Dataset for CDS BAX-like of Organism Lates calcarifer

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A4W6CPK8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lates calcarifer GN=BAX (length=579 residues).
atggcatctcacccgggaggaggcgaccaaggaaataccaaagatcagatactggaagtcggagccgttttgttaaagga
tttcatctatcagcgggttcagcgccatggagacagcaatactgtagtgaccagggcacagctgggtggaggagagctgc
gtgatccaaaccacaagaagctcgctcagtgtctacagcagattggagatgagctggatggcaatgttgagctccagagg
atgataaatgactcttcactcagtcccacaaaagacatgttcctgagagttgccgttgagatcttttcagatggaaaatt
caattggggcagggtggttgcactgttctactttgcctgcagacttgtcatcaaagctcttctgacccaagttcctgata
ttatcagaaccatcatcagctggaccatggactacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggcattcgttcctacttcggcacccctacctggcagacggtgggggttttcttggctggtgttctcaccactgttct
agtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A4W6CPK8_BAX-02 BCL2-associated X gene OS=[Eukaryota] Lates calcarifer GN=BAX (length=579 residues).
atggcatctcacccgggaggaggcgaccaaggtactgttaaattatatatattactgtgtctttgtaatcccctatgtag
tttcatctatcagcgggttcagcgccatggagacagcaatactgtagtgaccagggcacagctgggtggaggagagctgc
gtgatccaaaccacaagaagctcgctcagtgtctacagcagattggagatgagctggatggcaatgttgagctccagagg
atgataaatgactcttcactcagtcccacaaaagacatgttcctgagagttgccgttgagatcttttcagatggaaaatt
caattggggcagggtggttgcactgttctactttgcctgcagacttgtcatcaaagctcttctgacccaagttcctgata
ttatcagaaccatcatcagctggaccatggactacctccgggaacatgtgatcaactggatcagggagcaaggtggctgg
gagggcattcgttcctacttcggcacccctacctggcagacggtgggggttttcttggctggtgttctcaccactgttct
agtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A4W6CZY5_BAX-01 BCL2-associated X gene OS=[Eukaryota] Lates calcarifer GN=BAX (length=618 residues).
atggctgacaaccgagaagaggagacaaaagaaggagaccaggagcctcagggcgccgtgggtggggaagatgtattcga
tgatcccatcctggagcaaggagcagtggtcctcagagggtatgtaattgagcgtataagcacagaggaccctggtcgac
aagtctgctctgaggatctgggaggaagaccaaacgaacaacaggatccacaagtcaaagaagtagtggaacagctgctc
aagattgcagatgagatgaacaggaatgctgagctccaacagctgatcaaccaggttcaggggaactgtgcacaggacat
tttcatgaaggtggccaggagtatctttgctgatggcattaactggggtcgagtggtggctctctttcatctggcctaca
gactcatacacaaggcactgacgaccaatcatttagagaacatcagaatggtcatcagctgggttctccaggtcatcagg
gagcagctctactcctggcttgtacagcagggaggctgggagggggtgatctgtggcttttctcggtggaggacagtagc
cgtagtagcatcagtagtattggtagcaaccattgtttactacaggaagacacgctga
>gnl|bcl2dbcds|A0A4W6DD17_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Lates calcarifer GN=BOK (length=651 residues).
atggagatgttgcgccgctcctctgtgtttgcggccgaagtgtttgaccgatcgcccaccgacaaggagctggtgtccca
ggccaaggcactatgcagggactacatccattccaggctgaaccgtgccggcataggctggtctaaccctgaacacggac
tgtcagcatcaggtggagcactgggagagatatcctcggttctgctgtggctgggcgatgagttggagtaccttcgaccc
aacgtttaccgcaatgtagcacgacaactaaacatcacagtggcatcagagagcgtggtgtctgatgccttcctggctgt
agctgcagacattttctccacaggtaggtacaggcatgcaggtgtaacatggggaaaggtggtgtctttgtacgctgtgg
caggggccttggcagtggactgtgtacgccatggtcatccagccatggttcataccatcgtcgactgcatgggggagttt
gtccgcaagagtctgacgtcctggttaaaaaggagagggggctgggtggatgtcacaaaatgtgtggtgaacactgatcc
cagcttccgctctcactggctggtgactgctgcctgtgcctttggacactatctgaaggccatggtgttatacctcctca
gggagaagtga
>gnl|bcl2dbcds|A0A4W6DD17_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Lates calcarifer GN=BOK (length=633 residues).
atggagatgttgcgccgctcctctgtgtttgcggccgaagtgtttgaccgatcgcccaccgacaaggagctggtgtccca
ggccaaggcactatgcagggactacatccattccaggctgaaccgtgccggcataggctggtctaaccctgaacacggac
tgtcagcatcaggtggagcactgggagagatatcctcggttctgctgtggctgggcgatgagttggagtaccttcgaccc
aacgtttaccgcaatgtagcacgacaactaaacatcacagtggcatcagagagcgtggtgtctgatgccttcctggctgt
agctgcagacattttctccacaggtgtaacatggggaaaggtggtgtctttgtacgctgtggcaggggccttggcagtgg
actgtgtacgccatggtcatccagccatggttcataccatcgtcgactgcatgggggagtttgtccgcaagagtctgacg
tcctggttaaaaaggagagggggctgggtggatgtcacaaaatgtgtggtgaacactgatcccagcttccgctctcactg
gctggtgactgctgcctgtgcctttggacactatctgaaggccatggtgttatacctcctcagggagaagtga
>gnl|bcl2dbcds|A0A4W6DRR9_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Lates calcarifer GN=BOK (length=642 residues).
atggaggtcctacggaggtcttctgtgtttgcagcagaggtcctggatgtgtttgaccggtcgttgaccgagaaggagct
ggtgtcccagtccaaagccttgtgcagagactacattctgtccagactcaaccagaacgggctgggatggtccaaaactg
agctcaacctctctccctcgaacgcagcacttgctgaggtgtcctcggtgcttctctgtctcggcgacgagctggagtgt
atacagcccagtttgttcaggaacgtggcgcggcagctcaacgtctctgttgccatggagaacatggtttcggatgcctt
catcggcgtggcaacagagatcttttcaacaggtataacatggggcaaggtggtagccatgtatgcggtagctggagccc
tggcagtggactgtgtccgacaaggacatccaacaactgttcacattgtggtggacagtctgggacagtttgtccgcaag
ttcctggttccctggctgaagagacggggaggatgggcggagatcacgaaatgtgtgataaagaaggatctgacccctga
acatcactggctgtcctctgtcgtcgagtccctgaagtacttcctcaccacgatgtatgtctacatcatgaaggagccgt
ga
© 1998-2023Legal notice