Dataset for CDS BCL-2-like of organism Buteo japonicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B9Z3D5_BCL2A1-      atg--------------------------------------gaaactgct
A0A8C0ASR2_MCL1-01      ggg-----aacgg------------------actggaagtgagaactgac
A0A8C0BN28_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatag---tgct
A0A8C0AYR5_BCL2L1-      atg-----tccag-------------cagtaatcgggagttag---tgat
A0A8C0AYR5_BCL2L1-      atg-----tccag-------------cagtaatcgggagttag---tgat
                          *                                           **  

A0A8B9Z3D5_BCL2A1-      gagttctattacgtttattacttggctca-agattatctg----------
A0A8C0ASR2_MCL1-01      caattttacctgg--ttttgtgtagctcagaaatgagctggtttgggtc-
A0A8C0BN28_BCL2-01      gaagtacatccac--tataaactctcgcagaggggatacgactggg----
A0A8C0AYR5_BCL2L1-      tgactttgtttcc--tacaagctctcacagaagggatacagctggagtca
A0A8C0AYR5_BCL2L1-      tgactttgtttcc--tacaagctctcacagaagggatacagctggagtca
                            *          *      *  * ** *    *              

A0A8B9Z3D5_BCL2A1-      --------------------------caatatgtgcttcagg--------
A0A8C0ASR2_MCL1-01      --------------------------tagcctgagtcgtcggggtggcgg
A0A8C0BN28_BCL2-01      --------------------------------ctgccgccgagga-----
A0A8C0AYR5_BCL2L1-      gctggaggaggaggatgagaacaggactgactttgcagcagaggaggccg
A0A8C0AYR5_BCL2L1-      gctggaggaggaggatgagaacaggactgactttgcagcagaggaggccg
                                                          *     *         

A0A8B9Z3D5_BCL2A1-      -----aatcacatcttggaccagcccaaaccagggttgctcacgtcttgc
A0A8C0ASR2_MCL1-01      gactgag---------------------ctcctggcctcagggctcacgc
A0A8C0BN28_BCL2-01      -----cagggcacccctg---------cctccaggtctctctcctcctgc
A0A8C0AYR5_BCL2L1-      agatggacggcgtcctcaacgggagcccctcctggcacccgcccgccagc
A0A8C0AYR5_BCL2L1-      agatggacggcgtcctcaacgggagcccctcctggcacccgcccgccagc
                                                      *  **   *      *  **

A0A8B9Z3D5_BCL2A1-      ga---------aacattgcatcttcgctgcaagatcaaaccgaggaggct
A0A8C0ASR2_MCL1-01      tgggacttgtgggggctgcatcttct--cactggttgccttgtggggtat
A0A8C0BN28_BCL2-01      tgc----------tgctgctgctgcggttgccgctgctgct---------
A0A8C0AYR5_BCL2L1-      cacg--tagtgaacggagccgccatg--caccggagcagcctcgaagtcc
A0A8C0AYR5_BCL2L1-      cacg--tagtgaacggagccgccatg--caccggagcagcctcgaagtcc
                                         **  *          *                 

A0A8B9Z3D5_BCL2A1-      ctcagaccattcttggacaggattgatattacttctgtagctgtggccaa
A0A8C0ASR2_MCL1-01      ttggcattgtgt----gcatgcctgcttctaaaccaacatct--------
A0A8C0BN28_BCL2-01      ------------------gctgctgctgctgctgctgctgctg-------
A0A8C0AYR5_BCL2L1-      atgaaatcgttc----aaacagctgatg-tgaggcaggcgttgagagaag
A0A8C0AYR5_BCL2L1-      atgaaatcgttc----aaacagctgatg-tgaggcaggcgttgagagaag
                                               ** *  *    *      *        

A0A8B9Z3D5_BCL2A1-      ga----------------------------gaattttcaatggt------
A0A8C0ASR2_MCL1-01      ---------------------------------cttgcaggaat------
A0A8C0BN28_BCL2-01      ------------------------------ggacttcctctgatcacact
A0A8C0AYR5_BCL2L1-      caggggatgagtttgagttgaggtaccggcgggctttcagcgacctcact
A0A8C0AYR5_BCL2L1-      caggggatgagtttgagttgaggtaccggcgggctttcagcgacctcact
                                                          ** *            

A0A8B9Z3D5_BCL2A1-      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------gcttcggaaactggaaatccagaaagaggaagatctgcagtc
A0A8C0BN28_BCL2-01      gggctggtgtctccgcaccccgagccccccggctcggng-gccaggggcc
A0A8C0AYR5_BCL2L1-      ---------tcccagctccacatcacccctggcacggcgtatcaga----
A0A8C0AYR5_BCL2L1-      ---------tcccagctccacatcacccctggcacggcgtatcaga----

A0A8B9Z3D5_BCL2A1-      -----------gtcatggaagaaaaatttgctgatggaaatactaactgg
A0A8C0ASR2_MCL1-01      ggtgtgtg-aagtggctgcccatgtgttcagtgatggagtaacaaactgg
A0A8C0BN28_BCL2-01      gcttcgtggcggtggtggaggagctcttccgagacggcgt---caactgg
A0A8C0AYR5_BCL2L1-      gctttgagcaggtagtgaatgaactcttccgtgatggagt---gaactgg
A0A8C0AYR5_BCL2L1-      gctttgagcaggtagtgaatgaactcttccgtgatggagt---gaactgg
                                   **        *    **    ** **       ******

