Dataset for CDS MCL-1 of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5I9I0_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K5I9I0_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2K5I9I0_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K5I9I0_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                        **************************************************

A0A2K5I9I0_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K5I9I0_MCL1-03      ggcttttggccactg-------------gcgccaaggacacacagccaat
                        ********** ** *             *  **   ** * * **     

A0A2K5I9I0_MCL1-02      ggggaggccggcacggtgattggcggaagcgccggcgcaagccccccggc
A0A2K5I9I0_MCL1-03      gggcaggtc--------------tggggccaccagcaggaaggctctgg-
                        *** *** *               **   * ** **   *   * * ** 

A0A2K5I9I0_MCL1-02      cgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggcg
A0A2K5I9I0_MCL1-03      agaccttac----gacgggtgggggatggcgtg-----------------
                         * *** **    ****   ** ** * *** *                 

A0A2K5I9I0_MCL1-02      ccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcg
A0A2K5I9I0_MCL1-03      ----------------cagcgcaa---ccacgagacggccttccaaggca
                                        ** *** *   ** **** * ** ** *   ** 

A0A2K5I9I0_MCL1-02      cccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccga
A0A2K5I9I0_MCL1-03      -------------------tgcttcggaaactggacatcaaaaacgaaga
                                            ****  * *  ****   *     **  **

A0A2K5I9I0_MCL1-02      cgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
A0A2K5I9I0_MCL1-03      cgatgtca------------------------------------------
                        **   ***                                          

A0A2K5I9I0_MCL1-02      tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatct
A0A2K5I9I0_MCL1-03      ---------------------------------------------aatct
                                                                     *****

A0A2K5I9I0_MCL1-02      aatagctccagtacggatgggtcactaccctcgacgccgccgccagcaga
A0A2K5I9I0_MCL1-03      -ttatctcgagt---gatgatcca-tgttttcagcgacggcg-taacaaa
                          ** *** ***   ****   ** *    **  ** ** **  * ** *

A0A2K5I9I0_MCL1-02      --ggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcg
A0A2K5I9I0_MCL1-03      ctggggcaggattgtgactctca------------------tttcttttg
                          ** * ****    ** *   *                  * *** * *

A0A2K5I9I0_MCL1-02      gtaccttcgggagcaggccactggcgccaaggacacacagccaatgggca
A0A2K5I9I0_MCL1-03      gtgcctttgtggctaaacacttg-----aagaccata-aaccaagaaagt
                        ** **** * *   *  *   **     ***  ** * * ****      

A0A2K5I9I0_MCL1-02      ggtctggggccaccagcaggaaggctctggagacctt------acgacgg
A0A2K5I9I0_MCL1-03      tgcatcgaaccattagcagaaagtatc-acagacgttctcgtaaggacaa
                         *  * *  ***  ***** ***  **   **** **      * ***  

A0A2K5I9I0_MCL1-02      gtgggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggt
A0A2K5I9I0_MCL1-03      aacgggactggc---tagttaaacaaagaggctg--------ggatgggt
                           ***  ****    **   *** * *** * *        ********

A0A2K5I9I0_MCL1-02      ttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtg
A0A2K5I9I0_MCL1-03      ttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtg
                        **************************************************

A0A2K5I9I0_MCL1-02      ctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
A0A2K5I9I0_MCL1-03      ctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
                        **************************************************

A0A2K5I9I0_MCL1-02      aatcagatagccttactgtaa
A0A2K5I9I0_MCL1-03      aatcagatag-----------
                        **********           

© 1998-2020Legal notice