Dataset for CDS MCL-1 of organism Pygocentrus nattereri

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4C341_MCL1-01      -----------------------------------ttattttcatttgtg
A0A3B4C341_MCL1-02      atggtcaggctgttcggtgttgggttgagagtggtccactatgcaaaata
A0A3B4C341_MCL1-03      atgatgatg------------agtcccaaggagatgtattttg------a
A0A3B4CGU9_MCL1-03      ---------------------------atgga-----------gagcgc-
A0A3B4CGU9_MCL1-01      ---------------------------atggaagctcacggtggagttca
A0A3B4CGU9_MCL1-02      ---------------------------atggaagctcacggtggagttca

A0A3B4C341_MCL1-01      tgggaa---------------ttttctag-gaaatggccatggaattttc
A0A3B4C341_MCL1-02      tccaaagactgtttttccttctttgctggcgaagcgacc-----ttttac
A0A3B4C341_MCL1-03      taagaagactgtttttccttctttgctggcgaagcgacc-----ttttac
A0A3B4CGU9_MCL1-03      ---cgccat--cagcctgttctgtaacggagcggggaggatcccgttcaa
A0A3B4CGU9_MCL1-01      gatcaacatggcagctcatcctggag-gcagtatctgtgctccggttctc
A0A3B4CGU9_MCL1-02      gatcaacatggcagctcatcctggag-gcagtatctgtgctccggttctc
                                             *        *              **   

A0A3B4C341_MCL1-01      tttgggaa---------aaact----------------------------
A0A3B4C341_MCL1-02      tctgggtatatcctctcaaacccgggcgcccag-----------------
A0A3B4C341_MCL1-03      tctgggtatatcctctcaaacccgggcgcccag-----------------
A0A3B4CGU9_MCL1-03      caaggg------ctcggagagccagctggaccg------------cccgg
A0A3B4CGU9_MCL1-01      catggaagttcttttggaggtccagtcacactgatatacctcatacacgg
A0A3B4CGU9_MCL1-02      catggaagttcttttggaggtccagtcacactgatatacctcatacacgg
                           **            *                                

A0A3B4C341_MCL1-01      ---------------------gatcgcagctgttacagacggttct----
A0A3B4C341_MCL1-02      ---------------------gatcgcagctgttacagacggttct----
A0A3B4C341_MCL1-03      ---------------------gatcgcagctgttacagacggttct----
A0A3B4CGU9_MCL1-03      a-------------ccggcccgaccgcggcc----tgga-gggactacag
A0A3B4CGU9_MCL1-01      aggtcagggaggttccagttccagctcagct----cagacgggttctcct
A0A3B4CGU9_MCL1-02      aggtcagggaggttccagttccagctcagct----cagacgggttctcct
                                              * * * **       ** **        

A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-03      gcagcgcccggacccgct--------------------------------
A0A3B4CGU9_MCL1-01      gctgctcctgaactcactcacgtccaggtcaacagcattagcattagcag
A0A3B4CGU9_MCL1-02      gctgctcctgaactcactcacgtccaggtcaacagcattagcattagcag

A0A3B4C341_MCL1-01      --------------ctaccaacgtcccccgcgtcggattgtgaggagt-t
A0A3B4C341_MCL1-02      --------------ctaccaacgtcccccgcgtcggattgtgaggagt-t
A0A3B4C341_MCL1-03      --------------ctaccaacgtcccccgcgtcggattgtgaggagt-t
A0A3B4CGU9_MCL1-03      -agcaagg------ccgcca----------tggccggagggtcgctgc-c
A0A3B4CGU9_MCL1-01      caccaaggagcaaaccaccatcagcctgtgtgacggagaggtgaccgtgc
A0A3B4CGU9_MCL1-02      caccaaggagcaaaccaccatcagcctgtgtgacggagaggtgaccgtgc
                                      *  ***           * * *   *      *   

