Dataset for CDS BCL2L2 of organism Propithecus coquereli

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6GWM6_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A2K6GWM6_BCL2L2-      atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtc-
A0A2K6GWM6_BCL2L2-      atggcgaccccagcctcagccccagacaca-cgggctctggtggcagact
A0A2K6GWM6_BCL2L2-      atggcgaccccagcctcagccccagacaca-cgggctctggtggcagact
                        ****** *  * **  * **  ***   ** ****  ***  *** * * 

A0A2K6GWM6_BCL2L2-      ---ggggctccgggccggggcggcggcgccatct-tgtgcccggggccgg
A0A2K6GWM6_BCL2L2-      ---ggggctccgggccggggcggcggcgccatct-tgtgcccggggccgg
A0A2K6GWM6_BCL2L2-      ttgtaggctataagctgaggcagaagggttatgtctgtggagctggcccg
A0A2K6GWM6_BCL2L2-      ttgtaggctataagctgaggcagaagggttatgtctgtggagctggcccg
                             ****    ** * *** *  * *  ** * ****     **** *

A0A2K6GWM6_BCL2L2-      tggggaggccggggagggggccccggggggcgcaggggactacgggaacg
A0A2K6GWM6_BCL2L2-      tggggaggccggggagggggccccggggggcgcaggggactacgggaacg
A0A2K6GWM6_BCL2L2-      ggggagggcccagcagctgaccc-----gctgcaccaagccatgcgggca
A0A2K6GWM6_BCL2L2-      ggggagggcccagcagctgaccc-----gctgcaccaagccatgcgggca
                         ***  ****  * **  * ***     *  ***     * * * *  * 

A0A2K6GWM6_BCL2L2-      gcctg----gagtctgag------------------------gaactgga
A0A2K6GWM6_BCL2L2-      gcctg----gagtctgag------------------------gaactgga
A0A2K6GWM6_BCL2L2-      gctggagatgagtttgagacccgcttccggcgtaccttctctgatctggc
A0A2K6GWM6_BCL2L2-      gctggagatgagtttgagacccgcttccggcgtaccttctctgatctggc
                        **  *    **** ****                        ** **** 

A0A2K6GWM6_BCL2L2-      gcctggggagctgctgctggagcccgagccggagcccgagcccgaagagg
A0A2K6GWM6_BCL2L2-      gcctgggga-----------------------------------------
A0A2K6GWM6_BCL2L2-      ggct---cagctgcatgtgacccccgg--------ctcagcccagcagcg
A0A2K6GWM6_BCL2L2-      ggct---cagctgcatgtgacccccgg--------ctcagcccagcagcg
                        * **    *                                         

A0A2K6GWM6_BCL2L2-      agccgccccggcccc------gcgcccccccgggagctccg---------
A0A2K6GWM6_BCL2L2-      --------------------------------------------------
A0A2K6GWM6_BCL2L2-      cttcacccaggtctccgatgaacttttccaagggggccccaactggggcc
A0A2K6GWM6_BCL2L2-      cttcacccaggtctccgatgaacttttccaagggggccccaactggggcc

A0A2K6GWM6_BCL2L2-      -------ggccctggtcctggctcgggagcccccggcagccaggag----
A0A2K6GWM6_BCL2L2-      ---------------------------------------ccaggag----
A0A2K6GWM6_BCL2L2-      gccttgtggccttcttcgtctttggggctgcactgtgtgctgagagtgtc
A0A2K6GWM6_BCL2L2-      gccttgtggccttcttcgtctttggggctgcactgtgtgctgagagtgtc
                                                               *   ***    

A0A2K6GWM6_BCL2L2-      ---gaggaggaggagcc------gggac--------tggtcgagggtgac
A0A2K6GWM6_BCL2L2-      ---gaggaggaggagcc------gggac--------tggtcgagggtgac
A0A2K6GWM6_BCL2L2-      aacaaggagatggagccactggtgggacaagtgcaggagtggatggtggc
A0A2K6GWM6_BCL2L2-      aacaaggagatggagccactggtgggacaagtgcaggagtggatggtggc
                            *****  ******      *****          ** ** **** *

A0A2K6GWM6_BCL2L2-      ---ccgggggacggcgc-------------------cattgaggacccgg
A0A2K6GWM6_BCL2L2-      ---ccgggggacggcgc-------------------cattgaggacccgg
A0A2K6GWM6_BCL2L2-      ctacctggagacacggctggccgactggatccacagcagtgggggctggg
A0A2K6GWM6_BCL2L2-      ctacctggagacacggctggccgactggatccacagcagtgggggctggg
                           ** ** ***   **                   ** ** ** *  **

A0A2K6GWM6_BCL2L2-      agctggaagccatcaaagctc------gggtcagggagatggaggaagaa
A0A2K6GWM6_BCL2L2-      agctggaagccatcaaagctc------gggtcagggagatggaggaagaa
A0A2K6GWM6_BCL2L2-      agctggaagccatcaaagctc------gggtcagggagatggaggaagaa
A0A2K6GWM6_BCL2L2-      cg------gagttcacagctctatacggggacggggccctggaggagg--
                         *      *   *** *****      *** * ***   ******* *  

