Dataset for CDS BCL-2-like of organism Cyclopterus lumpus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C2Z1X1_MCL1-01      atgaat--------------------------------------------
A0A8C2ZH46_BCL2L1-      atgtcc--------------------------------------------
A0A8C2ZZ68_BCL2L1-      atgtct--------------------------------------------
A0A8C3G7A6_BCL2L10      atgtc-----------------gtgcgg----------------------
A0A8C2X310_BCL2-06      atggc-----------gaacgagtgcaatcgcaac---------------
A0A8C2X310_BCL2-01      --------------------------------------------------
A0A8C2X310_BCL2-02      atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaat
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaat
A0A8C2X310_BCL2-03      atgtcctctgaagaagggctgagctcaacgatcacggattggcttttaat

A0A8C2Z1X1_MCL1-01      --ataataagcacgaa-----------------------acgagccgcgt
A0A8C2ZH46_BCL2L1-      --aacatcaacagaga-----------------------gctggtggagt
A0A8C2ZZ68_BCL2L1-      --ca---aaacagaga-----------------------gctggtggtct
A0A8C3G7A6_BCL2L10      --gctgtggaaagagaccttggc----------------tctggcagagg
A0A8C2X310_BCL2-06      --attgtggaaaagtacatctgccataa---actctccaaacgg-----g
A0A8C2X310_BCL2-01      -------------------------------atgcttcttgtggtcgctg
A0A8C2X310_BCL2-02      caactcctggtggctccttctgccgtttgtcatgcttcttgtggtcgctg
A0A8C2X310_BCL2-04      -------------------------------atgcttcttgtggtcgctg
A0A8C2X310_BCL2-05      caactcctggtggctccttctgccgtttgtcatgcttcttgtggtcgctg
A0A8C2X310_BCL2-03      caactcctggtggctccttctgccgtttgtcatgcttcttgtggtcgctg

A0A8C2Z1X1_MCL1-01      tcaagatgactggagtcatgggctgtattatccttcctcaaaatggagtc
A0A8C2ZH46_BCL2L1-      tcttcat-----aagctacaagctgt------------------------
A0A8C2ZZ68_BCL2L1-      tctacat-----aaactataaactct------------------------
A0A8C3G7A6_BCL2L10      actac----ctgtacctg--------------------------------
A0A8C2X310_BCL2-06      gctacgtgtttggatttgacgacgtc------------------------
A0A8C2X310_BCL2-01      ccttcattgttgcatttg----tgtt------------------------
A0A8C2X310_BCL2-02      ccttcattgttgcatttg----tgtt------------------------
A0A8C2X310_BCL2-04      ccttcattgttgcatttg----tgtt------------------------
A0A8C2X310_BCL2-05      ccttcattgttgcatttg----tgtt------------------------
A0A8C2X310_BCL2-03      ccttcattgttgcatttg----tgtt------------------------
                         *           *                                    

A0A8C2Z1X1_MCL1-01      gtggagcgacccgtgcactacggctcgggagagtcctccccgctggtcgc
A0A8C2ZH46_BCL2L1-      -----------------------cgcagaagaactacccaacctctctgc
A0A8C2ZZ68_BCL2L1-      -----------------------cccagaggaactatcc--cctcaccca
A0A8C3G7A6_BCL2L10      --------------------------tgctgcacaagcccacg-------
A0A8C2X310_BCL2-06      ------------------------cgagatgaagatgccgccgatgacgg
A0A8C2X310_BCL2-01      ------------------------gctgttgtacatgatatcg----cca
A0A8C2X310_BCL2-02      ------------------------gctgttgtacatgatatcg----cca
A0A8C2X310_BCL2-04      ------------------------gctgttgtacatgatatcg----cca
A0A8C2X310_BCL2-05      ------------------------gctgttgtacatgatatcg----cca
A0A8C2X310_BCL2-03      ------------------------gctgttgtacatgatatcg----cca
                                                   *  *                   

