Dataset for CDS MCL-1 of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B4C6H5_MCL1-01      -------t--------tatttt-------c----------atttgtgtgg
A0A3B4C6H5_MCL1-03      atgatgat--------gagtcc-------caaggagatgtattttgataa
A0A3B4CGU9_MCL1-03      atgga-----------gagcgc----cgccat--cagcctgttctgtaac
A0A3B4CGU9_MCL1-02      atggaagctcacggtggagttcagatcaacatggcagctcatcctggag-
                                         *           *           *        

A0A3B4C6H5_MCL1-01      gaa---------------ttttctag-gaaatggccatggaattttcttt
A0A3B4C6H5_MCL1-03      gaagactgtttttccttctttgctggcgaagcgacc-----ttttactct
A0A3B4CGU9_MCL1-03      ggagcggggaggatcccgttcaacaaggg------ctcggagagccagct
A0A3B4CGU9_MCL1-02      gcagtatctgtgctccggttctccatggaagttcttttggaggtccagtc
                        * *               **       *                      

A0A3B4C6H5_MCL1-01      ggg-aa---------aaact------------------------gatcgc
A0A3B4C6H5_MCL1-03      ggg-tatatcctctcaaacccggg-------------cgcccaggatcgc
A0A3B4CGU9_MCL1-03      ggaccg------------cccgga-------------ccggcccgaccgc
A0A3B4CGU9_MCL1-02      acactgatatacctcatacacggaggtcagggaggttccagttccagctc
                                          *                          * * *

A0A3B4C6H5_MCL1-01      agct--------gttacagacggttct-----------------------
A0A3B4C6H5_MCL1-03      agct--------gttacagacggttct-----------------------
A0A3B4CGU9_MCL1-03      ggcctgga-gggactacaggcagcgcccggacccgct-------------
A0A3B4CGU9_MCL1-02      agctcagacgggttctcctgctgctcctgaactcactcacgtccaggtca
                         **             *   * *  *                        

A0A3B4C6H5_MCL1-01      ---------------------------------ctaccaacgtcccccgc
A0A3B4C6H5_MCL1-03      ---------------------------------ctaccaacgtcccccgc
A0A3B4CGU9_MCL1-03      --------------------agcaagg------ccgcca----------t
A0A3B4CGU9_MCL1-02      acagcattagcattagcagcaccaaggagcaaaccaccatcagcctgtgt
                                                         *  ***           

A0A3B4C6H5_MCL1-01      gtcggattgtgaggagt-tggactcagaccaattcaaggaatctgaaact
A0A3B4C6H5_MCL1-03      gtcggattgtgaggagt-tggactcagaccaattcaaggaatctgaaact
A0A3B4CGU9_MCL1-03      ggccggagggtcgctgc-ccgagtccccggagtccgacgacttcgtgccc
A0A3B4CGU9_MCL1-02      gacggagaggtgaccgtgctgattaaaccgaaaccaaag-------ggcc
                        * * *   *      *    ** *      *   * * *         * 

A0A3B4C6H5_MCL1-01      ------------------ttggacagagacacttcagaaatagtcattga
A0A3B4C6H5_MCL1-03      ------------------ttggacagagacacttcagaaatagtcattga
A0A3B4CGU9_MCL1-03      gacttcggcggcagcgccctggtggaggagacccggcggctcatcggggg
A0A3B4CGU9_MCL1-02      gagtcagg----------ctggaggaggagaccctctgcatcatcgggga
                                           ***     ** **        *  **   * 

A0A3B4C6H5_MCL1-01      ctttttgcaaaacttcaccgggctgtctcggtcctgtggtcggcaccgtg
A0A3B4C6H5_MCL1-03      ctttttgcaaaacttcaccgggctgtctcggtcctgtggtcggcaccgtg
A0A3B4CGU9_MCL1-03      cttttaccgcggatatatcggccag---aagacccgggaccagcaccccg
A0A3B4CGU9_MCL1-02      tttttaccagggatac------------aggagccgaaaccagcacccag
                         ****  *     *                *  * *    * *****  *

A0A3B4C6H5_MCL1-01      gggttgtacagacaataaggagggtggtggacggcctggtggtgaagcat
A0A3B4C6H5_MCL1-03      gggttgtacagacaataaggagggtggtggacggcctggtggtgaagcat
A0A3B4CGU9_MCL1-03      cccacg---gcacgatgagcagggtggtggagggggtgatcctcaagcac
A0A3B4CGU9_MCL1-02      cctcgg---acacgctgagcagagtggtggaggggatgctccacaaacac
                             *     **  * ** ** ******** **  ** *    ** ** 