A0A2K6GWM6_BCL2L2-      gctgagaagttaaaagagctacagaacgaggtagagaagcagatgaatat
A0A2K6GWM6_BCL2L2-      gctgagaagttaaaagagctacagaacgaggtagagaagcagatgaatat
A0A2K6GWM6_BCL2L2-      gctgagaagttaaaagagctacagaacgaggtagagaagcagatgaatat
A0A2K6GWM6_BCL2L2-      --------------------------cgcgg-------------------
                                                  ** **                   

A0A2K6GWM6_BCL2L2-      gagtccacctccaggcaatgctggtccagtgatcatgtccattgaagaga
A0A2K6GWM6_BCL2L2-      gagtccacctccaggcaatgctggtccagtgatcatgtccattgaagaga
A0A2K6GWM6_BCL2L2-      gagtccacctccaggcaatgctggtccagtgatcatgtccattgaagaga
A0A2K6GWM6_BCL2L2-      -----------------------------------cgtctgcgggagggg
                                                            ***    * ** * 

A0A2K6GWM6_BCL2L2-      aaatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
A0A2K6GWM6_BCL2L2-      aaatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
A0A2K6GWM6_BCL2L2-      aaatggaggctgatgcccgttccatctatgttggcaatgtggactatggt
A0A2K6GWM6_BCL2L2-      aactggg---------------catcagtgaggacagtgctga-------
                        ** ***                ****  **  * ** **  **       

A0A2K6GWM6_BCL2L2-      gcaacagcagaagagctggaagctcactttcatggttgtggttcagtcaa
A0A2K6GWM6_BCL2L2-      gcaacagcagaagagctggaagctcactttcatggttgtggttcagtcaa
A0A2K6GWM6_BCL2L2-      gcaacagcagaagagctggaagctcactttcatggttgtggttcagtcaa
A0A2K6GWM6_BCL2L2-      -caggggccgtggcactgggggccc-------------------------
                         **   ** *  *  ****  ** *                         

A0A2K6GWM6_BCL2L2-      ccgtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttg
A0A2K6GWM6_BCL2L2-      ccgtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttg
A0A2K6GWM6_BCL2L2-      ccgtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttg
A0A2K6GWM6_BCL2L2-      ------------------tggtaactgtaggggcc---------------
                                          **  ** * *** ****               

A0A2K6GWM6_BCL2L2-      catatatagagttctcagacaaagagtcagtgaggacttccctggcctta
A0A2K6GWM6_BCL2L2-      catatatagagttctcagacaaagagtcagtgaggacttccctggcctta
A0A2K6GWM6_BCL2L2-      catatatagagttctcagacaaagagtcagtgaggacttccctggcctta
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6GWM6_BCL2L2-      gatgagtccctgtttagaggaagacaaatca-------------------
A0A2K6GWM6_BCL2L2-      gatgagtccctgtttagaggaagacaaatca-------------------
A0A2K6GWM6_BCL2L2-      gatgagtccctgtttagaggaagacaaatcaaggtaagcctgtgctttcc
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6GWM6_BCL2L2-      --------------------aggtgatcccaaaacgaaccaacagaccag
A0A2K6GWM6_BCL2L2-      --------------------aggtgatcccaaaacgaaccaacagaccag
A0A2K6GWM6_BCL2L2-      attgtacatcctttactctcaggtgatcccaaaacgaaccaacagaccag
A0A2K6GWM6_BCL2L2-      --------tttttcgctagcaagtga------------------------
                                            * ****                        

A0A2K6GWM6_BCL2L2-      gcatcagcacaacagaccggggtttcccacgagcccgctaccgtgcccgg
A0A2K6GWM6_BCL2L2-      gcatcagcacaacagaccggggtttcccacgagcccgctaccgtgcccgg
A0A2K6GWM6_BCL2L2-      gcatcagcacaacagaccggggtttcccacgagcccgctaccgtgcccgg
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6GWM6_BCL2L2-      actaccaactacaacagttcccgctctcgattctacagtggttttaacag
A0A2K6GWM6_BCL2L2-      actaccaactacaacagttcccgctctcgattctacagtggttttaacag
A0A2K6GWM6_BCL2L2-      actaccaactacaacagttcccgctctcgattctacagtggttttaacag
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6GWM6_BCL2L2-      caggccccggggtcgcgtctacaggggccgggctagagcgacatcatggt
A0A2K6GWM6_BCL2L2-      caggccccggggtcgcgtctacaggggccgggctagagcgacatcatggt
A0A2K6GWM6_BCL2L2-      caggccccggggtcgcgtctacaggggccgggctagagcgacatcatggt
A0A2K6GWM6_BCL2L2-      --------------------------------------------------

A0A2K6GWM6_BCL2L2-      attccccttactaa
A0A2K6GWM6_BCL2L2-      attccccttactaa
A0A2K6GWM6_BCL2L2-      attccccttactaa
A0A2K6GWM6_BCL2L2-      --------------

© 1998-2022Legal notice