A0A8C2Z1X1_MCL1-01      catggg-----------ctccgctaaggactcccacaacggcaacgcggc
A0A8C2ZH46_BCL2L1-      tgtgg-------------ccagaggaggatgccgccggtgggaggacgga
A0A8C2ZZ68_BCL2L1-      catgggactcacagagcctctgaacagga--ctgacgggggggaggcggg
A0A8C3G7A6_BCL2L10      ---gccagcccctccacctccca-gcgag-----tc--agccactgccat
A0A8C2X310_BCL2-06      cttaatagttgtcccgccgccgactctgg-----tc--cgccggtgccgt
A0A8C2X310_BCL2-01      cttattagtc-ccaaacctctgaaactga-----acggggcccacgtcgt
A0A8C2X310_BCL2-02      cttattagtc-ccaaacctctgaaactga-----acggggcccacgtcgt
A0A8C2X310_BCL2-04      cttattagtc-ccaaacctctgaaactga-----acggggcccacgtcgt
A0A8C2X310_BCL2-05      cttattagtc-ccaaacctctgaaactga-----acggggcccacgtcgt
A0A8C2X310_BCL2-03      cttattagtc-ccaaacctctgaaactga-----acggggcccacgtcgt
                                           *               *   *          

A0A8C2Z1X1_MCL1-01      gtccaacgacgccccgaagaggcccaagatcctcggctacg-----cgtc
A0A8C2ZH46_BCL2L1-      gggagacgaagcc-------gacccagcatc--cagtaacg--gctcgct
A0A8C2ZZ68_BCL2L1-      ggcgggcgatgcc-------ga-ggaacagc--gggtagcgacgcacgct
A0A8C3G7A6_BCL2L10      ga-----ggcgcct------ggcccaggaca--tggagacg-----cagc
A0A8C2X310_BCL2-06      ga-------------------atccggcacc--gggcccga-----catc
A0A8C2X310_BCL2-01      ggtgactgggggct------caagtgggatc--gggaaatg-----catt
A0A8C2X310_BCL2-02      ggtgactgggggct------caagtgggatc--gggaaatg-----catt
A0A8C2X310_BCL2-04      ggtgactgggggct------caagtgggatc--gggaaatg-----catt
A0A8C2X310_BCL2-05      ggtgactgggggct------caagtgggatc--gggaaatg-----catt
A0A8C2X310_BCL2-03      ggtgactgggggct------caagtgggatc--gggaaatg-----catt
                        *                           *      *          *   

A0A8C2Z1X1_MCL1-01      ga---------aaatgatccagggcgcggacgaccacgacggcgg-ctcg
A0A8C2ZH46_BCL2L1-      gg--------tcaacgg--cggggacggg--gacggggccgg----cccg
A0A8C2ZZ68_BCL2L1-      aacgggactttcaatggcacaagtcccgg--gaccccaccggcatccccg
A0A8C3G7A6_BCL2L10      ac-----------------caggctc---gcttccactcc------ctcg
A0A8C2X310_BCL2-06      g-------------------------agagcgtcccccac------ctct
A0A8C2X310_BCL2-01      gc-----aattgagtgctacaggcaaggagcattcatcac------tttg
A0A8C2X310_BCL2-02      gc-----aattgagtgctacaggcaaggagcattcatcac------tttg
A0A8C2X310_BCL2-04      gc-----aattgagtgctacaggcaaggagcattcatcac------tttg
A0A8C2X310_BCL2-05      gc-----aattgagtgctacaggcaaggagcattcatcac------tttg
A0A8C2X310_BCL2-03      gc-----aattgagtgctacaggcaaggagcattcatcac------tttg

