Dataset for CDS BCL2A1 of organism Microcebus murinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C5VB12_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2A1 (length=561 residues).
atgaagcagctccagaccctgctccccgccgggcggaagatgacgggctgcgagttcgaattcacccgagagctggccca
ggactacctgcagcatgtcctgcgggcgccgcagcccgggtccagccccagcgaggcgtcccgggtgctgcggagcgtgg
cctcctccgtccaaaacgaagtggaaaggagactggaaccgtgcctggacaatttcaacgtcgcctccgtagagacggcc
agagccatcttcagtcgcgtgatggagcaggagttcggggacggcgtcgtcaactggggaagggtcgtgaccgtgtttgc
gttcggaggcgtcctcaccaagagactcctgcgggagcgggcggccctggacccggacgcgtgcaagcagatttctcacc
tcatcgccgagttcgtagtgagccacacgggagagtggattcggcagaacggaggctgggagcacggcttcgtgaagaag
tttgaacccaggcctgcctggctgacttttctggaagtcttggggaaggtctgtggcgtgctgtctctcctccactactg
a
© 1998-2022Legal notice