Dataset for CDS MCL-1 of organism Sparus aurata

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A671VEU3_MCL1-02      atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttca
A0A671VEU3_MCL1-01      atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttca
A0A671VEU3_MCL1-03      atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttca

A0A671VEU3_MCL1-02      aaatggagtcgtaggtggaacgatgcactacgactcaagagattccgctc
A0A671VEU3_MCL1-01      aaatggagtcgtaggtggaacgatgcactacgactcaagagattccgctc
A0A671VEU3_MCL1-03      aaatggagtcgtaggtggaacgatgcactacgactcaagagattccgctc

A0A671VEU3_MCL1-02      cggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcggg
A0A671VEU3_MCL1-01      cggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcggg
A0A671VEU3_MCL1-03      cggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcggg

A0A671VEU3_MCL1-02      tctaacgacacgccgaaacggccgattaaccttggagtgaacacggcgaa
A0A671VEU3_MCL1-01      tctaacgacacgccgaaacggccgattaaccttggagtgaacacggcgaa
A0A671VEU3_MCL1-03      tctaacgacacgccgaaacggccgattaaccttggagtgaacacggcgaa

A0A671VEU3_MCL1-02      ggcgtataatgtaccgaaaaacctccgggaggacagcgaggacctcgagg
A0A671VEU3_MCL1-01      ggcgtataatgtaccgaaaaacctccgggaggacagcgaggacctcgagg
A0A671VEU3_MCL1-03      ggcgtataatgtaccgaaaaacctccgggaggacagcgaggacctcgagg

A0A671VEU3_MCL1-02      acggctctttaccgtgtactccagagctacagtccgaaaacgacatggat
A0A671VEU3_MCL1-01      acggctctttaccgtgtactccagagctacagtccgaaaacgacatggat
A0A671VEU3_MCL1-03      acggctctttaccgtgtactccagagctacagtccgaaaacgacatggat

A0A671VEU3_MCL1-02      atctccagttgtccagcaggggacgagcttctggatcaagacacaaggca
A0A671VEU3_MCL1-01      atctccagttgtccagcaggggacgagcttctggatcaagacacaaggca
A0A671VEU3_MCL1-03      atctccagttgtccagcaggggacgagcttctggatcaagacacaaggca

A0A671VEU3_MCL1-02      attgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
A0A671VEU3_MCL1-01      attgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
A0A671VEU3_MCL1-03      attgatcagccggttcctggcagtgtatacaggactttctaaacttcggt

A0A671VEU3_MCL1-02      ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgtt
A0A671VEU3_MCL1-01      ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgtt
A0A671VEU3_MCL1-03      ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgtt

A0A671VEU3_MCL1-02      ttggaaaagcacagatacgcgtacaatggtatggtcaaaaaattgacact
A0A671VEU3_MCL1-01      ttggaaaagcacagatacgcgtacaatggtatggtcaaaaaattgacact
A0A671VEU3_MCL1-03      ttggaaaagcacagatacgcgtacaatggtatggtcaaaaaattgacact

A0A671VEU3_MCL1-02      ggatgagagggaggatgcaagttttgtcagctcagtagccaagagccttt
A0A671VEU3_MCL1-01      ggatgagagggaggatgcaagttttgtcagctcagtagccaagagccttt
A0A671VEU3_MCL1-03      ggatgagagggaggatgcaagttttgtcagctcagtagccaagagccttt

A0A671VEU3_MCL1-02      ttgcagacgggaccacaaactggggccgggtcgtcagcctgatggccttc
A0A671VEU3_MCL1-01      ttgcagacgggaccacaaactggggccgggtcgtcagcctgatggccttc
A0A671VEU3_MCL1-03      ttgcagacgggaccacaaactggggccgggtcgtcagcctgatggccttc

A0A671VEU3_MCL1-02      ggggcggtggtgtctcagtacctgaaggagaaaggcaggggccactgtgt
A0A671VEU3_MCL1-01      ggggcggtggtgtctcagtacctgaaggagaaaggcaggggccactgtgt
A0A671VEU3_MCL1-03      ggggcggtggtgtctcagtacctgaaggagaaaggcaggggccactgtgt

A0A671VEU3_MCL1-02      ggagcaggtgggacaggagatctcgacctacctgctgacggagcagagag
A0A671VEU3_MCL1-01      ggagcaggtgggacaggagatctcgacctacctgctgacggagcagagag
A0A671VEU3_MCL1-03      ggagcaggtgggacaggagatctcgacctacctgctgacggagcagagag

A0A671VEU3_MCL1-02      actggctggtcaagaacaactcttgggatggctttgttgagttcttcaga
A0A671VEU3_MCL1-01      actggctggtcaagaacaactcttgggatggctttgttgagttcttcaga
A0A671VEU3_MCL1-03      actggctggtcaagaacaactcttgggatggctttgttgagttcttcaga

A0A671VEU3_MCL1-02      gtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
A0A671VEU3_MCL1-01      gtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
A0A671VEU3_MCL1-03      gtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg

A0A671VEU3_MCL1-02      atttgctggtattggagcaacgcttgccctgttgatcagcccgagggtga
A0A671VEU3_MCL1-01      atttgctggtattggagcaacgcttgccctgttgatcag-----------
A0A671VEU3_MCL1-03      atttgctggtattggagcaacgcttgccctgttgatcag-----------

A0A671VEU3_MCL1-02      gtcgaggagaagttcatgagatgacctcatcgtcggcagaataa
A0A671VEU3_MCL1-01      -------------gtgtgatcttcgactctcacgaccggagtga
A0A671VEU3_MCL1-03      ----------------------------------------gtga
                                                                 * *

© 1998-2021Legal notice