A0A8B9Z3D5_BCL2A1-      ggacgaattatgaccatatttacctttggaggtcttctcactaagaagct
A0A8C0ASR2_MCL1-01      ggtcgagtggtgacgctcatctcgttcggtgcctttgttgcgaaa-cacc
A0A8C0BN28_BCL2-01      ggcaggatcgtggccttcttcgagttcggcggc------gtgatg-tgcg
A0A8C0AYR5_BCL2L1-      ggtcgcatcgtggctttcttctccttcggagga------gccttg-tgtg
A0A8C0AYR5_BCL2L1-      ggtcgcatcgtggctttcttctccttcggagga------gccttg-tgtg
                        **  *  *  ** *  *  *    ** ** *                   

A0A8B9Z3D5_BCL2A1-      tcaagagcatggagttcaactcactggagaggagaaggagcagatt----
A0A8C0ASR2_MCL1-01      tgaaaagcataaa---------ccaggagaggtgcatcagctcgctggca
A0A8C0BN28_BCL2-01      tggagagcgtcaa---------ccgggaga--tgtctcccctcgtagaca
A0A8C0AYR5_BCL2L1-      tggagagcgttga---------caaggaga--tgcgggtattggtgggac
A0A8C0AYR5_BCL2L1-      tggagagcgttga---------caaggaga--tgcgggtattggtgggac
                        *  * *** *  *            *****   *                

A0A8B9Z3D5_BCL2A1-      --------tcttatttcatcacaga-gtacataataaacaacaaa--gcc
A0A8C0ASR2_MCL1-01      g-----------ggatcatcacagatgcacttgtct---catctaagcgc
A0A8C0BN28_BCL2-01      gcatcgccgcctggatgaccga----gtacctgaaccggcacctg--cac
A0A8C0AYR5_BCL2L1-      gcgttgtatcttggatgaccac----gtacttgaccgaccaccta--gat
A0A8C0AYR5_BCL2L1-      gcgttgtatcttggatgaccac----gtacttgaccgaccaccta--gat
                                       * * *      * ** *        *         

A0A8B9Z3D5_BCL2A1-      gaatggatagatgcgaatggtggctgg-----------------------
A0A8C0ASR2_MCL1-01      gagtggctaatgagccagggaggctgg-----------------------
A0A8C0BN28_BCL2-01      aactggatccaggacaacggaggctgg-----------------------
A0A8C0AYR5_BCL2L1-      ccctggatccaggagaatggcggatgg-----------------------
A0A8C0AYR5_BCL2L1-      ccctggatccaggagaatggcggatggtccaggccatggcctctgtcccc
                           *** *        * ** ** ***                       

A0A8B9Z3D5_BCL2A1-      --------------------------gaaaatggcttcctaacg------
A0A8C0ASR2_MCL1-01      -----------------------------gagggctttgttgac------
A0A8C0BN28_BCL2-01      -----------------------------gatgcctttgtggag------
A0A8C0AYR5_BCL2L1-      -----------------------------gagcggtttgtggac------
A0A8C0AYR5_BCL2L1-      agccctgtcacacacctccctcagagggagag-gggctgtggctgtttgc
                                                      *        *          

A0A8B9Z3D5_BCL2A1-      --------aagtttgaaagaa-------------------gatcactact
A0A8C0ASR2_MCL1-01      ---------------------------------ttctttcga--------
A0A8C0BN28_BCL2-01      ----------ttgtatggcaacagtatgaggcctttgttcgatttctcct
A0A8C0AYR5_BCL2L1-      ----------ctctacgggaa------------------cga----tgct
A0A8C0AYR5_BCL2L1-      cgtgcagtggctctattgaaa------------tttgctcggctcttgct

A0A8B9Z3D5_BCL2A1-      atcttt-----------------------------ctccaaaatc-----
A0A8C0ASR2_MCL1-01      --------gtcgagga-------------------cctagaaggcagcat
A0A8C0BN28_BCL2-01      ggatct-----------------------------ctctgaagactatcc
A0A8C0AYR5_BCL2L1-      gctgccgaggtgaggaagggccaggagac------cttcaacaaatggct
A0A8C0AYR5_BCL2L1-      gttgct--ggagatgaaggact-ggaggcagccggcttggacgag-----
                                                           *    *         

A0A8B9Z3D5_BCL2A1-      ----------acagccatgttcatagctgttttttccttgctcagagagt
A0A8C0ASR2_MCL1-01      cagaaatgtactgatggcgttt---gcaggtgtggctggactaggagcaa
A0A8C0BN28_BCL2-01      tgagtctgg-----------ttctggtggga--------gcttgcatcac
A0A8C0AYR5_BCL2L1-      cctgaccggggcgacgg------tggcaggagtgcttctgctgggat--c
A0A8C0AYR5_BCL2L1-      ccgggccggagtgactgcattcctggcc--aggcctcgtgcttggcccgc
                                                 *              **        

A0A8B9Z3D5_BCL2A1-      act--------------------actga----------------------
A0A8C0ASR2_MCL1-01      gcttggcatacat-----gatccggtga----------------------
A0A8C0BN28_BCL2-01      tcttggcgcgtatcttggacataagtag----------------------
A0A8C0AYR5_BCL2L1-      cct---------gctgagccgcaagtga----------------------
A0A8C0AYR5_BCL2L1-      tct---------cccgaagcccagggaaaggccggagtttcacgatccag

A0A8B9Z3D5_BCL2A1-      --------------------
A0A8C0ASR2_MCL1-01      --------------------
A0A8C0BN28_BCL2-01      --------------------
A0A8C0AYR5_BCL2L1-      --------------------
A0A8C0AYR5_BCL2L1-      agtgcctgccttcgccatag

© 1998-2023Legal notice