Dataset for CDS MCL-1 of organism all

[Download (right click)] [Alignment] [Repertoires]

438 sequence(s)

>gnl|bcl2dbcds|A0A3Q1EQB9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=MCL-1 (length=840 residues).
atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctttccgcaaaatggagtcgtggagggaccgat
gcactatggatccggagattcctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaatcttggctcca
gtgataccccaaaacggccgaagaacctgggagtgaacgggtatgcgccaaaaagccttcgacaagacagcgacagtatg
gaggacggctctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctccagttgtccaacaggggacga
gttgctggagaatgacacgaggcaactcattcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggacaaacacagatactcatacaatggtatgatc
aacaaactgtcgctggatgacataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggac
aaccaactggggtcgtattacgagcctggtggccttcggggcggtggtttgtcagtacttaaaggagaggggcagggaga
actgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaacaactca
tgggacggttttgtggagttttttcgagtagcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
tgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3Q1EQB9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=MCL-1 (length=1152 residues).
atgaatatgattcctacgaagaggacgacgctgatgaactgcttaatctttccgcaaaatggagtcgtggagggaccgat
gcactatggatccggagattcctccccgcagatttccgtggcctcctctatagatcctcaaaacgggaatcttggctcca
gtgataccccaaaacggccgaagaacctgggagtgaacgggtatgcgccaaaaagccttcgacaagacagcgacagtatg
gaggacggctctttaccgtgcaccccagagctccagtcggacagtgaaaccgacgtctccagttgtccaacaggggacga
gttgctggagaatgacacgaggcaactcattcgccgtttcttaagagactttactggactttcaaagccccggtggaatg
aaagcaaagcattatcaacaatgaaaagagtggtggatgacgttttggacaaacacagatactcatacaatggtatgatc
aacaaactgtcgctggatgacataggggatgatgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacaggac
aaccaactggggtcgtattacgagcctggtggccttcggggcggtggtttgtcagtacttaaaggagaggggcagggaga
actgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaacaactca
tgggacggttttgtggagttttttcgagtagcagaccctgagttgacggtcagaaacacactcatggcctttgctggatt
tgctggtattggggcaacactggccctgctgatcagactggaaagtaaatttggggaaacccagaggaccgggagaggag
ccggaggcaaacgatggatccaggggggccggaggaaaccacaggagaggaaccggaggagacacgatgcctgcagggac
cgaggcagggggcaagggaaccgacagaactggagggttccaaggagggggaaccaggagggacacggagccggcagggg
tccaagacggaagcaaggagacagactgggcaggagtggtccggacagcgggatcctccaggagaggagaacagagaaaa
agacgttagtctcagaaatacttgtcacgtaa
>gnl|bcl2dbcds|A0A8B9M984_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Accipiter nisus GN=MCL-1 (length=1431 residues).
atgttcgccgtgaagcggaacgccgtcatcggcttcaacctctactgcggcggcggcccggccctggcgcccgcctcgcc
gggaggggggccggccccgccgccgccgcccgccgccgccgctgaggtacccgggaccctgattggctccgtggcggcct
gggccgccgccggtcgccccgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcg
gcgcggccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcggggga
ctcgctgcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct
acctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagctttttccggggctgctgggcgggcccggccggccc
gggggatcgggcgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacga
gctggccttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgccc
acgtgttcagtgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtgcctttgttgcgaaacacctg
aaaagcataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcacttgtctcatctaagcgcgagtg
gctaatgagccagggaggctgggagggctttgttgacttctttcgagtcgaggacctagaaggcagcatcagaaatgtac
tgatggcgtttgcaggtgtggctggactaggagcgagcttggcctacatgatccggaatgtcaccaactgctggatccct
agcctgggatggcagggaacagagttctgctcctcctgggatggctcatgtccaaggccagcattgcttctttctatgcc
agggacactgcaggagacctggcaggcacatcccaggagtgctcattccttcttcctttcctcctctcagctcaagccct
tgtccttgctggtgagtctctgcttgcagagttatggtgacagtccttggggtcctgaacagttcttgctgaacaaggca
acaggccttggtgtcccctcaagcagcagcaagtcatgttgcgactctgctgtccttccatgtgctgcctggctcaaaag
gtgtccggcagcactgggcaccaggtgcaagccctgccacccctctgaaagattagacagtctccccaaatcccaccagt
gccctagaaaccccagtgagcactggggttctgccctcttccccccttccagagtccatgctcagggttgg
>gnl|bcl2dbcds|A0A8B9M984_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Accipiter nisus GN=MCL-1 (length=990 residues).
atgttcgccgtgaagcggaacgccgtcatcggcttcaacctctactgcggcggcggcccggccctggcgcccgcctcgcc
gggaggggggccggccccgccgccgccgcccgccgccgccgctgaggtacccgggaccctgattggctccgtggcggcct
gggccgccgccggtcgccccgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcg
gcgcggccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcggggga
ctcgctgcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgct
acctgcgggaggcggcgggcgaggccgagcccgccgtgaagaagctttttccggggctgctgggcgggcccggccggccc
gggggatcgggcgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacga
gctggccttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgccc
acgtgttcagtgatggagtaacaaactggggtcgagtggtgacactcatctcgttcggtgcctttgttgcgaaacacctg
aaaagcataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcacttgtctcatctaagcgcgagtg
gctaatgagccagggaggctgggagggctttgttgacttctttcgagtcgaggacctagaaggcagcatcagaaatgtac
tgatggcgtttgcaggtgtggctggactaggagcgagcttggcctacatgatccgattgcaggtaccaatgaggatttat
tgctttgggaagagaaagtggaagaattga
>gnl|bcl2dbcds|G1L3L7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgctagtcccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctt
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G1L3L7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagcc
ggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8B9GMI8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amazona collaria GN=MCL-1 (length=801 residues).
atgttcgcgctcaagcggaaagcggtcatcggcctcaacctctactgcgggggcagcccggccccgccgccgccctcccc
ggcggcctgggccgcggggtgctccgaggcgctgctgggctgcggcccggtcccgctgcggagccccgaggaggagctgg
acggctgcgagccggagcccgagcgcggccccgcggcggccccgctgcccggcggcgcccccgacgccctgcgccaggcc
tcgctggagctcatcggccgctacctgcgggaggcggcgggcgaggcccagcccgcgcccaagaagctgttcccggggct
gctgtgcgggcccgggcggccccgaggggcggcggattcggggctggagaaggcgctggagacgctgcggaggctcgggg
acagcgtcctgcggaagcacgagctcgcgttccagggaatgctccggaagctggaaatccagaaggaggaggacctgcag
gcggtgcacgaggtggctgcgcgcttgttcagcgacggggtgaccaactggggccgggtggtgacgctcatctccttcgg
ggccttcgtcgccaagcacctgaagagcatccggcaggagcagtgcatcggctccctggcagggatcatcacggacgcgc
tcctctcctccagtcgcgagtggctgctgagccagggaggttgggagggctttgtggacttctttcacgtggaagacctg
gaaggcagcatcaggaatgtgctgatggcgtttgcaggcgtggctggactgggagcgagcttggcgtacatgatccggtg
a
>gnl|bcl2dbcds|A0A3Q0R633_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=684 residues).
tctcttccttttacatccccagactccaatggtaccccaaaacggccgaacaacctgggggtggtatcaacaaacggata
tgcaccaaaaaatatcacggacgacgtggaagacggttcgttgccgagcaccccggagtttcattcggatagtgaatccg
acgaggcgctggagagggaaacgaaaagcctcattactagtttctttagagactttactggactttctcaacgacgatgg
aaagaaagcgaagcactaaaaacaatgaaaagagttgtggcggacgtattagaaaagcaccgatacgcatacaacggaat
ggtcaacaaattgtcattggatgaaagaggggaggacgtgacatttgtgagcgcggtagccaagagcctgtttgcagaca
aaaccaccaactggggtcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagg
gacaattgtgtggagctggtgagccaggagatttccacatacctgctgtctgaccaacgagactggctggttaaaaacaa
tgcatgggatggatttgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacacactcatggcctttgctg
gatttgctggtattggggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q0R633_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=429 residues).
