Dataset for CDS BCL2L1 of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8XYL5_BCL2L1-      atgacttacaacaacaaagaactggtggcatactatattacctataaact
A0A3P8XFS0_BCL2L1-      atgtcttacagtaatagggaactggtggtgttttttataaactataaact
A0A3P8XFS0_BCL2L1-      atgtcttacagtaatagggaactggtggtgttttttataaactataaact
                        *** ******  ** *  **********  *  * *** * *********

A0A3P8XYL5_BCL2L1-      atcccagagaaactaccccatcaatcacactgggctcacaggagcatttg
A0A3P8XFS0_BCL2L1-      gtcccagaggaattattcctgttgtgaattggagctggagggtgcaagtg
A0A3P8XFS0_BCL2L1-      gtcccagaggaattattcctgttgtgaattggagctggagggtgcaagtg
                         ******** ** **  **     * *    * ***    ** ***  **

A0A3P8XYL5_BCL2L1-      atcggactgaggggggagaggtggaagaggtggcagcagtcaccatgcac
A0A3P8XFS0_BCL2L1-      gacggactgaggg---------agaagaggctactgca------------
A0A3P8XFS0_BCL2L1-      gacggactgaggg---------agaagaggctactgca------------
                          ***********          *******   * ***            

A0A3P8XYL5_BCL2L1-      cccaatggcacaatgaatgggacgagtcctgggactcca-acacaac---
A0A3P8XFS0_BCL2L1-      ---aatgggtctgtgg--ggaacgg---caggaacagcagacgcaatttg
A0A3P8XFS0_BCL2L1-      ---aatgggtctgtgg--ggaacgg---caggaacagcagacgcaatttg
                           *****  *  **   ** ***    * ** **  ** ** ***    

A0A3P8XYL5_BCL2L1-      ----agtcccccccctcatctcctcggcggactgttggcctggatgcagt
A0A3P8XFS0_BCL2L1-      ggaaag------ccctcaactccacagggg------tgcatggaggcagt
A0A3P8XFS0_BCL2L1-      ggaaag------ccctcaactccacagggg------tgcatggaggcagt
                            **      ****** **** * * **       ** **** *****

A0A3P8XYL5_BCL2L1-      gaaagaggcactgcgggactctgccaacgagtttgagctgcgttacgccc
A0A3P8XFS0_BCL2L1-      gaaagcagcactacgggactctgcagatgagtttgagctgcgctacaccc
A0A3P8XFS0_BCL2L1-      gaaagcagcactacgggactctgcagatgagtttgagctgcgctacaccc
                        *****  ***** ***********  * ************** *** ***

A0A3P8XYL5_BCL2L1-      tagcattcagtgacctgtcatcccagctgcacctcacaccggctacagcc
A0A3P8XFS0_BCL2L1-      gtgccttcagtgatctctcctcccagctccacatcacccccgccacagcc
A0A3P8XFS0_BCL2L1-      gtgccttcagtgatctctcctcccagctccacatcacccccgccacagcc
                          ** ******** ** ** ******** *** **** ** ** ******

A0A3P8XYL5_BCL2L1-      taccagagctttgcaagtgtgatggatgaggtgttccgggatggggtgaa
A0A3P8XFS0_BCL2L1-      taccacagttttgaaagtgtgatggacgaggtgttcagggatggggttaa
A0A3P8XFS0_BCL2L1-      taccacagttttgaaagtgtgatggacgaggtgttcagggatggggttaa
                        ***** ** **** ************ ********* ********** **

A0A3P8XYL5_BCL2L1-      ctggggaagggttgtgggcctgtttgcgttcggaggggccctctgtgtag
A0A3P8XFS0_BCL2L1-      ctggggtcgtgtggtgggcctgtttgctttcggcggggccctatgtgttg
A0A3P8XFS0_BCL2L1-      ctggggtcgtgtggtgggcctgtttgctttcggcggggccctatgtgttg
                        ******  * ** ************** ***** ******** ***** *

A0A3P8XYL5_BCL2L1-      agtgcgtggagaaggagatgagcccccttgtgggacggattgctgactgg
A0A3P8XFS0_BCL2L1-      agtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactgg
A0A3P8XFS0_BCL2L1-      agtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactgg
                        **** ** ******** ******* *** **** *** ***** ******

A0A3P8XYL5_BCL2L1-      atgaccgtctacctggataaccacatccagccctggatcgagagccaagg
A0A3P8XFS0_BCL2L1-      atgaccacctacctggacgaacacatccagccctggatccaaattcaagg
A0A3P8XFS0_BCL2L1-      atgaccacctacctggacgaacacatccagccctggatccaaattcaagg
                        ******  *********  * ****************** * *  *****

A0A3P8XYL5_BCL2L1-      aggatgggaccgttttgcagagatctttgggaaggatgctgcagccaaca
A0A3P8XFS0_BCL2L1-      aggatgggatcgttttgctgacatttttggcagagatgcagctgcagaca
A0A3P8XFS0_BCL2L1-      aggatgggatcgttttgctgacatttttggcagagatgcagctgcagaca
                        ********* ******** ** ** ***** *  ***** ** **  ***

A0A3P8XYL5_BCL2L1-      gcaggaagtctcaggagagctttaagaagtggctgctggcaggaatgacg
A0A3P8XFS0_BCL2L1-      tccgacgttcccaagaaagcttgaggaaatggctgctatttgggatg---
A0A3P8XFS0_BCL2L1-      tccgacgttcccaagaaagcttgaggaaatggctgctatttggggtgatg
                         * *    ** ** ** ***** * *** ********    **  **   

A0A3P8XYL5_BCL2L1-      ctggttacaggagttgtcgttgggtctcttattgctcagaaacgcctg--
A0A3P8XFS0_BCL2L1-      -----------------------------------gaaaatgcgcaatgg
A0A3P8XFS0_BCL2L1-      ctgctttcaggagtgctggttggcactctcctcatgaagaaacgccag--
                                                             * *  ***     

A0A3P8XYL5_BCL2L1-      ---tga
A0A3P8XFS0_BCL2L1-      acctga
A0A3P8XFS0_BCL2L1-      ---taa
                           * *

© 1998-2020Legal notice