Dataset for CDS BCL-2-like of organism Buteo japonicus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A8B9Z3D5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctattacgtttattacttggctcaagattatctgcaatatgtgcttcaggaatcacatcttgg
accagcccaaaccagggttgctcacgtcttgcgaaacattgcatcttcgctgcaagatcaaaccgaggaggctctcagac
cattcttggacaggattgatattacttctgtagctgtggccaagagaattttcaatggtgtcatggaagaaaaatttgct
gatggaaatactaactggggacgaattatgaccatatttacctttggaggtcttctcactaagaagcttcaagagcatgg
agttcaactcactggagaggagaaggagcagatttcttatttcatcacagagtacataataaacaacaaagccgaatgga
tagatgcgaatggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactatctttctccaaaatcaca
gccatgttcatagctgttttttccttgctcagagagtactactga
>gnl|bcl2dbcds|A0A8C0ASR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Buteo japonicus GN=MCL-1 (length=585 residues).
gggaacggactggaagtgagaactgaccaattttacctggttttgtgtagctcagaaatgagctggtttgggtctagcct
gagtcgtcggggtggcgggactgagctcctggcctcagggctcacgctgggacttgtgggggctgcatcttctcactggt
tgccttgtggggtatttggcattgtgtgcatgcctgcttctaaaccaacatctcttgcaggaatgcttcggaaactggaa
atccagaaagaggaagatctgcagtcggtgtgtgaagtggctgcccatgtgttcagtgatggagtaacaaactggggtcg
agtggtgacgctcatctcgttcggtgcctttgttgcgaaacacctgaaaagcataaaccaggagaggtgcatcagctcgc
tggcagggatcatcacagatgcacttgtctcatctaagcgcgagtggctaatgagccagggaggctgggagggctttgtt
gacttctttcgagtcgaggacctagaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggctggactaggagc
aagcttggcatacatgatccggtga
>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=816 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatggtccag
gccatggcctctgtccccagccctgtcacacacctccctcagagggagaggggctgtggctgtttgccgtgcagtggctc
tattgaaatttgctcggctcttgctgttgctggagatgaaggactggaggcagccggcttggacgagccgggccggagtg
actgcattcctggccaggcctcgtgcttggcccgctctcccgaagcccagggaaaggccggagtttcacgatccagagtg
cctgccttcgccatag
>gnl|bcl2dbcds|A0A8C0BN28_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Buteo japonicus GN=BCL-2 (length=600 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctcgcagagggg
atacgactgggctgccgccgaggacagggcacccctgcctccaggtctctctcctcctgctgctgctgctgctgcggttg
ccgctgctgctgctgctgctgctgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgag
ccccccggctcggnggccaggggccgcttcgtggcggtggtggaggagctcttccgagacggcgtcaactggggcaggat
cgtggccttcttcgagttcggcggcgtgatgtgcgtggagagcgtcaaccgggagatgtctcccctcgtagacagcatcg
ccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgggatgcctttgtggag
ttgtatggcaacagtatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtggg
agcttgcatcactcttggcgcgtatcttggacataagtag
© 1998-2022Legal notice