atgcctgagagaaatggtagtgctatatcaactcagttgggattacatcctaggatttctggaatggtcaacaaattgtc
attggatgaaagaggggaggacgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactggg
gtcgtattgccagtctgatggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagggacaattgtgtggag
ctggtgagccaggagatttccacatacctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggatt
tgtggagttttttcgtgtagcagaccccgagtcaacagtgaggaacacactcatggcctttgctggatttgctggtattg
gggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3Q0R633_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=MCL-1 (length=810 residues).
atgaacacgtgtactatgaggaattgtcgaatgggctcgtataaaaatgtcatggacctttttcttcctcaaaatggagt
cgtggacggaacaatgcactatggatcggggaattcctctccgcaagatgccacaggtacacctaaagactccaatggta
ccccaaaacggccgaacaacctgggggtggtatcaacaaacggatatgcaccaaaaaatatcacggacgacgtggaagac
ggttcgttgccgagcaccccggagtttcattcggatagtgaatccgacgaggcgctggagagggaaacgaaaagcctcat
tactagtttctttagagactttactggactttctcaacgacgatggaaagaaagcgaagcactaaaaacaatgaaaagag
ttgtggcggacgtattagaaaagcaccgatacgcatacaacggaatggtcaacaaattgtcattggatgaaagaggggag
gacgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaaaaccaccaactggggtcgtattgccagtctgat
ggcctttggggcagtggtgtgtcagcgcttgaaggaaaaaggcagggacaattgtgtggagctggtgagccaggagattt
ccacatacctgctgtctgaccaacgagactggctggttaaaaacaatgcatgggatggatttgtggagttttttcgtgta
gcagaccccgagtcaacagtgaggaacacactcatggcctttgctggatttgctggtattggggcaacactggccctgtt
gatcaggtga
>gnl|bcl2dbcds|A0A3Q1BKL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccaatgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtcaaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3Q1BKL8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=MCL-1 (length=915 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccaatgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtcaaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagctaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcagtggtcttgctgctgtaggactaacacagagcactgaaa
actcttgcaaggatgcacacataagttgttgcaga
>gnl|bcl2dbcds|A0A3P8RQX7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion percula GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccagtgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtccaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3P8RQX7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Amphiprion percula GN=MCL-1 (length=846 residues).
atgaatatgattccgacgacgacgaagaggacggcgttcatgaactacttaatttttcctcaaaatggagtcgtggaggg
accgatgcactatggatccggagattcctccccgcagattgccgtggcctcctccatagactctcacaacgggaatgttg
gctccagtgaaaccccaaaacggccgaagaacctgggagtgaatgggtatgcgtccaaaaaccttcgacaagacagcgac
agtatggaggagggctctttaccgtgcaccccggagctgcagtcggacagtgaaaccgacgtctccagttgtccagcagg
agacgagttgctggagaatgacacgaggcaactccttcgccgtttcttaagagactttactggactttcaaagccccggt
ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgttttggacaaacacagatacgcatacaatggt
atgatcaacaaactgtcgctggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcctctttgcaga
caggacgaccaactggggtcgtattacgagcctggtggcctttggggcggtggtatgtcagtacctgaaggagaggggca
gggagaactgcgtggacctggtcagccaggagatttccacatacctgctttctgaacagcgagactggctggtcaaaaac
aactcatgggatggttttgtggagttttttcgagtagcagaccctgagttgacggtcaggaacacactcatggcctttgc
tggatttgctggtattggggcaacactggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=852 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagctcctgtagtgtgatgtga
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=867 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagtgctgtccgacttcagcctcttcacctgcattaa
>gnl|bcl2dbcds|A0A493U0E8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=MCL-1 (length=978 residues).
ggagggtgggggacggagtcctggagaaacacgagctggccttccaagggaccggcgagatctgaccatttggggtcagt
tttgtggaaatcggaggcgagctctcagggaccagcaagaattgaccattttgggtcagttccatggaattcagaggcga
gtccccggggagtggtgggaactgcccattttgggtcagttttgtggaactcggaagcgagcccctggggatggggcgga
accgaccattttggggctgttttcccagaacccagcagcgggattttttccagaccagcacgtaccaaccctttgggatc
agctccacggggacgggggggagatttgaccattttgggctggtttcacccaactcagaagcgagctcccgagccagctg
ggcggcgagacgccgcccctcccgcagcaggatgttgcacttttaaaaaatgcaaaaggtttcgagccggcccccacccc
ttccctcatcaccctgctgggcgagatttttggggtttcaccacccccggccaaatttttggggtgctggcaaggaaacc
acactcgggggagcaggggggggtcaccgttgaggatttgggacgttcccttggaatgcttcggaagctggaaatcaaga
aggaggaggacctgcaggccgtgggtgaggtggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtc
accctcatctccttcggcgccttcgtcgcccggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccag
gatcatcaccgacgccctcgtctcgtccaaacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgactttt
tccgagtggaagacctggaaggcagcatcaggaacgtgctgatggcgttcgcaggagtggctggactgggagcgagcttg
gcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B9SWV2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos GN=MCL-1 (length=549 residues).
atgttcgccctgccgcgcaacgccctcatcggcttcaacctctactgcggcggcggcaccgggcccggagggggcggcgg
aggcggagggggcccggcctcaccgggggggaccccgaaagcgctggaaacgttgaggagggtgggggacggagtcctgg
agaaacacgagctggccttccaaggaatgcttcggaagctggaaatcaagaaggaggaggacctgcaggccgtgggtgag
gtggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcgtcgc
ccggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccaggatcatcaccgacgccctcgtctcgtcca
aacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgactttttccgagtggaagacctggaaggcagcatc
aggaacgtgctgatggcgttcgcaggagtggctggactgggagcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B9VGG9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas zonorhyncha GN=MCL-1 (length=822 residues).
ggagggtgggggacggagtcctggagaaacacgagctggccttccaagggaccggcgagatctgaccatttggggtcagt
tttgtggaaatcggaggcgagctctcagggaccagcaagaattgaccattttgggtcagttccatggaattcagaggcga
gtccccggggagtggtgggaactgcccattttgggtcagttttgtggaactcggaagcgagcccctggggatggggcgga
accgaccattttggggctgttttcccagaacccagcagcgggatttctttcagaccagcacgtaccaaccctttgggatc
agctccgtggggacgggggggagatttgaccattttgggctggtttcacccaactcagaagcgagctcctgagccagctg
gcggcgagacgccgcccctcccgcagcaggatgttgcacttttaaaaaatgcaaaaggaatgcttcggaagctggaaatc
aagaaggaggaggacctgcaggccgtgggtgaggtggctgcccacctcttcagcgacggggtgaccaactgggggcgcgt
cgtcaccctcatctccttcggcgccttcgtcgcccggcacctgaaaagcgtcaagcaggagaaaagcatcggctccctgg
ccaggatcatcaccgacgccctcgtctcgtccaaacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgac
tttttccgagtggaagacctggaaggcagcatcaggaacgtgctgatggcgttcgcaggagtggcgggactgggagcgag
cttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A803T0A4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=1068 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactctgcggatccac
ctcgaagcagtcactctcgttttcctcaattttcaagtccaggctgttttcgtccgccatggcttccttggatctgagag
aggaaagcagcagcacaactgtgtctga
>gnl|bcl2dbcds|A0A803T0A4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=1068 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctggcaacgtgctcggctcggcagcgccactctgcggatccac
ctcgaagcagtcactctcgttttcctcaattttcaagtccaggctgttttcgtccgccatggcttccttggatctgagag
aggaaagcagcagcacacctgtccgtga
>gnl|bcl2dbcds|A0A803T0A4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anolis carolinensis GN=MCL-1 (length=1038 residues).
atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcatggccccgaacacgccggcctcacctggagc
cggcggaggcgtcggagaaagtagcggcgggaataataacgacggcggcggcgtctcggttccgaaggcctcaggtcttt
tctcagagaggccgcgccctctgattggcggggggcctcgcgccggacccctgagggcgctgattggcccctgggagggg
tctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaaccaaaatggcgcccggcctccctgccgctgcc
tgaaggggagctcgacggctgcgaggaagccgaggaggaggaggccgcgacggtgccgtcttccaccccctcgccggaca
aagagatggcggaggaggaaggagagaaagggaaaggagggccccctctcttcccggaccacctgcggaagacgacgctg
gaagtggtaggccgctacctgcgcgaggccgccgacgaggccgggtccaaaggcaccgggcccaagttctccttccaagg
cttgctggggcgcttcgggagcagccccaacgaggcggaggtggcgcgcgcgctggagacgctgcgccgggtgggcgaga
gcctccgggagaagcacctgctggccttccaaggaatgcttagaaagttggaaataaagaaagaagaggacttggcgtct
gtggcagaagtgacaacagaggtcttcagagatggcataataaactggggccgcattgtgactctcatctcttttggtgc
ctttgttgccaaacacctgaagagcataaaccaagagaatgctatcaacactttaatagaaattatcactgatgtgctgg
tgacggacaagagagaatggctattgaaacataatgcctgggagggatttgttcagttcttccatgtagaggacatagaa
ggtggcatcaggaatgttctggtggcttttgccagtgtggctggaataggggcaggcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B9BNC2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anser brachyrhynchus GN=MCL-1 (length=996 residues).
atgaaaataaggggggggaaaaaaaaaagaggcaagataggggaaaaatgcaaagcccccgtgcggggtggggacggggg
gggcacagctccgccaccgcgacttcccccagcgcggggggaggaagcgaccgtgacgacagagggtgagaagcagcaag
agcagctccgggacgcgactgcggcgtggagcggggtcacgtacccctgtgggggtgcccaggggctttttttttggggg
gggggctccgatggggttgctttgaggcaggaggggctgaggcagctgagctgcgtgccggagggggcgggtgaaaaccc
gggggggcttcaggttggccgagcaacgtttgcccgttgttcatccccttcctttgtggggggggggtctgaagcacccc
cgtacccccccatagggtgctgggggccattagggacccgcggacccatccccttgtgccgagccgcgccagcaccacaa
catttctcagctgagcagcccggggggcttcctcctcctctgtccccaccggcgggtggtgacggggggaagagctggaa
tttatttacttatttatttttgcctggggttttgctccgtgcgcctgtctctgagccagcgtctcttgcaggaatgcttc
gcaagctagaaatcaagaaggaggaagacctgcagtcggtgggcgaggtggcggcccacgtcttcagcgacggagtgacg
aactgggggcgagtcgtcacactcatctccttcggtgcctttgtcgccaagcacctgaagagcataaagcaggagaagtg
catcggctccttggccaggatcatcacagacgcgctcgtctcgtccaagcgcgagtggctgctgagccagggaggctggg
agggcttcgtcgacttcttccgagtggaagacctagaaggcagcatcaggaacgtgctgatggcgttcgcgggggtggca
ggactgggagcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B9EU67_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anser cygnoid GN=MCL-1 (length=570 residues).
gctcttcggtcccgccgccccccgctcgccgccgttgtggagccccgaggaggagctggacggttgcgaacccgaaaccg
agaggggacccgggggggactcgatgcccgggacccccccggagctgcccgccgacgaaaagcgctggaaacgctgcgga
gggtcggggacggagtcctggagaaacacgagctggccttccaaggaatgcttcgcaagctagaaatcaagaaggaggaa
gacctgcagtcggtgggcgaggtggcagcccacgtcttcagcgacggagtgacgaactgggggcgagtcgtcacgctcat
ctccttcggtgcctttgtcgccaagcacctgaagagcataaagcaggagaagtgcatcggctccttggccaggatcatca
cggacgcgctcgtctcgtccaagcgcgagtggctgctgagccagggaggctgggagggctttgtcgacttcttccgagtg
gaagacctagaaggcagcatcaggaacgtgctgatggcgttcgcgggggtggcaggactgggagcgagcttggcctacat
gatccggtga
>gnl|bcl2dbcds|A0A2K5C7L5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=717 residues).
atgtttggcctccaaagaaacgcgctaatcggactcaacctctactgtgagtgggccggcttggggactggcagtggcgg
caccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgtggtgattggcggaagcgccggcgctagcccctcggccgccctcacgcctgacgcccgggggtcgtgcggccgctgc
tggttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgcccga
agaagagctggacaggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtggaggagc
ctggtaatgactccagtacggatgggtcactaccctcgacgccgccgacatcactggagattatctctcggtaccttcgg
gaacaggcgactggcgccaaggacacaaagccaatggacaggtccggggccgccagcaggaaggctctggagaccttacg
acgggttggggacggcgtgcagcgcaaccacgagacggccttccaagttcttccatgtagaagacctagaaggtggcatc
agaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttgtaa
>gnl|bcl2dbcds|A0A2K5CFB8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=1059 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcact
gtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFB8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=600 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcactgtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFB8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=789 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
>gnl|bcl2dbcds|A0A2K5DMS4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=492 residues).
atgtttggcttccaagtggtaatcagactcaacctctactgcggtgccatccctccaggaccgcggcttttggcgactgg
cgccaaggacacaaagccaatgggcaggtctgaggccgccaacagtaaggcgctggagaccttacgaggggttggggaag
gcgtgccccgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaaaaacgaagacaatgtcaaatct
ttctacggcgtaacaaactggggtaggattgtgactctcagttcttttggtgcctttgtggccaaacacttgaagaccat
aaaccaagaaagttgcatcgaaccattagcagaaagtatcagatattctcgctgggatgggtttgtggagttcttccgtg
tagaggacttagaaggtggcatcagaaatgggctgctggctttcgcaggtgttgctggagtaggaactgatttggcatat
ctaataagatag
>gnl|bcl2dbcds|A0A2K5EPX0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=405 residues).
aatgcctcatgttccagacctgcatgcttttcttccccaggcatgcttcgaaaactggacatcaaaaacaaagacgatgt
caaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttctt
ttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagac
gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataa
gatag
>gnl|bcl2dbcds|A0A2K5EPX0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=399 residues).
agccagagttataataacttaaagataaccacatgcatgcttcgaaaactggacatcaaaaacaaagacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttcttttggtg
cctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagacgttctc
gtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctaga
aggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8B9P3N9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Apteryx owenii GN=MCL-1 (length=1077 residues).