A0A3B4C341_MCL1-01      ggactcagaccaattcaaggaatctgaaact------------------t
A0A3B4C341_MCL1-02      ggactcagaccaattcaaggaatctgaaact------------------t
A0A3B4C341_MCL1-03      ggactcagaccaattcaaggaatctgaaact------------------t
A0A3B4CGU9_MCL1-03      cgagtccccggagtccgacgacttcgtgcccgacttcggcggcagcgccc
A0A3B4CGU9_MCL1-01      tgattaaaccgaaaccaaag-------ggccgagtcagg----------c
A0A3B4CGU9_MCL1-02      tgattaaaccgaaaccaaag-------ggccgagtcagg----------c
                         ** *      *   * * *         *                    

A0A3B4C341_MCL1-01      tggacagagacacttcagaaatagtcattgactttttgcaaaacttcacc
A0A3B4C341_MCL1-02      tggacagagacacttcagaaatagtcattgactttttgcaaaacttcacc
A0A3B4C341_MCL1-03      tggacagagacacttcagaaatagtcattgactttttgcaaaacttcacc
A0A3B4CGU9_MCL1-03      tggtggaggagacccggcggctcatcgggggcttttaccgcggatatatc
A0A3B4CGU9_MCL1-01      tggaggaggagaccctctgcatcatcggggatttttaccagggatac---
A0A3B4CGU9_MCL1-02      tggaggaggagaccctctgcatcatcggggatttttaccagggatac---
                        ***     ** **        *  **   *  ****  *     *     

A0A3B4C341_MCL1-01      gggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataag
A0A3B4C341_MCL1-02      gggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataag
A0A3B4C341_MCL1-03      gggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataag
A0A3B4CGU9_MCL1-03      ggccag---aagacccgggaccagcaccccgcccacg---gcacgatgag
A0A3B4CGU9_MCL1-01      ---------aggagccgaaaccagcacccagcctcgg---acacgctgag
A0A3B4CGU9_MCL1-02      ---------aggagccgaaaccagcacccagcctcgg---acacgctgag
                                   *  * *    * *****  *     *     **  * **

A0A3B4C341_MCL1-01      gagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggta
A0A3B4C341_MCL1-02      gagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggta
A0A3B4C341_MCL1-03      gagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggta
A0A3B4CGU9_MCL1-03      cagggtggtggagggggtgatcctcaagcacagcatcgcgtacaacggta
A0A3B4CGU9_MCL1-01      cagagtggtggaggggatgctccacaaacacagtgttgcctacagcggta
A0A3B4CGU9_MCL1-02      cagagtggtggaggggatgctccacaaacacagtgttgcctacagcggta
                         ** ******** **  ** *    ** **     * *  ****  ****

A0A3B4C341_MCL1-01      tgtttactaggctgggtatggaagacagaggagatgacatgcatataatt
A0A3B4C341_MCL1-02      tgtttactaggctgggtatggaagacagaggagatgacatgcatataatt
A0A3B4C341_MCL1-03      tgtttactaggctgggtatggaagacagaggagatgacatgcatataatt
A0A3B4CGU9_MCL1-03      tggtccagcgattgtgtttggagcagcaagacgatagcatggagtttatt
A0A3B4CGU9_MCL1-01      tggtccagcgattgtgtttggagcagcaagacgatagcatggagtttatt
A0A3B4CGU9_MCL1-02      tggtccagcgattgtgtttggagcagcaagacgatagcatggaatttatt
                        ** *     *  ** ** ****  *   **  ***  **** *  * ***

A0A3B4C341_MCL1-01      aggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcg
A0A3B4C341_MCL1-02      aggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcg
A0A3B4C341_MCL1-03      aggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcg
A0A3B4CGU9_MCL1-03      agcagtgtggcgaagaccctgttcaatgatgggaccaccaactgggggcg
A0A3B4CGU9_MCL1-01      agcagtgtggcgaagaccctgttcaatgatgggaccaccaactgggggcg
A0A3B4CGU9_MCL1-02      agcagcgtggcgaagaccctgtttgatgatgggatcaccaactgggggcg
                        ** *  ***** ***   ** **    ***** * ************ **

