Dataset for CDS BCL-2-like of organism Cyclopterus lumpus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A8C2X310_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1017 residues).
atgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagca
ggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatgg
aagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatg
aaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactc
cccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtgg
cctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaa
acctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccgt
gggacccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagg
atgcctttgtggagctgtatgacagacagagggactccctcttcaattgctcctggccctccattaagacggtcttcggt
ctggctgcactcggggccgccagcctcaccatcggagcataccttactcagaagtga
>gnl|bcl2dbcds|A0A8C2X310_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1080 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgc
catcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagc
aggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatg
gaagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccat
gaaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctact
ccccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtg
gcctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctga
aacctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccg
tgggacccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcag
attgttaccatgggactgtttcggaccatcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgat
tcagagggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=1074 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgc
catcaatgacaaacaggtatattgcttaaataattcagtgttgacctactggagtggctttttttctgttgcgcaggctc
aggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatggaagtg
gaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatgaagga
gcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactccccgt
ccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtggcctac
ccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaaacctc
aggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcagtgcaggggaacttcaacagctccgtgggac
ccgatggttacatgctatcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtctccagcagattgtt
accatgggactgtttcggaccatcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgattcagag
ggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=894 residues).
atgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaacc
tctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctaca
ggcaaggagcattcatcactttggtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaaatttgcc
atcaatgacaaacaggtggtgctttgcatatcagtggatgtttccagtgaatatagccaggtggaaagtgtgataaagca
ggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctggaaagtttgatgaaatgg
aagtggaccgttttaaaaaactgatggaagtgaactacctggggagcgtttacccgacacgagccgtcataaccaccatg
aaggagcgaagaaggggccgcatcatgtttgtgtcctcccaagcaggccagatcggcttgtttggatacaccgcctactc
cccgtccaagtttgccctgcgtggcttggcagaatctctgcagatggagataaagccatacaatatctacgtgacggtgg
cctacccccctgacactgacactccaggattggctgaggaaaacaagaccaagcctctggagaccaaattaatctctgaa
acctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgatgcaattgttaccatgggactgtttcggac
catcgccctcttctacctgggcagttttgacagcattgtgcggcgctgcatgattcagagggaacagtcaaaagcagctg
ataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-05 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=555 residues).
atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaatcaactcctggtggctccttctgccgtttgt
catgcttcttgtggtcgctgccttcattgttgcatttgtgttgctgttgtacatgatatcgccacttattagtcccaaac
ctctgaaactgaacggggcccacgtcgtggtgactgggggctcaagtgggatcgggaaatgcattgcaattgagtgctac
aggcaaggagcattcatcactttggtggcacgggatgaggtcaattgcttaaataattcagtgttgacctactggagtgg
ctttttttctgttgcgcaggctcaggagaagctggggcctgttgatatgttggtgaactgtgctggggtatccatttctg
gaaagtttgatgaaatggaagtggaccgttttaaaattgttaccatgggactgtttcggaccatcgccctcttctacctg
ggcagttttgacagcattgtgcggcgctgcatgattcagagggaacagtcaaaagcagctgataagagggagtaa
>gnl|bcl2dbcds|A0A8C2X310_BCL2-06 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL-2 (length=687 residues).
atggcgaacgagtgcaatcgcaacattgtggaaaagtacatctgccataaactctccaaacggggctacgtgtttggatt
tgacgacgtccgagatgaagatgccgccgatgacggcttaatagttgtcccgccgccgactctggtccgccggtgccgtg
aatccggcaccgggcccgacatcgagagcgtcccccacctctgcaaacggctcccgcagtccgacccgaccgccgccatc
caccgggtcctgcgcgaggctggggacgaactcgagagactgtaccagccggacttcacggagatgtcgcggcagctgta
cctcacctccaccacggcgcagcggaggttcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgcgttcttcgagttcgggggcacggtgtgcgcggagtgcgccgccaagcaggagatgacctcgcaggtggacaac
atcgcggagtggatgacggagtatttaaatggacctctgaacaactggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccctcttcaattgctcctggccctccattaagacggtcttcggtctggctgcac
tcggggccgccagcctcaccatcggagcataccttactcagaagtga
>gnl|bcl2dbcds|A0A8C2Z1X1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=MCL-1 (length=837 residues).
