Dataset for CDS BCL-2-like of organism Tursiops truncatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2U3V0P1_BCL2L1-      atg-----------------------------------------------
A0A2U4BHU7_BCL2-01      atg-gcg-------------------------------------------
A0A2U3V2H3_MCL1-01      atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgg
A0A2U4CFE3_BCL2L2-      atg-gcgacccca-------------------------------------

A0A2U3V0P1_BCL2L1-      ----------------------------------------tctcagagca
A0A2U4BHU7_BCL2-01      ---------------------------------------cacgctgggag
A0A2U3V2H3_MCL1-01      gggggccggattgggaccggatagcggcagcggcgcctccgctccgggaa
A0A2U4CFE3_BCL2L2-      ----------------------------------gcctcggccccagaca
                                                                 * *      

A0A2U3V0P1_BCL2L1-      atcgggagctggtggttg--------------------------------
A0A2U4BHU7_BCL2-01      aacagggtatgataaccg----------------------ggagatagtg
A0A2U3V2H3_MCL1-01      ggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtaggg
A0A2U4CFE3_BCL2L2-      cacgggctctagtggcag--------------------------------
                          * *    *       *                                

A0A2U3V0P1_BCL2L1-      ---------actttctctcctacaagctttccca----------------
A0A2U4BHU7_BCL2-01      atgaagtacatcc-----actataagctgtcgca----------------
A0A2U3V2H3_MCL1-01      ggaggggaagccggcgaggtgattggcggaagcgccggcccgagcccccc
A0A2U4CFE3_BCL2L2-      ---------actttgtaggctataagctgaggca----------------
                                             *   **     *                 

A0A2U3V0P1_BCL2L1-      -----------------------gaaaggataca--------gctggagt
A0A2U4BHU7_BCL2-01      -----------------------gaggggctacgagtgggatgccggagt
A0A2U3V2H3_MCL1-01      ggccactctcgcgcccgacgcccggagggtcgcgcggccctcgcc-----
A0A2U4CFE3_BCL2L2-      -----------------------gaagggttatg----------------
                                               *   **                     

A0A2U3V0P1_BCL2L1-      cagtttagcgatgtggacgagaacagaactgaggccccagaagggactga
A0A2U4BHU7_BCL2-01      cg--cgggcg------------------ccacgtccccgggggccgcc--
A0A2U3V2H3_MCL1-01      ca--ttggcg------------------ccgagggccccgacgtcaccg-
A0A2U4CFE3_BCL2L2-      ----tttgtg------------------gagctggccccgggg-------
                               * *                         *** *  *       

A0A2U3V0P1_BCL2L1-      atcagacatggaaacacccagtgccatcaatggcaacccatcctggcacc
A0A2U4BHU7_BCL2-01      -----------------cccgcgccg-----ggcatcttctcctcccagc
A0A2U3V2H3_MCL1-01      --------------cgacccgcgcca-----ggctgctgttcttcgcg--
A0A2U4CFE3_BCL2L2-      -------------------agggccc-----agcagctg-----------
                                            * ***       **  *             

A0A2U3V0P1_BCL2L1-      tggcagacagccctgcggt--------------gaatgtagccactggcc
A0A2U4BHU7_BCL2-01      ctgggagcaccccagcgccatccaggacctccccgccgccgccccagacc
A0A2U3V2H3_MCL1-01      ------------------------------cccacccgccgcgcctcgcc
A0A2U4CFE3_BCL2L2-      ---------------------------------acccgctgcaccaagcc
                                                             *  **  *   **

A0A2U3V0P1_BCL2L1-      acagcag------cagcttggatgcccgggaggtgat--ccccatggca-
A0A2U4BHU7_BCL2-01      gctcccgccgcccccgccggggggcctgcgctcag----ccccgtgccac
A0A2U3V2H3_MCL1-01      gcccgaa------gagatggaatcctcggtctccgacgccatcatgtcgc
A0A2U4CFE3_BCL2L2-      atgcggg------cagctgga-----------------------------
                                       *   *                              

A0A2U3V0P1_BCL2L1-      --gcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgagg
A0A2U4BHU7_BCL2-01      ctgtggtccacctgaccctgcgccaggccggtgatgatttttctcgtcgc
A0A2U3V2H3_MCL1-01      ccgaagaggagctggacgggtgcgagccgga--------------gcctc
A0A2U4CFE3_BCL2L2-      --------------gatgagttcgagac------------------ccgc
                                           *    ** *                      

A0A2U3V0P1_BCL2L1-      t-------------accggcgggcatt--cagcgacctgacatcccagct
A0A2U4BHU7_BCL2-01      t-------------accgccgcgacttcgccgagat--gtccagccagct
A0A2U3V2H3_MCL1-01      tagggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggcc
A0A2U4CFE3_BCL2L2-      t-------------tccggcgcacctt--ctcggatctggcagctcagct
                        *              *** *     **  *    *   * *      ** 

A0A2U3V0P1_BCL2L1-      ccacatcac--cccagggacgg----------catatcagagctttgagc
A0A2U4BHU7_BCL2-01      gcacctgacgcccttcaccgcgaggg------------gacgctttgcca
A0A2U3V2H3_MCL1-01      a---gtaacagcccgggcaaggacggctcactcccctcgacgccgccccc
A0A2U4CFE3_BCL2L2-      gcatgtgac--cccaggctcgg----------cccagcaacgcttcaccc
                             * **  **        *                   **       

