Dataset for CDS BCL2L1 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O35843_BCL2L1-01      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-01      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-09      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
                      **************************************************

O35843_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgttgaagagaata
Q64373_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-09      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
                      *************************************** **********

O35843_BCL2L1-01      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-01      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-09      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
                      **************************************************

O35843_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-09      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
                      **************************************************

O35843_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-09      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
                      **************************************************

O35843_BCL2L1-01      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-01      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-09      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
                      **************************************************

O35843_BCL2L1-01      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-01      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-09      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
                      **************************************************

O35843_BCL2L1-01      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-01      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-09      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
                      **************************************************

O35843_BCL2L1-01      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-01      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-09      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
                      **************************************************

O35843_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-09      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
                      **************************************************

O35843_BCL2L1-01      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-01      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-09      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
                      **************************************************

O35843_BCL2L1-01      agaacggcggctggggtgtgagtggaggtacacccct-cagatctgtctt
Q64373_BCL2L1-01      agaacggcggctggg--------------acacttttgtggatc--tcta
Q64373_BCL2L1-09      agaacggcggctggg--------------acacttttgtggatc--tcta
                      ***************              ****   *   ****  *** 

O35843_BCL2L1-01      cagaaggcttgt-----tcaagtgccaggagtggc-ggagcacgtttg--
Q64373_BCL2L1-01      cgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaacc
Q64373_BCL2L1-09      cgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaacc
                      * * *    **       * ** *** * *  * * ***** * *     

O35843_BCL2L1-01      --tgatcccagcctttgggaggtggaaacagaaggatcggaagttcaagg
Q64373_BCL2L1-01      gctggttcctgac----gggcatgactgtggctggtgtggttctgctggg
Q64373_BCL2L1-09      gctggttcctgac----gggcatgactgtggctggtgtggttctgctggg
                        ** * ** * *    **   **      *  **   **   * *  **

O35843_BCL2L1-01      cc--ctcctcagctattatag-
Q64373_BCL2L1-01      ctcactcttcagtcggaagtga
Q64373_BCL2L1-09      ctcactcttcagtcggaagtga
                      *   *** ****     *  * 

© 1998-2020Legal notice