Dataset for CDS BCL2L1 of organism Mus musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


O35843_BCL2L1-01      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-04      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-03      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q5HZH3_BCL2L1-02      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-05      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-01      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-08      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-09      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-07      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
Q64373_BCL2L1-06      atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagct
                      **************************************************

O35843_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgttgaagagaata
Q64373_BCL2L1-04      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-03      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q5HZH3_BCL2L1-02      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-05      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-01      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-08      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-09      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-07      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
Q64373_BCL2L1-06      ttcccagaaaggatacagctggagtcagtttagtgatgtcgaagagaata
                      *************************************** **********

O35843_BCL2L1-01      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-04      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-03      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q5HZH3_BCL2L1-02      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-05      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-01      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-08      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-09      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-07      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
Q64373_BCL2L1-06      ggactgaggccccagaagaaactgaagcagagagggagacccccagtgcc
                      **************************************************

O35843_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-04      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-03      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q5HZH3_BCL2L1-02      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-05      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-01      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-08      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-09      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-07      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
Q64373_BCL2L1-06      atcaatggcaacccatcctggcacctggcggatagcccggccgtgaatgg
                      **************************************************

O35843_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-04      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-03      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q5HZH3_BCL2L1-02      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-05      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-01      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-08      agccactggccacagcagcagtttggatgcgcgg----------------
Q64373_BCL2L1-09      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-07      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
Q64373_BCL2L1-06      agccactggccacagcagcagtttggatgcgcgggaggtgattcccatgg
                      **********************************                

O35843_BCL2L1-01      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-04      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-03      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q5HZH3_BCL2L1-02      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-05      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-01      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
Q64373_BCL2L1-07      cagcagtgaagcaagcgctgagagaggcaggcgatgagtt----------
Q64373_BCL2L1-06      cagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcgg
                                                                        

O35843_BCL2L1-01      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-04      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-03      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q5HZH3_BCL2L1-02      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-05      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-01      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      taccggagagcgttcagtgatctaacatcccagcttcacataaccccagg
                                                                        

O35843_BCL2L1-01      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-04      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-03      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q5HZH3_BCL2L1-02      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-05      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-01      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      gaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
                                                                        

O35843_BCL2L1-01      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-04      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-03      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q5HZH3_BCL2L1-02      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-05      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-01      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactg
                                                                        

O35843_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-04      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-03      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q5HZH3_BCL2L1-02      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-05      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-01      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggattgc
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      tgcgtggaaagc--------------------------------------
                                                                        

O35843_BCL2L1-01      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-04      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-03      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q5HZH3_BCL2L1-02      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-05      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-01      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      aagttggatggccacctatctgaatgaccacctagagccttggatccagg
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      --------------------------------------------------
                                                                        

O35843_BCL2L1-01      agaacggcggctggg--gtgtgagtggaggtacacccctcagatctgtct
Q64373_BCL2L1-04      agaacggcggctggg-----------------------------------
Q64373_BCL2L1-03      agaacggcggctggg-----------------------------------
Q5HZH3_BCL2L1-02      agaacggcggctgggacacttttgtggatctctacgggaacaatgcagca
Q64373_BCL2L1-05      agaacggcggctgg------------------------------------
Q64373_BCL2L1-01      agaacggcggctgggacacttttgtggatctctacgggaacaatgcagca
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      agaacggcggctgggacacttttgtggatctctacgggaacaatgcagca
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      --------------------------------------------------
                                                                        

O35843_BCL2L1-01      tcagaaggcttg---------------ttcaagtgccaggagtggcggag
Q64373_BCL2L1-04      ----------------------------taagaaccacgccccttgtgtg
Q64373_BCL2L1-03      ----------------------------taagaaccacgccccttgtgtg
Q5HZH3_BCL2L1-02      gccgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
Q64373_BCL2L1-05      --------------------------------------------------
Q64373_BCL2L1-01      gccgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      gccgagagccggaaaggccaggagcgcttcaaccgctggttcctgacggg
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      --------------------------------------------------
                                                                        

O35843_BCL2L1-01      cacgtttgtgatcccagcctttgggaggtggaaacagaaggatcggaagt
Q64373_BCL2L1-04      tccgccccttgcttgtgtctctcttctctgtgaacatccctaa-------
Q64373_BCL2L1-03      tccgccccttgcttgtgtctctcttctctgtgaacatccctaa-------
Q5HZH3_BCL2L1-02      catgactgtggctggtgtggttctgctgggctcactcttcagtcggaagt
Q64373_BCL2L1-05      --------------------------------------------------
Q64373_BCL2L1-01      catgactgtggctggtgtggttctgctgggctcactcttcagtcggaagt
Q64373_BCL2L1-08      --------------------------------------------------
Q64373_BCL2L1-09      catgactgtggctggtgtggttctgctgggctcactcttcagtcggaagt
Q64373_BCL2L1-07      --------------------------------------------------
Q64373_BCL2L1-06      --------------------------------------------------
                                                                        

O35843_BCL2L1-01      tcaaggccctcctcagctattatag
Q64373_BCL2L1-04      -------------------------
Q64373_BCL2L1-03      -------------------------
Q5HZH3_BCL2L1-02      ga-----------------------
Q64373_BCL2L1-05      -------------------------
Q64373_BCL2L1-01      ga-----------------------
Q64373_BCL2L1-08      -------------------------
Q64373_BCL2L1-09      ga-----------------------
Q64373_BCL2L1-07      -------------------------
Q64373_BCL2L1-06      -------------------------
                                               

© 1998-2020Legal notice