A0A3B4C6H5_MCL1-01      gagctcgtctacaaaggtatgtttactaggctgggtatggaagacagagg
A0A3B4C6H5_MCL1-03      gagctcgtctacaaaggtatgtttactaggctgggtatggaagacagagg
A0A3B4CGU9_MCL1-03      agcatcgcgtacaacggtatggtccagcgattgtgtttggagcagcaaga
A0A3B4CGU9_MCL1-02      agtgttgcctacagcggtatggtccagcgattgtgtttggagcagcaaga
                            * *  ****  ****** *     *  ** ** ****  *   ** 

A0A3B4C6H5_MCL1-01      agatgacatgcatataattaggacagtggctaaggagctcttcagcgatg
A0A3B4C6H5_MCL1-03      agatgacatgcatataattaggacagtggctaaggagctcttcagcgatg
A0A3B4CGU9_MCL1-03      cgatagcatggagtttattagcagtgtggcgaagaccctgttcaatgatg
A0A3B4CGU9_MCL1-02      cgatagcatggaatttattagcagcgtggcgaagaccctgtttgatgatg
                         ***  **** *  * ***** *  ***** ***   ** **    ****

A0A3B4C6H5_MCL1-01      gcatcaccaactggggtcgaatcgccagcctgctggcctttggtgcagtg
A0A3B4C6H5_MCL1-03      gcatcaccaactggggtcgaatcgccagcctgctggcctttggtgcagtg
A0A3B4CGU9_MCL1-03      ggaccaccaactgggggcggattgccagtctggtggcgtttggtgcggtg
A0A3B4CGU9_MCL1-02      ggatcaccaactgggggcggattgccagtctggtggcgttgggtgcggtg
                        * * ************ ** ** ***** *** **** ** ***** ***

A0A3B4C6H5_MCL1-01      gtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttgt
A0A3B4C6H5_MCL1-03      gtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttgt
A0A3B4CGU9_MCL1-03      gtctgtgagcagatgaaggaagcaggcagagagcagtgtgtggagaacgt
A0A3B4CGU9_MCL1-02      gtctgtgagtggctgaaggaggtgggcagagagcagtgtgtggagaacgt
                        ** **  **     ***  *    *** ***  ** ** ***      **

A0A3B4C6H5_MCL1-01      gggccaagagatttcctcatatcttctttcagaccaaaaagactggctac
A0A3B4C6H5_MCL1-03      gggccaagagatttcctcatatcttctttcagaccaaaaagactggctac
A0A3B4CGU9_MCL1-03      catacaacacatctcaacgtacctcagtacagaccagcgacagtggctca
A0A3B4CGU9_MCL1-02      catacaacacatctcaatgtacctcagtacagaccagcgacagtggctca
                            *** * ** **    ** **   * *******   * * *****  

A0A3B4C6H5_MCL1-01      tgaaaaataaagcatgggatggctttgtggagttttttcatgtcccggat
A0A3B4C6H5_MCL1-03      tgaaaaataaagcatgggatggctttgtggagttttttcatgtcccggat
A0A3B4CGU9_MCL1-03      tcaacaacaaagcctggggaggttttgtggagttcttccgtgaagacgac
A0A3B4CGU9_MCL1-02      tcaacaacaaagcctggggaggttttgtggagttcttccgtgaagacgac
                        * ** ** ***** ****  ** *********** ** * **     ** 

A0A3B4C6H5_MCL1-01      cccgagtcaaaaatgaggaatgcattaatggccttggttactgcagcagg
A0A3B4C6H5_MCL1-03      cccgagtcaaaaatgaggaatgcattaatggccttggttactgcagcagg
A0A3B4CGU9_MCL1-03      tccgagtcacgcgtacggaacgctcttatggccttcgcgggattcgctgg
A0A3B4CGU9_MCL1-02      tccgagtcacgcgtacggaacgctcttatggccttcgcgggattcgctgg
                         ********    *  **** **  * ******** *        ** **

A0A3B4C6H5_MCL1-01      tgttggagcaggacttgttttattgtcaagataa
A0A3B4C6H5_MCL1-03      tgttggagcaggacttgttttattgtcaagataa
A0A3B4CGU9_MCL1-03      cctgggggcggggctagcactactgatgcgctga
A0A3B4CGU9_MCL1-02      cctgggggcggggctagcactactgatgcgctga
                          * ** ** ** ** *   ** **    * * *

© 1998-2020Legal notice