A0A2U3V0P1_BCL2L1-      aggtagtgaacgaactcttccgggatggggtgaactggggtcg-----ca
A0A2U4BHU7_BCL2-01      cggtggtggaggagctcttcagggatggagtgaactgggggag-----ga
A0A2U3V2H3_MCL1-01      ag----cagagg---------aggaggaggacgagttgtaccggcagtcc
A0A2U4CFE3_BCL2L2-      aggtctctgatgaactcttccaaggggggcccaactggggccg-----cc
                         *       * *           *  *      * * *    *       

A0A2U3V0P1_BCL2L1-      ttgtgg-----cctttttctccttcggtggggcactgtgcgtggaaagcg
A0A2U4BHU7_BCL2-01      tcgtgg-----ccttctttgagttcggtggggtcatgtgtgtggagagcg
A0A2U3V2H3_MCL1-01      ctggagattatctctcgatacctccgggagcaggc----------aaccg
A0A2U4CFE3_BCL2L2-      ttgtgg-----ctttctttgtctttggagccgcgctgtgtgctgagagtg
                          *  *     *  *       *  **                   *  *

A0A2U3V0P1_BCL2L1-      tagacaaggagatgcaggtattggtgagtcggattgcagcttggatggcc
A0A2U4BHU7_BCL2-01      tcaaccgggagatgtcccccct------------------------ggtg
A0A2U3V2H3_MCL1-01      gcaccaaggacgcgaagccact----------gggcgggtctgg--ggcc
A0A2U4CFE3_BCL2L2-      tcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtg
                            *  ***   *       *                        **  

A0A2U3V0P1_BCL2L1-      acttacc--------------------tgaatgacca------------c
A0A2U4BHU7_BCL2-01      gacaaca---------tcg---ccctgtggatgactgagt---------a
A0A2U3V2H3_MCL1-01      gccagccggaaagcgttagagaccctgcgacgggtcggggacggtgtgca
A0A2U4CFE3_BCL2L2-      gcctacc---------tggagac---gcggctggccg------------a
                             *                      *   *                 

A0A2U3V0P1_BCL2L1-      ctagagc-------------------------------------------
A0A2U4BHU7_BCL2-01      cctgaac---------------------------cgacacctg-------
A0A2U3V2H3_MCL1-01      acggaaccacgagacggccttccaaggcatgcttcggaaactggacatca
A0A2U4CFE3_BCL2L2-      ctggatccaca-------------------gcagcgggggctgggcg---
                           ** *                                           

A0A2U3V0P1_BCL2L1-      --------------------cttggatc---------------------c
A0A2U4BHU7_BCL2-01      ----------------cacacctggatc---------------------c
A0A2U3V2H3_MCL1-01      aaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttc
A0A2U4CFE3_BCL2L2-      -----------gagttcacagctctata---------------------c
                                              *   *                      *

A0A2U3V0P1_BCL2L1-      aggagaacggcg------gctgggac------------------------
A0A2U4BHU7_BCL2-01      aggataacggag------gctgggat------------------------
A0A2U3V2H3_MCL1-01      agt--gacggagtaacaaactggggcaggattgtgactctcatttctttt
A0A2U4CFE3_BCL2L2-      ggg--gacggggc-----cctggaggaggcgcg-----------------
                         *    **** *       ****                           

A0A2U3V0P1_BCL2L1-      ---actttcgtgg-----------------------------aactctat
A0A2U4BHU7_BCL2-01      ---gcctttgtgg-----------------------------agctgtac
A0A2U3V2H3_MCL1-01      ggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcat
A0A2U4CFE3_BCL2L2-      ---gcgtctgcgg-----------------------gaggggaactg---
                            * *  * **                             * **    

A0A2U3V0P1_BCL2L1-      gggaac--------aatgcagcagccgagagccggaagggccag------
A0A2U4BHU7_BCL2-01      ggtccc---agcatgcggcctct-----------gt--------------
A0A2U3V2H3_MCL1-01      cgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgag
A0A2U4CFE3_BCL2L2-      ----------------ggcctca-----------gtgaggacag------
                                         **  *            *               

A0A2U3V0P1_BCL2L1-      --------------------------------------------------
A0A2U4BHU7_BCL2-01      ------------------------------------ttgatttctcct--
A0A2U3V2H3_MCL1-01      actggctagtcaaacaaagaggctgggatgggtttgtggacttcttccat
A0A2U4CFE3_BCL2L2-      ----------------------------------tgctgac---------

A0A2U3V0P1_BCL2L1-      ---gagcgcttcaa-------------------ccgctggttcctgacgg
A0A2U4BHU7_BCL2-01      ---ggctgtct----------------------ctgaagg-cactgctca
A0A2U3V2H3_MCL1-01      gtagaggacctagaaggcggcatcagaaatgtgctgctgg-cttttgcag
A0A2U4CFE3_BCL2L2-      ---gggggcc------gtggca-----------ctggggg-ccctggtaa
                           *                             * *  **    *     

A0A2U3V0P1_BCL2L1-      gcatgactgtggctggcgtgcttct---gctgggctcgctcttcagtcgg
A0A2U4BHU7_BCL2-01      gtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccat
A0A2U3V2H3_MCL1-01      gtgttgccggagtaggagctggttt---------ggcgtatctaa----t
A0A2U4CFE3_BCL2L2-      ct---------gtaggggccttttt---------tg-----ctag----c
                                   *  ** *      *                 *       

A0A2U3V0P1_BCL2L1-      aaatga-
A0A2U4BHU7_BCL2-01      aagtga-
A0A2U3V2H3_MCL1-01      aagatag
A0A2U4CFE3_BCL2L2-      aagtga-
                        **   * 

© 1998-2020Legal notice