Dataset for CDS BCL2L10 of organism Suricata suricatta

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A673UC80_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L10 (length=579 residues).
atggctgacccgttgagagagcgtactgcgcgattattaacggacttcctggagtactgcgctcgggcccccggcagccc
cgcgcgggcgccgtccacgcccgaggctgaagtgctgcgctacgtggccacccaagtacaacagagccaccagcaattct
tgtcgaatttccgcggctaccgccagaaccgcgttgcgctagtggggcggttggagcggtatttactccccgacccccaa
aacgtcagctggggctatatagcagcgctgttgatcttcgcggggacgctgctggagaggccgccaccagggaacgactt
gaccctgaagccggaccaggaacaggacctggagtgggagaccaacgttgaccaggactgccagcgcctggtggctttgc
tctgcgatcggcttatggaacggcatcgcgcctggctggaggcgcacaatggctgggatggcttttgtctcttcttctca
cccctgctgccatattcttggaaaacattgctggtccaggctcttctgtcatgcgttacagtaatgatcttaatctacct
cttgagaagattatcatga
© 1998-2020Legal notice