tccccgtggcttttcccacatgctcccacgtcctttggggcgggcgcgattttgcgccagccacgtgcggggagggagcg
aagggcggcagggcgaagtgcaggaggcctggcctccgctggggatcgccgtgtggatccctggaaagtccgcagagatg
ggaaaccgcaagggccgttggcagggggatcccaaagagaaaccccccccgctgcagctggcgtgcggctctgctcacta
gcaggatgctcggctcgaaggcagccggatttgggatgcgtcgaggttagggagcagggcacgaagcacagcaggggcag
accagaacgagacggcgccgcgaatcccccaaaacgagccaaaccgtatcccagcgggtcggcgcctcccgcttttcccc
ggaatggtatttccccacgtctacgtgatgccgctcaccaggccgctcgctccggagccgatcggctcgttccgggtgca
ccggggccgcccggcgtcgacgagctgcgccaggactcgctggagctcatcggccgctacctgcgggaggcggcgggcga
agccgagcccggcgctaagaagctcttcccggggctgctgggcggcccgggtaggcccggcggggcgggcgacggcgtca
tggagaaggcgctggagacgctgcggcgggtcggcaacggcgtcatgcagaagcacgagctcgccttccaaggaatgctg
cggaagctggaaatcaagaaggaggaagacctgcagtcagtgtgtgaggtggcagcccatgttttcagtgatggagtaac
aaactggggcagagttgtgacactcatctcatttggtgcctttgttgcaaaacacctgaaaagcataaaccaggagaagt
gcatcagctcattagcagggatcatcacagatgctcttgtctcatctaaacgagagtggctgatgagccaaggaggctgg
gagggctttgttgacttcttccgagtagaggacctagaaggaagcatccggaatgtactgatggcttttgcaggagttgc
tggactgggagcaagcttggcctacatgatacggtga
>gnl|bcl2dbcds|A0A663EQJ0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=MCL-1 (length=933 residues).
agcggaacgccgtcatcggcttcaacctctactgcggcggcggcggcccggccctggcgcccgcctcgccgggggggggg
gccggccccaccgccgcccaccgcagccgccgccgctgaggtacccgggaccctgattggctccgtgggggcctgggccg
ccgccggtcgccctgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcgg
ccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcgggggactcgct
gcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgctacctgc
gggaggcggcgggcgaggcggagcccgccgtgaagaagcttttgccggggctcctgggcgggcccggccggcctggcgga
tcgggtgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacgagctggc
cttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgcccatgtgt
tcagtgatggagtaacaaactggggtcgagtggtgacgctcatctcgtttggtgcctttgttgcaaaacacctgaaaagc
ataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcgcttgtctcatctaagcgtgagtggctaat
gagccagggaggctgggagggctttgttgacttctttcgagttgaggacctagaaggcagcatcagaaatgtactgatgg
cgtttgcaggtgtggctggactaggagcaagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A663EQJ0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=MCL-1 (length=984 residues).
agcggaacgccgtcatcggcttcaacctctactgcggcggcggcggcccggccctggcgcccgcctcgccgggggggggg
gccggccccaccgccgcccaccgcagccgccgccgctgaggtacccgggaccctgattggctccgtgggggcctgggccg
ccgccggtcgccctgagcacccccgcgcgctggttggctgcggcgcggccccccgcgcggcgctgccccccgcggcgcgg
ccgggcgcgctgtggagccccgaggaggagctggacggctgcgagccggaggccgagcgcggcccggcgggggactcgct
gcccggcacgccgcccgggccgccggagccgcccgatgggctgcggcaggactcgctggagctcatcagccgctacctgc
gggaggcggcgggcgaggcggagcccgccgtgaagaagcttttgccggggctcctgggcgggcccggccggcctggcgga
tcgggtgatgccgtgatggagaaggcgctggagacgctgcggagggtgggcgacggcgtcatgcagaaacacgagctggc
cttccagggaatgcttcggaaactggaaatccagaaagaggaagatctgcagtcggtgtgtgaagtggctgcccatgtgt
tcagtgatggagtaacaaactggggtcgagtggtgacgctcatctcgtttggtgcctttgttgcaaaacacctgaaaagc
ataaaccaggagaggtgcatcagctcgctggcagggatcatcacagatgcgcttgtctcatctaagcgtgagtggctaat
gagccagggaggctgggagggctttgttgacttctttcgagttgaggacctagaaggcagcatcagaaatgtactgatgg
cgtttgcaggtgtggctggactaggagcaagcttggcctacatgatccgattgcaggtaccgatgaggatttattgcttt
gggaacagaaagtggaagaattga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=834 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagatcttctacaatcttttga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
>gnl|bcl2dbcds|A0A3B1IEV7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=729 residues).
atgaacccaaccgcgatcagcctcctgtgtgacggaacaagcccggttctctacagaaccgagaaagaggagaagctgcc
ccggacggagcggccggaacgcggcctggaggggctgcagtccgctaaaggagtctccatgggcggcgggtctctgcccg
actccccgctggcggacgtagacttcatccaggactttagctgccgctgcccgggcgcgctggaggcggagacccgccgc
ctgatggtggagttttaccgcgggtacctgggccagaagccccgggagcagagcccggccctgcggaccatgagccgggt
ggtggcgggggtcgtcctcaaacacgggatcgcctacaacggtatggtccagaagctgaatttggaggagcaggacgaca
gtatggacattattagcagcgtagctaaggctctgtttagcgacggaaccacgaactgggggcggatcgttagcctggtg
gcgttcggcgcggtggtgtgtgatcatctgaagaagaagagtcgagatcactgcgtggagaacgtcgcccaacacatctc
cacctacctcaacacccaccaacaccagtggctcatcaacaacaacgcctgggacggattcgtggaattcttccgcgagg
acgactcagaatcacgagtccgaaacgccctgatggccttcgctggatttgccgggctgggggcggggctagcactactg
atgcgctga
>gnl|bcl2dbcds|A0A3B1K5R1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=735 residues).
atgatgagcccacaggatatgtgttcgtataacaagaagacggccgacattgttccccgggtcgctgttcgcggaggagg
gggaggagcggggctctcgctcggtctcgcggccgacattagacctaccaggcccggcgtcgacgacggctcagtgccca
gctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgctggacggagacacgcgagag
attatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggttgtacagacaatgaa
gcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggtatgttgaacaaactgggtatggaagacagag
gagatgacatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaactggggcagggtcgccagc
ctggtggcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaaga
actatcctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtggagttttttc
gtgttcctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcctcaatagca
tttttggcaagataa
>gnl|bcl2dbcds|A0A8B9JW80_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=729 residues).
atgcatatttttctaagccacaacgtgcagaacgagactcggtttaagaccgtcgacattgttccccgggtcgctgttcg
cggaggagggggaggagcggggctctcgctcggtctcgcggccgacattagacctaccaggcccggcgtcgacgacggct
cagtgcccagctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgctggacggagac
acgcgagagattatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggttgtaca
gacaatgaagcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggttggttagcttatctaagagatg
acatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaactggggcagggtcgccagcctggtg
gcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaagaactatc
ctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtggagttttttcgtgttc
ctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcctcaatagcatttttg
gcaagataa
>gnl|bcl2dbcds|A0A663M6G8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Athene cunicularia GN=MCL-1 (length=474 residues).
aggggcagggctggtgccaggctgcaaactgacttctgtgctgtggttctgatgcggtggggctttaaagcccttgtgag
aaaggggagtgtgatgtcatctcttgcaggaatgcttcggaagctggaaatccagaaagaggaagatctgcagtcagtgt
gtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcatctcatttggtgccttt
gttgcgaaacacctgaagagcataaaccaggagaaatgcatcagctcgttggcagggatcatcacggatgcactcatctc
atcgaagcgcgagtggctcatgagccaaggaggctgggagggctttgttgacttctttcgagtcgaggacctggaaggca
gcatcagaaatgtactgatggcatttgcaggtgtggctggactgggagcaagcttagcctacatgatccggtga
>gnl|bcl2dbcds|A0A8C0CVU0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=447 residues).