A0A8C2Z1X1_MCL1-01      ctgccgtgc--------accccggagccggacagcgaga----tcgacgt
A0A8C2ZH46_BCL2L1-      tcggggacg--------tcatcgcctccgtccggtgacg----tggaggc
A0A8C2ZZ68_BCL2L1-      ctgcgaccg--------caacggttgccgt-cgacgacgaacctggacgc
A0A8C3G7A6_BCL2L10      ct---------------cagacc-ttcctgaggcagtgcgggccggaccc
A0A8C2X310_BCL2-06      g----------------caaacggctcc---------cgcagtccgaccc
A0A8C2X310_BCL2-01      gtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaa
A0A8C2X310_BCL2-02      gtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaa
A0A8C2X310_BCL2-04      gtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaa
A0A8C2X310_BCL2-05      gtggcacgggatgaggtca-------------------------------
A0A8C2X310_BCL2-03      gtggcacgggatgaggctaaattgcttcaagcgaagaaagagttggagaa

A0A8C2Z1X1_MCL1-01      gtcggactcccaggc-----------gggcgccgaggt------------
A0A8C2ZH46_BCL2L1-      cgtga------aggc-----------ggctctccggga------------
A0A8C2ZZ68_BCL2L1-      ggtaa------agga-----------ggccctccggga------------
A0A8C3G7A6_BCL2L10      ctgctccagcctcaggaa--------ggtgatagaggagtt---------
A0A8C2X310_BCL2-06      gaccgccgccatccaccg--------ggtcctgcgcgag-----------
A0A8C2X310_BCL2-01      atttgccatcaatgacaaacaggt--ggtgctttgcatatcagtggatgt
A0A8C2X310_BCL2-02      atttgccatcaatgacaaacaggt--ggtgctttgcatatcagtggatgt
A0A8C2X310_BCL2-04      atttgccatcaatgacaaacaggt--ggtgctttgcatatcagtggatgt
A0A8C2X310_BCL2-05      --------------------------attgctt---aaataattcagtgt
A0A8C2X310_BCL2-03      atttgccatcaatgacaaacaggtatattgctt---aaataattcagtgt

A0A8C2Z1X1_MCL1-01      ------------------gctggagaa-----------------cgacac
A0A8C2ZH46_BCL2L1-      ------------------ctcggcgaa-----------------cg----
A0A8C2ZZ68_BCL2L1-      ------------------ctcggccaa-----------------cg----
A0A8C3G7A6_BCL2L10      ------------------ggtgggaga-----------------cg----
A0A8C2X310_BCL2-06      ------------------gctgggga------------------cg----
A0A8C2X310_BCL2-01      ttccagtgaatatagccaggtggaaag-------tgtgataaagca----
A0A8C2X310_BCL2-02      ttccagtgaatatagccaggtggaaag-------tgtgataaagca----
A0A8C2X310_BCL2-04      ttccagtgaatatagccaggtggaaag-------tgtgataaagca----
A0A8C2X310_BCL2-05      ------------tgacctactggagtggctttttttctgttgcgca----
A0A8C2X310_BCL2-03      ------------tgacctactggagtggctttttttctgttgcgca----
                                             **                     *     

A0A8C2Z1X1_MCL1-01      gaggcagctcatgggccgcttcctgggagactttaccggactttcgaaat
A0A8C2ZH46_BCL2L1-      -----agtttgagctgctcttcacgcaagcgttcagtgacctttc-----
A0A8C2ZZ68_BCL2L1-      -----agttcgagctgcgatacgcccgggccttcagcgatctgca-----
A0A8C3G7A6_BCL2L10      -----gacacttg----------aactgg---------------------
A0A8C2X310_BCL2-06      -----aactcgagagactgtaccagccggacttcacggagatgtc-----
A0A8C2X310_BCL2-01      -----ggctcaggaga-------agctggggcctgttgatatgtt-----
A0A8C2X310_BCL2-02      -----ggctcaggaga-------agctggggcctgttgatatgtt-----
A0A8C2X310_BCL2-04      -----ggctcaggaga-------agctggggcctgttgatatgtt-----
A0A8C2X310_BCL2-05      -----ggctcaggaga-------agctggggcctgttgatatgtt-----
A0A8C2X310_BCL2-03      -----ggctcaggaga-------agctggggcctgttgatatgtt-----
                                    *               *                     

