Dataset for CDS MCL-1 of organism Sparus aurata

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A671VEU3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata GN=MCL-1 (length=870 residues).
atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttcaaaatggagtcgtaggtggaacgatgcacta
cgactcaagagattccgctccggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcgggtctaacgaca
cgccgaaacggccgattaaccttggagtgaacacggcgaaggcgtataatgtaccgaaaaacctccgggaggacagcgag
gacctcgaggacggctctttaccgtgtactccagagctacagtccgaaaacgacatggatatctccagttgtccagcagg
ggacgagcttctggatcaagacacaaggcaattgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgttttggaaaagcacagatacgcgtacaatggt
atggtcaaaaaattgacactggatgagagggaggatgcaagttttgtcagctcagtagccaagagcctttttgcagacgg
gaccacaaactggggccgggtcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaaggagaaaggcaggg
gccactgtgtggagcaggtgggacaggagatctcgacctacctgctgacggagcagagagactggctggtcaagaacaac
tcttgggatggctttgttgagttcttcagagtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
atttgctggtattggagcaacgcttgccctgttgatcaggtgtgatcttcgactctcacgaccggagtga
>gnl|bcl2dbcds|A0A671VEU3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata GN=MCL-1 (length=894 residues).
atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttcaaaatggagtcgtaggtggaacgatgcacta
cgactcaagagattccgctccggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcgggtctaacgaca
cgccgaaacggccgattaaccttggagtgaacacggcgaaggcgtataatgtaccgaaaaacctccgggaggacagcgag
gacctcgaggacggctctttaccgtgtactccagagctacagtccgaaaacgacatggatatctccagttgtccagcagg
ggacgagcttctggatcaagacacaaggcaattgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgttttggaaaagcacagatacgcgtacaatggt
atggtcaaaaaattgacactggatgagagggaggatgcaagttttgtcagctcagtagccaagagcctttttgcagacgg
gaccacaaactggggccgggtcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaaggagaaaggcaggg
gccactgtgtggagcaggtgggacaggagatctcgacctacctgctgacggagcagagagactggctggtcaagaacaac
tcttgggatggctttgttgagttcttcagagtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
atttgctggtattggagcaacgcttgccctgttgatcagcccgagggtgagtcgaggagaagttcatgagatgacctcat
cgtcggcagaataa
>gnl|bcl2dbcds|A0A671VEU3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata GN=MCL-1 (length=843 residues).
atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttcaaaatggagtcgtaggtggaacgatgcacta
cgactcaagagattccgctccggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcgggtctaacgaca
cgccgaaacggccgattaaccttggagtgaacacggcgaaggcgtataatgtaccgaaaaacctccgggaggacagcgag
gacctcgaggacggctctttaccgtgtactccagagctacagtccgaaaacgacatggatatctccagttgtccagcagg
ggacgagcttctggatcaagacacaaggcaattgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgttttggaaaagcacagatacgcgtacaatggt
atggtcaaaaaattgacactggatgagagggaggatgcaagttttgtcagctcagtagccaagagcctttttgcagacgg
gaccacaaactggggccgggtcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaaggagaaaggcaggg
gccactgtgtggagcaggtgggacaggagatctcgacctacctgctgacggagcagagagactggctggtcaagaacaac
tcttgggatggctttgttgagttcttcagagtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
atttgctggtattggagcaacgcttgccctgttgatcaggtga
© 1998-2020Legal notice