atgctcggcctcaagagaaacacagtaatcggactcaaactctactggggggaaccggattgggaccagacggccttcca
aggcatgcttcagaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtg
acggagttacaaactggggcaggattgtgactcttctttcttttggtgcctttgtggccaaacacttgaggagtataaac
caagaaatctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacaagactggctagtcaaacg
aagaggctgggatgggtttttggacttcttccatggagaggacctagcaaacggcctcagaaatgtgctgctggcttttg
caggtgttgctggagtaggagctggtttggcgtatctaatacgatag
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtagggggaggggaaa
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggcctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgaggccagtaacagccccggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=816 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggctgcgggaaaggaggccacggccgggcgagaggtagggggaggggaaa
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggcctccgacgccatcatgtcgcccgaggaggagctggacgggtgcgagccggagc
ctctagggaagcggccggccgtcctgcctttgctggagttggtcggcgaggccagtaacagccccggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggatgggtttgtggacttcttccatgtaga
ggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcgtatctaa
taagatagccttttaa
>gnl|bcl2dbcds|A0A8C0DF47_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Balaenoptera musculus GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggccggatagcggcag
cggcgcctccgctccaggaaggcggcttttggcaaccggcaccaaggacgcgaagccactgggcaggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
>gnl|bcl2dbcds|A0A4W2CQV1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcaggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2G6Q5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=1065 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcagtcgatactagattgtatacagaaccagctga
tgtaatggtatgcaacctggtgtag
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=951 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggtaagtttgttttaa
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8B9W7D1_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos mutus grunniens GN=MCL-1 (length=591 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccgga
aggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactg
gggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcg
aaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2CQV1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcaggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4W2G6Q5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos indicus GN=MCL-1 (length=558 residues).
atgtgtgaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccgggagcaggcaaccgg
cgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcaccgagtcggggatg
gggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaagacgatgttaaatct
ttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactcttatttcttttggtgc
ctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcg
taaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaa
ggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A5PJR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F1MQX4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=573 residues).
ggaatgttgccaatattttcagaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccg
ggagcaggcaaccggcgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
accgagtcggggatggggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaa
gacgatgttaaatctttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C0FD84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bubo bubo GN=MCL-1 (length=561 residues).
agggagaactgttttgacctggttttgtgtaacttggaaacgagctgttttggggctagcctgagactttggggtggtgg
ggctgagctcccggcctcggggctcgtgctggggctgcttttggcatgtcacaccgcgtctgatcccagatcagggtggt
acctggcacaggagggtggtgtctcatctcttgcaggaatgcttcggaagctggaaatccagaaagaggaagatctgcaa
tcagtatgtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcatctcgtttgg
tgcctttgttgcgaaacacctgaagagcataaaccaggagaagtgcatcagctcgctggcagggatcatcacggacgcgc
tcgtctcatcgaagcgcgagtggctaatgagccaaggaggctgggagggctttgtcgacttcttccgagtcgaggacctg
gaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggctggactgggagcgagcttggcctacatgatccggtg
a
>gnl|bcl2dbcds|J7H260_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bufo japonicus formosus GN=MCL-1 (length=639 residues).
atgggcggctctctgccctccccgcagtccgagctggacgaggacgaggattacatggacgtacagtcggactcccgggg
ctccacctcccctccgctcacccccacctgctccccggaccccctgcacacggaaacccgcgccctgctgcacaccttct
tcagggaatgggccggagacgcgaagcaggaggacggcgacagcccgaaggcgctgcccaccatgcgcaggctggggggc
gacatcaatgagaagcaccgaatggcctttcagggcatgttgcagaagttatctatacaacgtccagaagatatccagaa
gctctccgaggtcccctctatggtcttcagcgatggggttaccaattggggccgtatcgtcaccgtgataagctttggtg
cgtttgtggctaaacatttgaaaagcatccacatggagaactgcgttggaatcctagcggacagcttcacagactatctt
atgacccagaagaaagaatggatcgtagaacacaatggctgggatggctgtgtcgaattctttcacgtcgaggactatga
gagtggactaaaaacagtcttgatggccttcgctggtgtggctggtcttggagcaagcctggcgtacatgatccggtga
>gnl|bcl2dbcds|A0A8C0ASR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Buteo japonicus GN=MCL-1 (length=585 residues).
gggaacggactggaagtgagaactgaccaattttacctggttttgtgtagctcagaaatgagctggtttgggtctagcct
gagtcgtcggggtggcgggactgagctcctggcctcagggctcacgctgggacttgtgggggctgcatcttctcactggt
tgccttgtggggtatttggcattgtgtgcatgcctgcttctaaaccaacatctcttgcaggaatgcttcggaaactggaa
atccagaaagaggaagatctgcagtcggtgtgtgaagtggctgcccatgtgttcagtgatggagtaacaaactggggtcg
agtggtgacgctcatctcgttcggtgcctttgttgcgaaacacctgaaaagcataaaccaggagaggtgcatcagctcgc
tggcagggatcatcacagatgcacttgtctcatctaagcgcgagtggctaatgagccagggaggctgggagggctttgtt
gacttctttcgagtcgaggacctagaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggctggactaggagc
aagcttggcatacatgatccggtga
>gnl|bcl2dbcds|A0A8C3GNC2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cairina moschata domestica GN=MCL-1 (length=1269 residues).
atgttcgccctgccgcgcaacgccctcatcggcttcaacctctactgcggcggcggcaccgggcccgggggaggaggagg
aggaggaggaggaggagggggcccggcctcaacgggggggaccccggccccgccgcccccctcccctcacgccgccgccc
ccccccctccgttcccggcggctcgcggcgccccctgctcgctgctgattggctccgccgccgctccgcgctcgctgatt
ggctccgccgctccgccgttgtggagccccgaggaggagctggacggctgcgagcccgaggccgagctgggggggcccgg
aggaggagggggggggtctctcccggggacccccccggagttacccacggacgagttgaggcaggactcgttggaactga
tcctccggtacctccgggaagcggcgggggaaacggaaccgggcttgaaaaagttttttccgggccttttgggaagaccc
gggggggttgcggggggggacggcgtgatggagaaagcgctggaaacgctgcggagggtgggggacggagtcctggagaa
acacgagctggccttccaaggaatgcttcggaagctggaaatcaagaaggaggaagacctgcaggccgtgggtgaggtgg
cggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcgtggccagg
cacctgaaaagcgtgaagcaggagaaaagcatcggctccctggccaggatcatcacggacgccctcgtctcgtccaagcg
cgagtggctcgtgagccagggaggctgggagggtttcgtcgactttttccgagtggaagacctggaaggcagcatcagga
acgtgctgatggcgttcgcgggagtggcgggactgggagcgagcttggcctacatgatccggaaggcgtgcgccggtcgg
attgcgaggggaccgatgaggattatcgctttgggagcggaaagcggaagaagttcggtcaatcggctcggtttgagagc
ccaaggggactgcttcggttttacccccggagttttagcctcgcctagaccgaagcctcgtgggcttggcgtggcgggag
cgagatattcagagcttctggtgagagcagctcctctgtcagagcttcgagtgcgagcccggcgccgcctcgggaaggag
cggagccaccccgggggctggcagcaggtggcagggaggcggcggagcggggccggcgcggcgcggtga
>gnl|bcl2dbcds|F7GTF7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=1065 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcagagattgtagtgagctgagatcgagccattgtactccagcccaggggatggtacgagactt
tgtctcaaaaaaaaaaaaaagttaa
>gnl|bcl2dbcds|F7GTF7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=594 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgg
agtaggagctgggttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C0L4C8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus dingo GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C0MCZ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C0MCZ5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=813 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttttaa
>gnl|bcl2dbcds|A0A8I3P430_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8I3P430_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=594 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagcc
ggaaggcgttagagaccctccggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|Q8HYS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtaatccggactcaactctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggagggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
agcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A452GA25_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttagctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcct
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A452GA25_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Capra hircus GN=MCL-1 (length=1008 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccgggttaggacagggcagcggcgc
ttcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcgcgccggcccgagccccccggccactcttg
cgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagggccccgacgtcaccgcgacccccaccagactg
ctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagagatggaatccccgatctccgacgccatcatgtcgcccga
agaggagctggacgggtgcgagccagaccctctcgggaagcggcctgccgtccggcctttagctttgatggtcggagaag
ccagtaacaacagtccaggctcggacggctcgctgccctcgacgccgcccccatcagaggaggaggaggacgagttatat
cggcagtccctggagattatctctcagtacctcctggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtc
tggggccaccagccggaaggcgttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagacggctttcc
aaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaagtctttgtctcgagtgatggttcatgttttcagt
gacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaa
tcaagaaagctgcatcgaaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaac
aaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttt
gcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C0WJK2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Castor canadensis GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcggtaatcggactcaacctctactgtgggggtgctgggctgggggccggtagcggcgg
cgccaccacccctccgcgagggcggcttctggccgcggaggaggcctcggcccggcgagaggtagggggaggggaagccg
gtgcggtgattggcggcagcgcaggcgcgagccccccggccgccctggcgcaggacgcccgaagggtcgcgcggccggcg
cccattggcgccgagatccccgacgtcactgcgacccctgcgaggctgctgttcttcgcgcccacccgccgtgcgtcgac
gcctaaggagatggaagccccggcctccgacgccatcatgtcgcccgaagaggagctggacggctacgagccggagcctc
tcgggaagcggccggctgtcctacccttgctggagttggtcggggaggccactaagagccccagcgcggacgggtcactg
ccctcaacgccacccccagcagaggaggaggaggacgaattgtaccggcagtcgctagagattatctgccggtaccttcg
cgagcaggccaccggcgccaaggacgccaagccaatgggcgggtctggggcggccagcaggaaggcgctggagaccctgc
gacgggtcggcgacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgag
gacgatgtcaaatctttgtctcgagtgatgatccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C3W949_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=1095 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtagggggaggggaag
ccggcgcggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagatgcccggagggtcgcgcggccc
tcgcccattggcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacccgcctcgcgtc
gccgcccgaagagatggactccccggcctccgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggaggccagtagtggccccggcacggacggctca
ctcccctcgacgccgcccccggcagaggaggaggacgacgagttgtaccggcagtccctagagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggtgtggtcctttaaaaacaag
ttctacagctatgttttggagcagaggagacgcaacaggacttctgtggctgggcagagtgagaattcaaccagatggaa
gaaatcccagggacttagacttaggtactttcctgaggctttctacttcctgtaa
>gnl|bcl2dbcds|A0A8C3W949_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=1056 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggctgcgggaaaagaggccacggcccagagagaggtagggggaggggaag
ccggcgcggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagatgcccggagggtcgcgcggccc
tcgcccattggcgccgagggcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacccgcctcgcgtc
gccgcccgaagagatggactccccggcctccgacgccatcatgtctcccgaagaggagctggacggctacgagccggagc
ccctcgggaagaggccggccgtcctgcccttgctggggttggtcgaggaggccagtagtggccccggcacggacggctca
ctcccctcgacgccgcccccggcagaggaggaggacgacgagttgtaccggcagtccctagagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A8C3W949_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catagonus wagneri GN=MCL-1 (length=597 residues).
atgtttggcttcaagagaaacgcagtaatcgggctcaacctctactgtgggggggccggactggggccgggtagcggcag
cagtgcctccgctccgggagggcgcctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtgcggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggctttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C3UEV5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Catharus ustulatus GN=MCL-1 (length=585 residues).
atgctcggtgctgcagaaccgagagcgaagctggctgagccgggggaggggacacacgtggccgcagggatggggatggg
gatggggacgctttttccgggactcctgggtggtcccgaccggcccggcgcggcgggggatgctgtgatggagaaggcgc
tggagacgctgcggagggtcggtgatggagtgatgcagaaacacgagctcgcttttcaagggatgctgcggaagctggaa
atccagcaggaggaggacctgcagtcggtggtggaggtggctgcacacctgttcagcgacggggtgaccaactggggacg
agtggtgaccctcattgcctttggagccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagttccc
tggctgggatcatcacggacgccctggtgtcgtccaagcgccagtggctggagagccaggggggctgggatggctttgtg
gactttttccgagtggaggacctggagggcagcatcaggaacgtgctgatggcgtttgcaggagtggctggcctgggggc
cagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A286Y1M5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cavia porcellus GN=MCL-1 (length=702 residues).
atgtcgcctgaggaggagctggacgggtacgagccggagcccctcgggaagcggccggccgtgctgcccttgctggggct
ggtgggggaggccgggaagagccccagcgccgacggttcgctgccctcgacgccgcccccggcggaggaggaggaggagg
aggacgcgctgtaccgacagtcgctggagatcatctcgcggtacctgcgggagcaggccgcgggcgccaaggactcgaag
ccgctgggcggggtggggcccaccagcaggaaggcactggagaccctgcggcgggtcggggacggcgtgcagcgcaacca
ccagaccgccttccaaggaatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatccttgtcgcgagtggttg
cccttgttttcagtgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacac
ttgaagagcataaaccaagaaagctgcatcgaaccattagcggaaagtatcacagatgctctggtgcactcaaaaaggga
ctggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatatagaggatctagaaggcggcatcagaaatg
tgctgctggcttttgcaggtgttgctggagtaggggctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5LXU8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cercocebus atys GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatccttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggctgttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C0GRW6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=MCL-1 (length=579 residues).
catgttggcgttaaagcggaacgcggtgatcgcctcaacttgtactgcgggggcggccacgctgccccctccgcgccggc
ctccccagcggcgcggggacccctccgccccggccctgcggaggagggccgggccccgcgcatggagaaggcgctggaga
cgctgcggagggtcggcgacggcgtcattgagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaag
aatgaggatgatctgaagtcagtgactgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgt
gacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcag
ggatcatcacagatgtgcttgtcacaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattc
ttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagctt
agcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C3T6A5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelydra serpentina GN=MCL-1 (length=996 residues).
atgttggcgttaaagcgcaacgcggtgatcggcctcaacctgtactgcgggggcggcccggcgctggcgccccccccgcc
ggcctccccgagcggcgcgggaacccctcccgcccccggcgcgcgggaccccggcccttcggcggagggcgcccggccgg
cgacgctgattggcggagccgcttgggcttccaacggtcactctgaggggccccgggcgctgattggcgaggcgccccgc
gcgcggagcagctcccccacgaccccccctgcgctggtggccggggggccccggccgggcccgctgtggcggccggaaga
ggagctggacggctgcgaccccgacgccgagaggatgggcccgccggccgctgccgctggcggctccttgcccagcaccc
cgcccgcggacgacgacgacgacctggacgggctgtaccaggactcgctggagctcatcagccgctacctgcgggaggcc
gcggagctcgccgggcccggcggcaagaagctctacaagcggctgctgagcgggccgcggggggcgggccccgccgccat
ggagaaggcgctggagacgctgcggagggtcggcgacggcgtcattgaaaagcaccagatcgccttccaagggatgcttc
ggaaactagacatcaagaataaggaggatctgaagtcagtgactgctgttgcaacccatgttttcagtgatggagtaaca
aactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttg
catcaacacactagcagggatcatcacagatgtgcttgtcacagacaaacgagattggctagttaaccaaagaggctggg
agggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgct
ggactgggagcaagtttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C3TAL3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chelydra serpentina GN=MCL-1 (length=579 residues).
