Dataset for CDS BCL2A1 of organism Cricetulus griseus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A3L7HT14_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2A1 (length=711 residues).
atggcctgtgcgccaatgctagtccacagaggccacgccccctccctccccacggcgtccgagggcgatgggcgtggccg
gggcggtacttgccacgtgatggcggcggtggcagcaagcagcgccaagcggagcctgcgggccgagctgaagcagcgtt
tgcgggccttgagcgcggaggaacggctgcggcagtctcacctcctcacgcagaaggtgattgctcacagtcagtatcaa
aattccaaaagaatttccatctttttgagcatgcaagatgaaattgagacagaagagatcatcaaggacattttcaaaca
aggcaaaatctgcttcatccctcggtaccggttccagagcaatcacatggacatggtgagattagcatcacctgaagaga
tctctttacttcccaaaacatcctggaatattcatcagcccgctgagggagatgctcgagaggaggccttatccactggt
ggacttgacctcatcttcttgccaggccttgggtttgacaaagatggcaaccggctagggcggggcaagggctactatga
cacctacttgaagcgctgtgtgcagcaccaggaagtgaagccctacaccttggctttggctttcaaagagcagatctgcc
cccaggtcccagtggatgagcatgacatgaaggtagatgaagtcctttatgaagactgcccagcatcttaa
>gnl|bcl2dbcds|A0A3L7HT14_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2A1 (length=1002 residues).
atgattaccccttcgttgtcaagccatctttggcttagttgcctctttgactggacttggcagctccagtctgctctgcc
aaggacaatgactgactgtgagttcatgtacatccactcgctggctgaggactatcttcagtatgtcctgaaggtaccta
cttttgaatctgctccaagcaaaacatccagggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaat
ctgaaactatacttggatgattttgatgtgagatccatcgacactgccagaacaatattcaatcaagtgatggaaaaaga
atttgaagatggcatcattaactgggggaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttgcac
aagagcagattggcttggatgtgggtgcttacaagcaagtttccaattttgtggctgaattcataatgaataacacagca
gagtggatacgtcagaatggaggctgggtgattgctcacagtcagtatcaaaattccaaaagaatttccatctttttgag
catgcaagatgaaattgagacagaagagatcatcaaggacattttcaaacaaggcaaaatctgcttcatccctcggtacc
ggttccagagcaatcacatggacatggtgagattagcatcacctgaagagatctctttacttcccaaaacatcctggaat
attcatcagcccgctgagggagatgctcgagaggaggccttatccactggtggacttgacctcatcttcttgccaggcct
tgggtttgacaaagatggcaaccggctagggcggggcaagggctactatgacacctacttgaagcgctgtgtgcagcacc
aggaagtgaagccctacaccttggctttggctttcaaagagcagatctgcccccaggtcccagtggatgagcatgacatg
aaggtagatgaagtcctttatgaagactgcccagcatcttaa
>gnl|bcl2dbcds|A0A3L7HT14_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2A1 (length=699 residues).
atgattaccccttcgttgtcaagccatctttggcttagttgcctctttgactggacttggcagctccagtctgctctgcc
aaggacaatgactgactgtgagttcatgtacatccactcgctggctgaggactatcttcagtatgtcctgaaggtaccta
cttttgaatctgctccaagcaaaacatccagggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaat
ctgaaactatacttggatgattttgatgtgagatccatcgacactgccagaacaatattcaatcaagtgatggaaaaaga
atttgaagatggcatcattaactgggggaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttgcac
aagagcagattggcttggatgtgggtgcttacaagcaagtttccaattttgtggctgaattcataatgaataacacagca
gagtggatacgtcagaatggaggctgggaagatggcttcatgaagaagtttgaacctaaatctggctgggtgacttttct
ggaaacgatagggcagatctgggaaatgctcttttctcctcaagcaacactactggccagagaggaccctggctccttcg
acaatggtgaccatcacttagtacttccatttgcaaacaactcagctgacaggacttaa
>gnl|bcl2dbcds|G3GTB4_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2A1 (length=612 residues).
atgactgactgtgagttcatgtacatccactcgctggctgaggactatcttcagtatgtcctgaaggtacctacttttga
atctgctccaagcaaaacatccagggtgctacaaagagttgcttcctcagttcaaaaagaagtcgaaaagaatctgaaac
tatacttggatgattttgatgtgagatccatcgacactgccagaacaatattcaatcaagtgatggaaaaagaatttgaa
gatggcatcattaactgggggaggattgtgactgtatttgcctttgggggtgttctcctcaaaaaacttgcacaagagca
gattggcttggatgtgggtgcttacaagcaagtttccaattttgtggctgaattcataatgaataacacagcagagtgga
tacgtcagaatggaggctgggaagatggcttcatgaagaagtttgaacctaaatctggctgggtgacttttctggaaacg
atagggcagatctgggaaatgctcttttctcctcaagcaacactactggccagagaggaccctggctccttcgacaatgg
tgaccatcacttagtacttccatttgcaaacaactcagctgacaggacttaa
© 1998-2020Legal notice