atgaatataataagcacgaaacgagccgcgttcaagatgactggagtcatgggctgtattatccttcctcaaaatggagt
cgtggagcgacccgtgcactacggctcgggagagtcctccccgctggtcgccatgggctccgctaaggactcccacaacg
gcaacgcggcgtccaacgacgccccgaagaggcccaagatcctcggctacgcgtcgaaaatgatccagggcgcggacgac
cacgacggcggctcgctgccgtgcaccccggagccggacagcgagatcgacgtgtcggactcccaggcgggcgccgaggt
gctggagaacgacacgaggcagctcatgggccgcttcctgggagactttaccggactttcgaaatcccagtggcacgaaa
gcagagagctgagcacgatgaagagggtcgtgaaagacgttttggagaagcatagatacgcgtacaatggcatgatcaac
aaattgtcattggacgacagaagtgacgatgccagtttcgtcagagaggtagccaagagcctcttcgcggacgggaccac
gaactggggccggattgtcagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaagaaccgggggaact
gtgtggagctggtgggacaggagatctccacgtacctgctgtctgaccagagggactggctggtcaagaacaatgcatgg
gagggctttgtggagttctttcgggtagtggacccagagtccacagtgaggaacacactcatggccgtcgctggatttgc
cagcatcggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A8C2ZH46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=678 residues).
atgtccaacatcaacagagagctggtggagttcttcataagctacaagctgtcgcagaagaactacccaacctctctgct
gtggccagaggaggatgccgccggtgggaggacggagggagacgaagccgacccagcatccagtaacggctcgctggtca
acggcggggacggggacggggccggcccgtcggggacgtcatcgcctccgtccggtgacgtggaggccgtgaaggcggct
ctccgggactcggcgaacgagtttgagctgctcttcacgcaagcgttcagtgacctttcctcgcagctcgacgtcacccc
cgtcacggcctaccacagctttaagagcgtgatggacgaggtgttcaaggacggagtcaactggggccgcgtggtgggcc
tgttcgccttcggcagcgtgctgtgtgtggactgcgtcgagaaggacatgagcgagctggtttcccgcatcgcggactgg
atgaccacgtacctggacgagcacatcagcgcatggatccagagccagggaggatgggactgctttgccgagatctttgg
gcgggacagcgctgcggaggcgaggatatctcaggagacgctgaggaggtggctgctcgttggagcggcgctgctaaaag
gagtgctcggcggcatggccatcagcaagaagcggtga
>gnl|bcl2dbcds|A0A8C2ZZ68_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagagctggtggtcttctacataaactataaactctcccagaggaactatcccctcacccacatggg
actcacagagcctctgaacaggactgacgggggggaggcgggggcgggcgatgccgaggaacagcgggtagcgacgcacg
ctaacgggactttcaatggcacaagtcccgggaccccaccggcatccccgctgcgaccgcaacggttgccgtcgacgacg
aacctggacgcggtaaaggaggccctccgggactcggccaacgagttcgagctgcgatacgcccgggccttcagcgatct
gcacaaccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgtttcgggacgggg
tcaactggggccgcatcgtggggcttttcgccttcggcggggccctgtgcgtggagtgtgtggagaaggagatgagtcca
ctggtgggacggatcatcgagtggatgacggtctacctggacaaccacattcagccctggatccagacccagggaggatg
ggagcgcttcgccgagatctttgggcaggacgcggcggcggagagcaggaagtctcaggagagcttcaagaagtggctgc
tggcgggggtgacgctggtgaccggcgtcgtggtggttttgctcatcggccagaagcgcctgtga
>gnl|bcl2dbcds|A0A8C3G7A6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L10 (length=579 residues).
atgtcgtgcgggctgtggaaagagaccttggctctggcagaggactacctgtacctgtgctgcacaagcccacggccagc
ccctccacctcccagcgagtcagccactgccatgaggcgcctggcccaggacatggagacgcagcaccaggctcgcttcc
actccctcgctcagaccttcctgaggcagtgcgggccggacccctgctccagcctcaggaaggtgatagaggagttggtg
ggagacggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccaggcagctgctggagca
gaatggcacaaagctggggctggaccctgggcaggaactagaacaggagtccggaaactgcaggggactggcggagacca
tagctgattacctgggagaggagaagaaagactggctgctggagaatgatggatgggaggggttctgcaagttctcccgc
agtgccagagaagtcggccaggactcgtccatgaagacggcgctgtttgctgctgctggtgtgggcctcgctggactcac
cttcctcctagtgcgctag
© 1998-2022Legal notice