Dataset for CDS BCL2L1 of organism Mus musculus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|O35843_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=708 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgttgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctggggtgtgagtggaggtacacccctcagatctgtcttcagaaggcttgttcaagtgccaggagtggcggagcacgttt
gtgatcccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcctcagctattatag
>gnl|bcl2dbcds|Q5HZH3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q64373_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q64373_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=630 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgcttgtgtctctcttctctgtgaacatccctaa
>gnl|bcl2dbcds|Q64373_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=630 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgcttgtgtctctcttctctgtgaacatccctaa
>gnl|bcl2dbcds|Q64373_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=564 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgg
>gnl|bcl2dbcds|Q64373_BCL2L1-06 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=462 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagc
>gnl|bcl2dbcds|Q64373_BCL2L1-07 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=290 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtt
>gnl|bcl2dbcds|Q64373_BCL2L1-08 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=234 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgg
>gnl|bcl2dbcds|Q64373_BCL2L1-09 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
© 1998-2022Legal notice