A0A8C2Z1X1_MCL1-01      cccagtggcacgaaagcagagagctgagcacgatgaagagggtcgtgaaa
A0A8C2ZH46_BCL2L1-      ----------------ctcgcagctcgacgt-------------------
A0A8C2ZZ68_BCL2L1-      ----------------caaccagctgcacat-------------------
A0A8C3G7A6_BCL2L10      ------------------gggagggttgttt-------------------
A0A8C2X310_BCL2-06      ----------------gcggcagctgtac---------------------
A0A8C2X310_BCL2-01      ----------------g-gtgaactgtgctg-------------------
A0A8C2X310_BCL2-02      ----------------g-gtgaactgtgctg-------------------
A0A8C2X310_BCL2-04      ----------------g-gtgaactgtgctg-------------------
A0A8C2X310_BCL2-05      ----------------g-gtgaactgtgctg-------------------
A0A8C2X310_BCL2-03      ----------------g-gtgaactgtgctg-------------------

A0A8C2Z1X1_MCL1-01      gacgttttggagaagcatagatacgcgtacaatggcatgatcaacaaatt
A0A8C2ZH46_BCL2L1-      ---------------------cacccccgtcacggcct-acca-------
A0A8C2ZZ68_BCL2L1-      ---------------------cacgccggccacggcct-acca-------
A0A8C3G7A6_BCL2L10      --------------cccttttcacctttactg------------------
A0A8C2X310_BCL2-06      -------------------ctcacctccacca----cg------------
A0A8C2X310_BCL2-01      --------------gggtatccatttctggaaagtttg------------
A0A8C2X310_BCL2-02      --------------gggtatccatttctggaaagtttg------------
A0A8C2X310_BCL2-04      --------------gggtatccatttctggaaagtttg------------
A0A8C2X310_BCL2-05      --------------gggtatccatttctggaaagtttg------------
A0A8C2X310_BCL2-03      --------------gggtatccatttctggaaagtttg------------

A0A8C2Z1X1_MCL1-01      gtcattggacgacagaagtgacgatgccagtttcgtcagagaggtag---
A0A8C2ZH46_BCL2L1-      ---------------------------cagctttaagagcgtgatgg---
A0A8C2ZZ68_BCL2L1-      ---------------------------aagcttcgagaacgtgatgg---
A0A8C3G7A6_BCL2L10      ------------------gggtgctggcca-----ggcagctgctgg---
A0A8C2X310_BCL2-06      -----------gcgcagcggaggttcgccg--------aggtgatag---
A0A8C2X310_BCL2-01      -----------atgaaatggaagtggaccgttttaaaaaactgatggaag
A0A8C2X310_BCL2-02      -----------atgaaatggaagtggaccgttttaaaaaactgatggaag
A0A8C2X310_BCL2-04      -----------atgaaatggaagtggaccgttttaaaaaactgatggaag
A0A8C2X310_BCL2-05      -----------atgaaatggaagtggaccgttttaaa-------------
A0A8C2X310_BCL2-03      -----------atgaaatggaagtggaccgttttaaaaaactgatggaag

A0A8C2Z1X1_MCL1-01      ----------------------------ccaagagcctctt-------cg
A0A8C2ZH46_BCL2L1-      ----------------------------acgagg---tgtt-------ca
A0A8C2ZZ68_BCL2L1-      ----------------------------acgagg---tgtt-------tc
A0A8C3G7A6_BCL2L10      -----------------------------------------------agc
A0A8C2X310_BCL2-06      ----------------------------acgaac---tgtt-------cc
A0A8C2X310_BCL2-01      tgaactacctggggagcgtttacccgacacgagc---cgtcataaccacc
A0A8C2X310_BCL2-02      tgaactacctggggagcgtttacccgacacgagc---cgtcataaccacc
A0A8C2X310_BCL2-04      tgaactacctggggagcgtttacccgacacgagc---cgtcataaccacc
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      tgaactacctggggagcgtttacccgacacgagc---cgtcataaccacc