atgttggcgttaaagcggaacgtggtgatcagcctcaacctgtactgtgggggcggcccatcgctggcgccctccccgaa
cggcgtgggaacccctcccgccccccggctgctgagtgggccacggggggcaggccccgccgccatggaaacggcgctgg
agatgctgcggagggtcggcaacggcgtcattgagaagcaccagatcgccttccaagggatggttcggaagctagacatc
aagaatgaggaggatctgaagtcagtgacggctgttgcaacccatgttttcagtgatggagtagcatggggtagaattgt
gacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagacttgcatcaacacactagcag
ggattatcacagatgtgattgtcccaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattc
ttccgtggagaggatctagaaggtagcatcaggaacgttctggtggcttttgcaggctttgctggactggaagcaagttt
ggcctgcatgatgcaatga
>gnl|bcl2dbcds|A0A0D9RZP5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggctcggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgctggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgagcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C3EZ48_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=MCL-1 (length=666 residues).
tgtgctggggggtgctcccccagttcacccagaccctgccccactccactgcttccccccaggccccacctctgtcccac
tccatccccactccactgctgccctgcctcttcccgtcccgttctaccccatcccgagtgcaccctgccctcactcctcc
cacccagtgcctcctacacactggatcatggcaggcaggaggtcggcgatggcgtcattgagaagcagcagatcaccttc
caagggatgcttcggaagctagacatcaagcatgaggaggatctgaagtcagtaactgctgttgcaacccatattttcaa
tgatggggtaacaaactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataa
accaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgacattggttagttaac
caaagaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggtagcagcatcaggaatgttctggtggc
ttttgctggactgggagcatccttgttgagaggatttttttttttttttaaaagcagtggttataaatgttcaggcctga
gtctccattgcataatgcagcagtga
>gnl|bcl2dbcds|A0A8C3H9M3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=MCL-1 (length=597 residues).
atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccgtccccgcc
gggctccccgagcggcgccgggacccctcccaccccgggccggctgctgagcgggccgcggggagcgggccccgccgccc
tggagaaggcgctggagacgctgcggagggtcggcgacggcgtcatggagaagcaccagctcgccttccaagggatgctt
cggaagctagacatcaagaatgaggaggatctgaagtcagtgactgccgttgcaacccatgttttcagtgatggagtaac
aaactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaatt
gcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgagattggctagttaaccaaagaggctgg
gagggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgc
tggactgggagcaagcttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=1050 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac
gatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcat
ttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagtatca
cagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgta
gaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
aatcagatag
>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctaatagctccagtacggatgggtcactaccc
tcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcggga
gcaggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgac
gggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagaggacct
agaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaatcagat
agccttactgtaa
>gnl|bcl2dbcds|A0A2K5I9I0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccactggcgccaaggacacacagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaatcagatag
>gnl|bcl2dbcds|A0A6F9BEN5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=MCL-1 (length=879 residues).
atgaatctgtcgaagtcgtttacacgagccacaactacgatgttgaatattcaaaatggagtcgtcggaggatcttcgta
ccctgctggtgctagccctttgtactatttcggcgcgaatggggccgtatgtgctggggcgtcaccgaagtctaaagtag
atactgacttgggaaatgggactggcgatactccaccacgacccacgaagttagcagtgaatgtcgtgaaaagcaacgtc
ctagataatcatttgtcagaccgaagcaacaatgacgactctgacgactctttgccgtgcactcctcagatggcgtcaga
gtgtgggcctgacatatcgaattgtccatcgggcgatgaagtattggaacatgataccagacaactcattgagaacgtct
tgggggactacacaggactgtctccgtctcgttggaagcaaagcaagactcttacgacgatgaagcgagtggtggaggat
gtaatagcgaagcaccgatacgcatacaatggtatgatcgacaaacttgacttggatgatcgtagcgatgacatgagcgt
catcaagtctgtggccaagaccctgttcagtgatgggatcacgaactggggtcgcatcgccagcctagtggcatttggag
cagtggtgagccagcacctgaaggagaggggcaggggacactgcgttgagttggtgggccaagagatcgccacatacctc
ctctctgaccaaagggactggctggtcaaaaacaatgcatggaatggatttgtagagttctttcatgtgcaggatccaga
gtcctcagtaaggaacaccctcatagcctttgctggagttgctgggattggggcaacactcgccatgttgatcaggtga
>gnl|bcl2dbcds|A0A8C2TT61_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coturnix japonica GN=MCL-1 (length=1056 residues).
atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcggcggaggaggcccgggcctggtgcccgcttc
accggcaggagaccaacccgcgccacccgccgccgccgccgctccggccgccgccaccggctctgaggtaccgcggcctc
tgattggctcagcggggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattggctccggggctgccccc
cactctccgattggctccggggctgccccccactctccgattggttccgagtttgccccccactctctgattggtcccgc
cacggcccgccgggctccgtcggactccacaccgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg
aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccgccagaactgcccgacgacgagctacggcgg
gattccttagagctcatcctccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagctttttccggg
tctattgggtgggcctggacggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgttgaggagggtcg
gggatggagtgatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaatcaagaaagaagaagatctg
caggcagtttgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt
tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgcatcagctcgttggcagggatcatcacagacg
ctttggtctcatccaaacgcgagtggctgatgagccagggaggctgggagggttttgtcgacttcttccgagtcgaggac
ctggaaggcagcatcaggaacgtgctgatggcctttgctggagtggccggcctgggggcgagcttggcctacatgatccg
aaagtggaggagttga
>gnl|bcl2dbcds|A0A8C2TT61_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Coturnix japonica GN=MCL-1 (length=1050 residues).
atgtttgccgtcaaacggaacgccgtcatcggcttcaatctctattgcggcggaggaggcccgggcctggtgcccgcttc
accggcaggagaccaacccgcgccacccgccgccgccgccgctccggccgccgccaccggctctgaggtaccgcggcctc
tgattggctcagcggggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattggctccggggctgccccc
cactctccgattggctccggggctgccccccactctccgattggttccgagtttgccccccactctctgattggtcccgc
cacggcccgccgggctccgtcggactccacaccgaggcccgtcgctctgtggagccccgaggaggagttggacggatacg
aacccgaatccgaacgaggccccgggggcgattcgttacccggtacaccgccagaactgcccgacgacgagctacggcgg
gattccttagagctcatcctccggtatctccgggaagcggcgggagaagcggaacccagcgttaaaaagctttttccggg
tctattgggtgggcctggacggcccggtaaaacggggaacggcgtcatggagaaagcactggaaacgttgaggagggtcg
gggatggagtgatggagaaacacgagctggcgttccagggaatgcttcggaagctggaaatcaagaaagaagaagatctg
caggcagtttgtgaggtggccgctcacgttttcagcgacggagtaacaaactggggccgagttgtcacgctcatctcatt
tggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatgcatcagctcgttggcagggatcatcacagacg
ctttggtctcatccaaacgcgagtggctgatgagccagggaggctgggagggttttgtcgacttcttccgagtcgaggac
ctggaaggcagcatcaggaacgtgctgatggcctttgctggagtggccggcctgggggcgagcttggcctacatgatccg
ctggacttga
>gnl|bcl2dbcds|A0A8C2MG79_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cricetulus griseus GN=MCL-1 (length=1023 residues).
atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcggcggcgccagcctgggcgcgggcggcggctc
tccggccggggcgcgcctcacggccgaggaggccaaggcgcggcgcgaggggggaggggaggccggcctgctgcccggcg
cgcgggtggccgtgcggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgagaggcggctgctccgg
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcctccaccgccgccgccgccgc
catcatgtcccccgaggaggagctggacggctgcgagccggaggcgctcggcaagcggccggccgtgctgcccctgctgg
agcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctgccctccacgccgccgtcggccgaggaggag
gaggacgagctgtaccgccagtcgctcgagatcatctcgcgctacctccgggagcaggcggccggcgtcaaggacgcgaa
gccgctgggcgaggcgggcgcggcgggccggagggcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaacc
acgagacggccttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtcaaatctttttctcgagtgatg
gtccatgttttcaaggatggcataacaaactggggcaggattgtgactcttatttcttttggtgcctatgtggccaaaca
cttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagtatcacagatgttcttgtaaggacaaaacggg
actggcttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaat
gtgctgctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C2MG79_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cricetulus griseus GN=MCL-1 (length=879 residues).
