Dataset for CDS BCL2L1 of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8XYL5_BCL2L1-      attatgacttacaacaacaaagaactggtggcatactatattacctataa
A0A3P8XFS0_BCL2L1-      ---atgtcttacagtaatagggaactggtggtgttttttataaactataa
A0A3P8XFS0_BCL2L1-      ---atgtcttacagtaatagggaactggtggtgttttttataaactataa
                           *** ******  ** *  **********  *  * *** * ******

A0A3P8XYL5_BCL2L1-      actatcccagagaaactaccccatcaatcacactgggctcacaggagcat
A0A3P8XFS0_BCL2L1-      actgtcccagaggaattattcctgttgtgaattggagctggagggtgcaa
A0A3P8XFS0_BCL2L1-      actgtcccagaggaattattcctgttgtgaattggagctggagggtgcaa
                        *** ******** ** **  **     * *    * ***    ** *** 

A0A3P8XYL5_BCL2L1-      ttgatcggactgaggggggagaggtggaagaggtggcagcagtcaccatg
A0A3P8XFS0_BCL2L1-      gtggacggactgaggg---------agaagaggctactgca---------
A0A3P8XFS0_BCL2L1-      gtggacggactgaggg---------agaagaggctactgca---------
                         **  ***********          *******   * ***         

A0A3P8XYL5_BCL2L1-      caccccaatggcacaatgaatgggacgagtcctgggactcca-acacaac
A0A3P8XFS0_BCL2L1-      ------aatgggtctgtgg--ggaacgg---caggaacagcagacgcaat
A0A3P8XFS0_BCL2L1-      ------aatgggtctgtgg--ggaacgg---caggaacagcagacgcaat
                              *****  *  **   ** ***    * ** **  ** ** *** 

A0A3P8XYL5_BCL2L1-      -------agtcccccccctcatctcctcggcggactgttggcctggatgc
A0A3P8XFS0_BCL2L1-      ttgggaaag------ccctcaactccacagggg------tgcatggaggc
A0A3P8XFS0_BCL2L1-      ttgggaaag------ccctcaactccacagggg------tgcatggaggc
                               **      ****** **** * * **       ** **** **

A0A3P8XYL5_BCL2L1-      agtgaaagaggcactgcgggactctgccaacgagtttgagctgcgttacg
A0A3P8XFS0_BCL2L1-      agtgaaagcagcactacgggactctgcagatgagtttgagctgcgctaca
A0A3P8XFS0_BCL2L1-      agtgaaagcagcactacgggactctgcagatgagtttgagctgcgctaca
                        ********  ***** ***********  * ************** *** 

A0A3P8XYL5_BCL2L1-      ccctagcattcagtgacctgtcatcccagctgcacctcacaccggctaca
A0A3P8XFS0_BCL2L1-      cccgtgccttcagtgatctctcctcccagctccacatcacccccgccaca
A0A3P8XFS0_BCL2L1-      cccgtgccttcagtgatctctcctcccagctccacatcacccccgccaca
                        ***  ** ******** ** ** ******** *** **** ** ** ***

A0A3P8XYL5_BCL2L1-      gcctaccagagctttgcaagtgtgatggatgaggtgttccgggatggggt
A0A3P8XFS0_BCL2L1-      gcctaccacagttttgaaagtgtgatggacgaggtgttcagggatggggt
A0A3P8XFS0_BCL2L1-      gcctaccacagttttgaaagtgtgatggacgaggtgttcagggatggggt
                        ******** ** **** ************ ********* **********

A0A3P8XYL5_BCL2L1-      gaactggggaagggttgtgggcctgtttgcgttcggaggggccctctgtg
A0A3P8XFS0_BCL2L1-      taactggggtcgtgtggtgggcctgtttgctttcggcggggccctatgtg
A0A3P8XFS0_BCL2L1-      taactggggtcgtgtggtgggcctgtttgctttcggcggggccctatgtg
                         ********  * ** ************** ***** ******** ****

A0A3P8XYL5_BCL2L1-      tagagtgcgtggagaaggagatgagcccccttgtgggacggattgctgac
A0A3P8XFS0_BCL2L1-      ttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagac
A0A3P8XFS0_BCL2L1-      ttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagac
                        * ***** ** ******** ******* *** **** *** ***** ***

A0A3P8XYL5_BCL2L1-      tggatgaccgtctacctggataaccacatccagccctggatcgagagcca
A0A3P8XFS0_BCL2L1-      tggatgaccacctacctggacgaacacatccagccctggatccaaattca
A0A3P8XFS0_BCL2L1-      tggatgaccacctacctggacgaacacatccagccctggatccaaattca
                        *********  *********  * ****************** * *  **

A0A3P8XYL5_BCL2L1-      aggaggatgggaccgttttgcagagatctttgggaaggatgctgcagcca
A0A3P8XFS0_BCL2L1-      aggaggatgggatcgttttgctgacatttttggcagagatgcagctgcag
A0A3P8XFS0_BCL2L1-      aggaggatgggatcgttttgctgacatttttggcagagatgcagctgcag
                        ************ ******** ** ** ***** *  ***** ** **  

A0A3P8XYL5_BCL2L1-      acagcaggaagtctcaggagagctttaagaagtggctgctggcaggaatg
A0A3P8XFS0_BCL2L1-      acatccgacgttcccaagaaagcttgaggaaatggctgctatttggggtg
A0A3P8XFS0_BCL2L1-      acatccgacgttcccaagaaagcttgaggaaatggctgctatttgggatg
                        *** * *    ** ** ** ***** * *** ********    **  **

A0A3P8XYL5_BCL2L1-      acgctggttacaggagttgtcgttgggtctcttattgctcagaaacgcct
A0A3P8XFS0_BCL2L1-      atgctgctttcaggagtgctggttggcactctcctcatgaagaaacgcca
A0A3P8XFS0_BCL2L1-      --------------------------------------gaaaatgcgcaa
                                                                * *  ***  

A0A3P8XYL5_BCL2L1-      g-----tga
A0A3P8XFS0_BCL2L1-      g-----taa
A0A3P8XFS0_BCL2L1-      tggacctga
                              * *

© 1998-2022Legal notice