Dataset for CDS BAX-like of Organism Haliotis discus hannai

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8F4XB69_BAX-01 BCL2-associated X gene OS=[Eukaryota] Haliotis discus hannai GN=BAX (length=615 residues).
atgagtagagaacgttatcaccccctagccagaagcaaacaaccagtggatcgacacttgagtcgcgatgatatcacaaa
tcaaggccgctatctgctcaataccttcatccatgagcgtatgcgtcaggatggtatacagcaagcacctgccctggatg
aactgcaggaaccgggcactccttgtggcccacctatgcaacacacgacagagatagcccgggccttgcgatgtataggc
gaccagttggatggagacgttaggctacagaacctgatcaaccaggtccaaccggacgctcagcggagcacatttctcaa
cgtagcccagtctatattcagcgatggagtgttcaactggggcagggtggttgccctcttttactttgcctacaagatgg
cgctgaaggccttggataagatacctctagtccgagctatcatcaacctggtgatagacttcctgagagacaaagtggca
cagtggattatagacagaggtggctgggaagccattgtggaatacttcgggacccccagcaaacaggttttgcttgtcct
tggcgccggcgtggtcataagtggagccatctacctctggaagggctggcattga
© 1998-2023Legal notice