Dataset for CDS BCL2A1 of organism Terrapene carolina triunguis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A674K8Q6_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=BCL2A1 (length=495 residues).
atggaacgctctgagtactgctatgtttaccatttagtccaagattatctgaaatacgttcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgttttaagaactactgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacacttgatattacctctgtagatgctgccagaagaattttcactgaagtcgtggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaggcttcaagaacacaa
agttcagcttacaggagataataaagagcagatttcttatttcatcacggagtacattataaacaacaaggctgagtgga
tagaggcaaatggaggttgggtaagtttcagtgctgtattttataaccatttttcactgttgtctagatcaggagaattt
tccttaatacattaa
© 1998-2023Legal notice