A0A8C2Z1X1_MCL1-01      cggacgggaccacgaactggggccggattgtcagcctggtggcc------
A0A8C2ZH46_BCL2L1-      aggacggagtc---aactggggccgcgtggtgggcctgttcgcc------
A0A8C2ZZ68_BCL2L1-      gggacggggtc---aactggggccgcatcgtggggcttttcgcc------
A0A8C3G7A6_BCL2L10      agaatggcacaa--agctggggctggaccctgggcaggaactagaacagg
A0A8C2X310_BCL2-06      gggacggggtga--a-ctggggccggatta---tcgcgttcttcga----
A0A8C2X310_BCL2-01      atgaaggagcga--agaaggggccgcatcatgtttgtgtcctcccaagca
A0A8C2X310_BCL2-02      atgaaggagcga--agaaggggccgcatcatgtttgtgtcctcccaagca
A0A8C2X310_BCL2-04      atgaaggagcga--agaaggggccgcatcatgtttgtgtcctcccaagca
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      atgaaggagcga--agaaggggccgcatcatgtttgtgtcctcccaagca

A0A8C2Z1X1_MCL1-01      ---------------ttcggggccgtggtgtgt-----------cagtac
A0A8C2ZH46_BCL2L1-      ---------------ttcggcagcgtgctgtgt-----------gtggac
A0A8C2ZZ68_BCL2L1-      ---------------ttcggcggggccctgtgc-----------gtggag
A0A8C3G7A6_BCL2L10      a-------------gtccggaaac--------------------------
A0A8C2X310_BCL2-06      --------------gttcgggggcacggtgtgcgc--------ggagtgc
A0A8C2X310_BCL2-01      ggccagatcggcttgtttggatacaccgcctactccccgtccaagtttgc
A0A8C2X310_BCL2-02      ggccagatcggcttgtttggatacaccgcctactccccgtccaagtttgc
A0A8C2X310_BCL2-04      ggccagatcggcttgtttggatacaccgcctactccccgtccaagtttgc
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      ggccagatcggcttgtttggatacaccgcctactccccgtccaagtttgc

A0A8C2Z1X1_MCL1-01      ctgaaggagaagaac-cgggggaactgtgtgg------------agctgg
A0A8C2ZH46_BCL2L1-      tgcgtcgagaaggacatgagcgagctg-gttt------------cccgca
A0A8C2ZZ68_BCL2L1-      tgtgtggagaaggagatgagtccactg-gtgg------------gacgga
A0A8C3G7A6_BCL2L10      -------tgcagggga---------ctggcggag----------accata
A0A8C2X310_BCL2-06      gccgccaagcaggagatgacctc-gcaggtgg------------acaaca
A0A8C2X310_BCL2-01      cctgcgtggcttggcagaatctctgcagatggagataaagccatacaata
A0A8C2X310_BCL2-02      cctgcgtggcttggcagaatctctgcagatggagataaagccatacaata
A0A8C2X310_BCL2-04      cctgcgtggcttggcagaatctctgcagatggagataaagccatacaata
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      cctgcgtggcttggcagaatctctgcagatggagataaagccatacaata

A0A8C2Z1X1_MCL1-01      tg------------------------------------------------
A0A8C2ZH46_BCL2L1-      tc------------------------------------------------
A0A8C2ZZ68_BCL2L1-      tc------------------------------------------------
A0A8C3G7A6_BCL2L10      gctgattacctggga-----------------------------------
A0A8C2X310_BCL2-06      tc------------------------------------------------
A0A8C2X310_BCL2-01      tctacgtgacggtggcctacccccctgacactgacactccaggattggct
A0A8C2X310_BCL2-02      tctacgtgacggtggcctacccccctgacactgacactccaggattggct
A0A8C2X310_BCL2-04      tctacgtgacggtggcctacccccctgacactgacactccaggattggct
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      tctacgtgacggtggcctacccccctgacactgacactccaggattggct

