Dataset for CDS BCL-2 of organism Nannospalax galili

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C6RID6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL-2 (length=711 residues).
atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaagtacatccactataagctgtcacagagggg
ctacgaatgggatgctggagatgcggacgccgcgcccctgggggccacccccgccccgggcatcttttcttccttgcctg
ggagcaacccaaccgccgctgtgcaccaggacccagccgccaggacctcgccgccgcgcctcccggctgcaatggctggg
caggcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctggggatgacttctcccgtcgttaccgccg
cgacttcgcagagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcaccgctggtggacaacatcgccctctggatgaccgactacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggatgcctttgtggaactgtatggacccagtgtgcggcccctgtttgacttctcttggctgtctc
tgaagaccctgctcagtctggccctggtaggggcctgcatcaccctgggtgcctatttgggccacaagtga
>gnl|bcl2dbcds|A0A8C6RID6_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Nannospalax galili GN=BCL-2 (length=642 residues).
atggcgcacgccggcagaacagggtatgataaccgggagattgtgatgaagtacatccactataagctgtcacagagggg
ctacgaatgggatgctggagatgcggacgccgcgcccctgggggccacccccgccccgggcatcttttcttccttgcctg
ggagcaacccaaccgccgctgtgcaccaggacccagccgccaggacctcgccgccgcgcctcccggctgcaatggctggg
caggcgctcagcccggtgccacctgtggtccacctgaccctccgccaggctggggatgacttctcccgtcgttaccgccg
cgacttcgcagagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgcttcgtcacggtggtggaggagc
tcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
agggagatgtcaccgctggtggacaacatcgccctctggatgaccgactacctgaaccggcacctgcacacctggatcca
ggataacggaggctgggtaggtgcacatctgactgaaggagtctgggtttcggtgatcattttctggtaccctgggaggt
ag
© 1998-2022Legal notice