgcgggaacgctgctggagcgcccgccgccgggggcctgctc
gaacttggggccggacgcggaactggagctgggggagtgggaggccaccgttcgccaggactgccggcgcctggtggact
tcctctgcggtcggctcgcagggcagcaccgcgcctggctggaggcgcacggcggctgggatggcttttgtctcttcttc
acacccgtgctgctgtcttcttggaaaagactgctggtccaggctcttctgtcatgctttacggcagtgatcttaatcta
cttctggaaaagattaccgtga
>gnl|bcl2dbcds|A0A8C7B9K2_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Neovison vison GN=BCL-2 (length=705 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggcgacgcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcccagcccg
ggcgcacccccgcgcccgccaggacctcgccgcccccgccccccgccgccctcgccgccgctgccgccgcgggccctgcg
ctcagcccggtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgtcgctaccgccgcgactt
cgcggagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttca
gggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggag
atgtcgcccctggtggacaacatcgccctatggatgactgagtacctgaaccggcacttgcacacctggatccaggacaa
cggaggctgggatgcctttgtggagctgtacggccccagcgtgcagcctctgtttgacttctcctggctgtccctgaagg
ccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaagtga
>gnl|bcl2dbcds|A0A8C7BMW8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neovison vison GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggggg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacgagccggaacctt
tggggaagaggcctgctgtcctgcctttgctggagttggtgggggaggccagcagtggcccctgcacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtccctggagattatttctcggtacctgcg
ggagcaggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C7BMW8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neovison vison GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggggg
cgcctcctcttcgggagggcggcttttggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagcc
ggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C7BPR9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neovison vison GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatctcagcttcacatcacccccgggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgcgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C7BPR9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Neovison vison GN=BCL2L1 (length=666 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatctcagcttcacatcacccccgggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgcgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggtccggactggcttattttaccccgagttcctggcacacggcctgaggttgggtaagggcttagccagcatctgct
cagtgaacatgaagggttattattag
>gnl|bcl2dbcds|A0A8C7EW82_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Neovison vison GN=BCL2L2 (length=582 residues).
atggcgaccccggcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggggagggcccagcagctgacccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgtaccttctctgatttggcagcccagctgcatgtgaccccaggctcggcccagcagcgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggccaagtgcaagagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|U6CQS8_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Neovison vison GN=BCL2A1 (length=525 residues).
atgacagacggtgagttcgggtacacgctgtcgctggctcaggactacgtgaggcatgtcctgcagatcccgcagcccgg
cccggccgccagcagagtgtcccgggtcctgcgggacgtggcctcctccgtgcagcgggaggtggaacagaacttgaaac
catgcttggacagctttgacgtggggtccatcgacactgccagaaccatcttcaatcaagtcatggaaaaggaatttgaa
gacggcatcattaactgggggaggattgtgaccgtatttgcctttgaaggcattctctccaagaagctcctccgggagcg
aatttccccggacgtggatgcttccagggtttcttactttgtggcagagttcatcacgacaaacatgagggagtggataa
gacaaaacggaggctgggaggacggctttgtaaagaagttcgagcccaagtccggctggctgacctttctggaagttaca
ggaaagatctgtgaaatgttctctctcctgaagcaatactactga
© 1998-2022Legal notice