A0A8C2Z1X1_MCL1-01      ggacaggagatctccacgtacctgctgtctgaccagagggactggctgg-
A0A8C2ZH46_BCL2L1-      gcggactggatgaccacgtac---ctggacgagcacatcagcgcatgga-
A0A8C2ZZ68_BCL2L1-      atcgagtggatgacggtctac---ctggacaaccacattcagccctgga-
A0A8C3G7A6_BCL2L10      gaggagaagaa-----------------------agactggctgctgga-
A0A8C2X310_BCL2-06      gcggagtggatgacggagta----ttt-------aaatggacctctgaa-
A0A8C2X310_BCL2-01      gaggaaaacaagaccaagcc----tctggagaccaaattaatctctgaaa
A0A8C2X310_BCL2-02      gaggaaaacaagaccaagcc----tctggagaccaaattaatctctgaaa
A0A8C2X310_BCL2-04      gaggaaaacaagaccaagcc----tctggagaccaaattaatctctgaaa
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      gaggaaaacaagaccaagcc----tctggagaccaaattaatctctgaaa

A0A8C2Z1X1_MCL1-01      ----------------tcaagaa-------caat---gcatgggagggct
A0A8C2ZH46_BCL2L1-      ----------------tccagag-------ccagggaggatgggactgct
A0A8C2ZZ68_BCL2L1-      ----------------tccagac-------ccagggaggatgggagcgct
A0A8C3G7A6_BCL2L10      ------------------------------gaatgatggatgggaggggt
A0A8C2X310_BCL2-06      --------------caactggat-------acaagataacgg---gggat
A0A8C2X310_BCL2-01      cctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgat
A0A8C2X310_BCL2-02      cctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgat
A0A8C2X310_BCL2-04      cctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgat
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      cctcaggagtttgccaaccagaccaagtggccaaaatcattgttcgcgat

A0A8C2Z1X1_MCL1-01      ttgtg---------------------------------------------
A0A8C2ZH46_BCL2L1-      ttgcc---------------------------------------------
A0A8C2ZZ68_BCL2L1-      tcgcc---------------------------------------------
A0A8C3G7A6_BCL2L10      tctgc---------------------------------------------
A0A8C2X310_BCL2-06      g-------------------------------------------------
A0A8C2X310_BCL2-01      gcagtgcaggggaacttcaacagctccgtgggacccgatggttacatgct
A0A8C2X310_BCL2-02      gcagtgcaggggaacttcaacagctccgtgggacccgatggttacatgct
A0A8C2X310_BCL2-04      gca-----------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      gcagtgcaggggaacttcaacagctccgtgggacccgatggttacatgct

A0A8C2Z1X1_MCL1-01      --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
A0A8C3G7A6_BCL2L10      --------------------------------------------------
A0A8C2X310_BCL2-06      --------------------------------------------------
A0A8C2X310_BCL2-01      atcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtc
A0A8C2X310_BCL2-02      atcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtc
A0A8C2X310_BCL2-04      --------------------------------------------------
A0A8C2X310_BCL2-05      --------------------------------------------------
A0A8C2X310_BCL2-03      atcagccctcacctgtggaatgtcacccgtcacctccatcacagagggtc

