Dataset for CDS MCL-1 of organism Colobus angolensis palliatus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagaggacct
agaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaatcagat
agccttactgtaa
>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaatcagatag
© 1998-2020Legal notice