A0A3B4C341_MCL1-01      aatcgccagcctgctggcctttggtgcagtggtgtgccagcaccagaacc
A0A3B4C341_MCL1-02      aatcgccagcctgctggcctttggtgcagtggtgtgccagcaccagaacc
A0A3B4C341_MCL1-03      aatcgccagcctgctggcctttggtgcagtggtgtgccagcaccagaacc
A0A3B4CGU9_MCL1-03      gattgccagtctggtggcgtttggtgcggtggtctgtgagcagatgaagg
A0A3B4CGU9_MCL1-01      gattgccagtctggtggcgtttggtgcggtggtctgtgagcagatgaagg
A0A3B4CGU9_MCL1-02      gattgccagtctggtggcgttgggtgcggtggtctgtgagtggctgaagg
                         ** ***** *** **** ** ***** ***** **  **     ***  

A0A3B4C341_MCL1-01      aaatgggccgaggtcactgcgtgagtcttgtgggccaagagatttcctca
A0A3B4C341_MCL1-02      aaatgggccgaggtcactgcgtgagtcttgtgggccaagagatttcctca
A0A3B4C341_MCL1-03      aaatgggccgaggtcactgcgtgagtcttgtgggccaagagatttcctca
A0A3B4CGU9_MCL1-03      aagcaggcagagagcagtgtgtggagaacgtcatacaacacatctcaacg
A0A3B4CGU9_MCL1-01      aagcaggcagagagcagtgtgtggagaacgtcatacaacacatctcaacg
A0A3B4CGU9_MCL1-02      aggtgggcagagagcagtgtgtggagaacgtcatacaacacatctcaatg
                        *    *** ***  ** ** ***      **    *** * ** **    

A0A3B4C341_MCL1-01      tatcttctttcagaccaaaaagactggctactgaaaaataaagcatggga
A0A3B4C341_MCL1-02      tatcttctttcagaccaaaaagactggctactgaaaaataaagcatggga
A0A3B4C341_MCL1-03      tatcttctttcagaccaaaaagactggctactgaaaaataaagcatggga
A0A3B4CGU9_MCL1-03      tacctcagtacagaccagcgacagtggctcatcaacaacaaagcctgggg
A0A3B4CGU9_MCL1-01      tacctcagtacagaccagcgacagtggctcatcaacaacaaagcctgggg
A0A3B4CGU9_MCL1-02      tacctcagtacagaccagcgacagtggctcatcaacaacaaagcctgggg
                        ** **   * *******   * * *****  * ** ** ***** **** 

A0A3B4C341_MCL1-01      tggctttgtggagttttttcatgtcccggatcccgagtcaaaaatgagga
A0A3B4C341_MCL1-02      tggctttgtggagttttttcatgtcccggatcccgagtcaaaaatgagga
A0A3B4C341_MCL1-03      tggctttgtggagttttttcatgtcccggatcccgagtcaaaaatgagga
A0A3B4CGU9_MCL1-03      aggttttgtggagttcttccgtgaagacgactccgagtcacgcgtacgga
A0A3B4CGU9_MCL1-01      aggttttgtggagttcttccgtgaagacgactccgagtcacgcgtacgga
A0A3B4CGU9_MCL1-02      aggttttgtggagttcttccgtgaagacgactccgagtcacgcgtacgga
                         ** *********** ** * **     **  ********    *  ***

A0A3B4C341_MCL1-01      atgcattaatggccttggttactgcagcaggtgttggagcaggacttgtt
A0A3B4C341_MCL1-02      atgcattaatggccttggttactgcagcaggtgttggagcaggacttgtt
A0A3B4C341_MCL1-03      atgcattaatggccttggttactgcagcaggtgttggagcaggacttgtt
A0A3B4CGU9_MCL1-03      acgctcttatggccttcgcgggattcgctggcctgggggcggggctagca
A0A3B4CGU9_MCL1-01      acgctcttatggccttcgcgggattcgctggcctgggggcggggctagca
A0A3B4CGU9_MCL1-02      acgctcttatggccttcgcgggattcgctggcctgggggcggggctagca
                        * **  * ******** *        ** **  * ** ** ** ** *  

A0A3B4C341_MCL1-01      ttattgtcaagataa
A0A3B4C341_MCL1-02      ttattgtcaagataa
A0A3B4C341_MCL1-03      ttattgtcaagataa
A0A3B4CGU9_MCL1-03      ctactgatgcgctga
A0A3B4CGU9_MCL1-01      ctactgatgcgctga
A0A3B4CGU9_MCL1-02      ctactgatgcgctga
                         ** **    * * *

© 1998-2023Legal notice