A0A8C2Z1X1_MCL1-01      -------gagttctttcgggtagtggacccagagtcca-cagtgaggaac
A0A8C2ZH46_BCL2L1-      -------gagatcttt-gggcg--ggacagcg---ctg-cggaggcgagg
A0A8C2ZZ68_BCL2L1-      -------gagatcttt-gggca--ggacgcgg---cgg-cggagagcagg
A0A8C3G7A6_BCL2L10      -------aagttctcccgca----gtgc-----------cagagaag---
A0A8C2X310_BCL2-06      -------ggatgcctttgtg----gagctgtatgacagacagagggactc
A0A8C2X310_BCL2-01      tccagcaggatgcctttgtg----gagctgtatgacagacagagggactc
A0A8C2X310_BCL2-02      tccagcagattgttaccatg----ggactgttt------cggaccatcgc
A0A8C2X310_BCL2-04      --------attgttaccatg----ggactgttt------cggaccatcgc
A0A8C2X310_BCL2-05      --------attgttaccatg----ggactgttt------cggaccatcgc
A0A8C2X310_BCL2-03      tccagcagattgttaccatg----ggactgttt------cggaccatcgc
                                                *  *           * *        

A0A8C2Z1X1_MCL1-01      aca-ctcatggccgtcgctggatttgccagc--atcggggcgacact---
A0A8C2ZH46_BCL2L1-      atatctcaggagacgctgaggaggtggctgctcgttggagcggcgctgct
A0A8C2ZZ68_BCL2L1-      aagtctcaggagagcttcaagaagtggctgctggcgggggtgacgctggt
A0A8C3G7A6_BCL2L10      -----tcggccaggactc-----------gtccatgaagacggcgctgtt
A0A8C2X310_BCL2-06      cctcttcaattgctcctg-----------gccctccattaagacggtctt
A0A8C2X310_BCL2-01      cctcttcaattgctcctg-----------gccctccattaagacggtctt
A0A8C2X310_BCL2-02      cctcttcta-----cctg-----------ggcagttttgacagcattgtg
A0A8C2X310_BCL2-04      cctcttcta-----cctg-----------ggcagttttgacagcattgtg
A0A8C2X310_BCL2-05      cctcttcta-----cctg-----------ggcagttttgacagcattgtg
A0A8C2X310_BCL2-03      cctcttcta-----cctg-----------ggcagttttgacagcattgtg
                             **                      *             *  *   

A0A8C2Z1X1_MCL1-01      ----------------ggccctgttgatca--------------g-----
A0A8C2ZH46_BCL2L1-      aaaaggagtgctcggcggcatggc-catca--------------gcaaga
A0A8C2ZZ68_BCL2L1-      gaccggcgt-cgtggtggttttgctcatcg--------------gccaga
A0A8C3G7A6_BCL2L10      tgctgctgctggtgtgggcctcgctggactcaccttc-------ctccta
A0A8C2X310_BCL2-06      cggtctggctgcactcggggccgccagcctcaccatcggagcatacctta
A0A8C2X310_BCL2-01      cggtctggctgcactcggggccgccagcctcaccatcggagcatacctta
A0A8C2X310_BCL2-02      cggcgctgcatgattcagagggaacagtcaaa-------agcagctgata
A0A8C2X310_BCL2-04      cggcgctgcatgattcagagggaacagtcaaa-------agcagctgata
A0A8C2X310_BCL2-05      cggcgctgcatgattcagagggaacagtcaaa-------agcagctgata
A0A8C2X310_BCL2-03      cggcgctgcatgattcagagggaacagtcaaa-------agcagctgata
                                         *          *                     

A0A8C2Z1X1_MCL1-01      -------gtga
A0A8C2ZH46_BCL2L1-      agcg---gtga
A0A8C2ZZ68_BCL2L1-      agcgcctgtga
A0A8C3G7A6_BCL2L10      gt--gcgctag
A0A8C2X310_BCL2-06      ctcagaagtga
A0A8C2X310_BCL2-01      ctcagaagtga
A0A8C2X310_BCL2-02      agagggagtaa
A0A8C2X310_BCL2-04      agagggagtaa
A0A8C2X310_BCL2-05      agagggagtaa
A0A8C2X310_BCL2-03      agagggagtaa

© 1998-2023Legal notice