Dataset for CDS BCL2L2 of organism Propithecus coquereli

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A2K6GWM6_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L2 (length=921 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctggggagctgctgctggagcccgagccggagcccgagcccgaagaggagccgccccggccccgcgccccc
ccgggagctccgggccctggtcctggctcgggagcccccggcagccaggaggaggaggaggagccgggactggtcgaggg
tgacccgggggacggcgccattgaggacccggagctggaagccatcaaagctcgggtcagggagatggaggaagaagctg
agaagttaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggtccagtgatc
atgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaaga
gctggaagctcactttcatggttgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaag
ggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctgtttagaggaaga
caaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggtttcccacgagcccgctaccg
tgcccggactaccaactacaacagttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctaca
ggggccgggctagagcgacatcatggtattccccttactaa
>gnl|bcl2dbcds|A0A2K6GWM6_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgtaccttctctgatctggcggctcagctgcatgtgacccccggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggagctggaagccatcaaagctcgggtcagggagatggaggaagaagct
gagaagttaaaagagctacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggtccagtgat
catgtccattgaagagaaaatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggttgtggttcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccctggccttagatgagtccctgtttagaggaag
acaaatcaaggtaagcctgtgctttccattgtacatcctttactctcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggtttcccacgagcccgctaccgtgcccggactaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2K6GWM6_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L2 (length=813 residues).
atggcggcggcggcggcggcggcagcagcagcgggggctgcgggcggtcggggctccgggccggggcggcggcgccatct
tgtgcccggggccggtggggaggccggggagggggccccggggggcgcaggggactacgggaacggcctggagtctgagg
aactggagcctggggaccaggaggaggaggaggagccgggactggtcgagggtgacccgggggacggcgccattgaggac
ccggagctggaagccatcaaagctcgggtcagggagatggaggaagaagctgagaagttaaaagagctacagaacgaggt
agagaagcagatgaatatgagtccacctccaggcaatgctggtccagtgatcatgtccattgaagagaaaatggaggctg
atgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaagctcactttcatggttgtggt
tcagtcaaccgtgttaccatactgtgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
agagtcagtgaggacttccctggccttagatgagtccctgtttagaggaagacaaatcaaggtgatcccaaaacgaacca
acagaccaggcatcagcacaacagaccggggtttcccacgagcccgctaccgtgcccggactaccaactacaacagttcc
cgctctcgattctacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggta
ttccccttactaa
>gnl|bcl2dbcds|A0A2K6GWM6_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggcagactttgtaggctataagctgaggcagaagggtta
tgtctgtggagctggcccgggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgtaccttctctgatctggcggctcagctgcatgtgacccccggctcagcccagcagcgcttcacc
caggtctccgatgaacttttccaagggggccccaactggggccgccttgtggccttcttcgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggagccactggtgggacaagtgcaggagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtagg
ggcctttttcgctagcaagtga
© 1998-2021Legal notice