atgtttggcctgcggagaaacgcggtgatcggcctgaacctgtactgcggcggcgaccccgacgtcaccgcgtcggccga
gaggcggctgctccggtcgcccggcctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctcctcca
ccgccgccgccgccgccatcatgtcccccgaggaggagctggacggctgcgagccggaggcgctcggcaagcggccggcc
gtgctgcccctgctggagcgcgtgagcagcgaggcggctaagaacccgggcgccgccggctcgctgccctccacgccgcc
gtcggccgaggaggaggaggacgagctgtaccgccagtcgctcgagatcatctcgcgctacctccgggagcaggcggccg
gcgtcaaggacgcgaagccgctgggcgaggcgggcgcggcgggccggagggcgctggagaccctgcggcgcgtgggcgac
ggcgtgcagcgcaaccacgagacggccttccagggcatgcttcggaaaatggacattaaaaacgaagacgatgtcaaatc
tttttctcgagtgatggtccatgttttcaaggatggcataacaaactggggcaggattgtgactcttatttcttttggtg
cctatgtggccaaacacttgaagagcataaaccaggaaagctgcatcgaacccttagcagaaagtatcacagatgttctt
gtaaggacaaaacgggactggcttgtcaaacaaagaggctgggatgggtttgtggagttcttccacgtacaggacctaga
aggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C0UE15_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=MCL-1 (length=483 residues).
atgctctgcacatccctgagaggctcctgcagcttcaggagctccagtggtggtgggctcacaccccatccccgctcctc
ccgcggggttttggtgctcctaaacccaaatcttccaggaatgctgcggaagctggaaatccagcaagaggaggacctgc
agtcggtggtggaggtggctgcccacttgttcagcgatggggtgaccaactggggccgcgtggtgacgctcatcgccttc
ggagccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagttccctggctgggatcatcacggacgc
cctggtctcgtccaagcgagagtggctggagagccaggggggctgggagggctttgtggactttttccgagtggaggacc
tggagggcagcatccggaacgttctgatggcgtttgcaggagtggccggcctgggggctggcttggcctacatgatccgg
tga
>gnl|bcl2dbcds|A0A8C3QRB8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyanoderma ruficeps GN=MCL-1 (length=903 residues).
atgttcgccgtgaagccgaaagccgtcatcggcttcaacctctactgcggcggcgccccggcgctgagccccggcgggcc
cggggagcgcccggagcccgccgccgccgccggcgcctcagagcagccccgcgaccgctccggggccgcccccgcccgcg
ccgagccgccccgcgcgctgattggctgcggcgccgcgccccgcgcgctgattggctgcggcgcgactctctggcgcccc
gaggaggagctggacggctgcgagcccgagcccgagcgcggccccgccgccgactcgctgcccgggacccccccggggcc
ccccgacgggctccggcaggactcgctggagctcatcagccgctacctgcgggaagtggcgggcgaggcggagcccgcat
ccaagaaacttttcccggggctcctgggtggtcccggccggcccggcgcggcgggggatgcggtgatggagaaagcgctg
gagacgctgcggagaatcggcgacggcgtcatgcggaaacacgagctcgcctttcaagggatgctgcggaagctgcaaat
ccagcaagaggaggacctgcagtcggtggtggaggtggctgcccacctcttcagcgacggggtgaccaactggggccgcg
tggtgacgctcatctccttcggggccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagctccctg
gccgggatcatcaccgacgccctggtctcgtccaagcgggagtggctggagagccaggggggctgggagggctttgtgga
cttcttccgagtggaggacctggagggcagcatccggaacgtgctgatggcctttgcaggggtggctggcctgggggcca
gcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8C2Z1X1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=MCL-1 (length=837 residues).
atgaatataataagcacgaaacgagccgcgttcaagatgactggagtcatgggctgtattatccttcctcaaaatggagt
cgtggagcgacccgtgcactacggctcgggagagtcctccccgctggtcgccatgggctccgctaaggactcccacaacg
gcaacgcggcgtccaacgacgccccgaagaggcccaagatcctcggctacgcgtcgaaaatgatccagggcgcggacgac
cacgacggcggctcgctgccgtgcaccccggagccggacagcgagatcgacgtgtcggactcccaggcgggcgccgaggt
gctggagaacgacacgaggcagctcatgggccgcttcctgggagactttaccggactttcgaaatcccagtggcacgaaa
gcagagagctgagcacgatgaagagggtcgtgaaagacgttttggagaagcatagatacgcgtacaatggcatgatcaac
aaattgtcattggacgacagaagtgacgatgccagtttcgtcagagaggtagccaagagcctcttcgcggacgggaccac
gaactggggccggattgtcagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaagaaccgggggaact
gtgtggagctggtgggacaggagatctccacgtacctgctgtctgaccagagggactggctggtcaagaacaatgcatgg
gagggctttgtggagttctttcgggtagtggacccagagtccacagtgaggaacacactcatggccgtcgctggatttgc
cagcatcggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3P8V8T6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=582 residues).
ctggatatggtgctcataagcagtgtctgtttgacgctgtgcacactggaaaatgacaccaggcaattgatttgcgattt
cctgaaagacttcaccacaaaatctacccaacgattggtggagagcaaagcattgtcaactatgaaaagagtggtaaaag
gcattttagacaaacacagacatgcattcagtggcatgatcaacaacctctcttttgaaaacggagtatataatattgga
gttgttggggcagtggccaggagcctcttcagagatggcacctccaactggggtcgaatagttagcctggttgcatttgg
ggcagtgctttgtcagcacctaaaggagaaaggctgggagaacacggtggaccaggttggacaggagatcgcctcatacc
tgttgtcttatcagaaagactggctcctgaaaaacaactcctgggatggcttcgtggaattcttccaaggacaagagcca
gagaaggcaattagatgtacacttcttggctttgttgggtttgcaggactttgggcaacacttgccttactgatgagata
ttttctcaggtttgtgtggtag
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=858 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcaggtcaagaaaatga
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=915 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagggatttcaactccattggaaaagccttcacagtgg
ccttcgatgccatgttcctcttcattcgtcgctga
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=849 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=849 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagataa
>gnl|bcl2dbcds|A0A3P8VHY5_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=MCL-1 (length=855 residues).
atgaatattataaagaacaaccaagctaagttgaacgttgccaccggagtcctaggctgtttcatcgtccctcaaaatgg
agtcgttaatggaaccatgcactatggcactggaaactccacgcctatagccttagcgtcttcgctgtcaacccacaacg
actcaatgagttctgtcaccgaaacccaaaggcgacccaaggacctccaggttaacacggcaaacggacatgccagaaag
agccactgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcggaagcagaactcgatgtctcccaggc
cggggacgaggtgctggataccgataccaaggaacttatttttcagttctacagagactttacaactcattctccgtcga
aatggggcgaacgcaaagcgcttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagatatgcatacaat
ggtatgatcaacaaactttcattagaaaacagacagggtgatttgactttcatcagctctgttgccaaaagcctgtttgg
agatggtaccacaaactggggtcggatcaccagcctggtggcctttggggcagttgtgtgtcagcacctaaaggagtgtg
gtcaagagaactcaacagagctagtaggaagagagatctcctcgtacctgctgtcttaccagagagattggctattgaaa
aacaactcttgggatggctttgtagagttcttcagagtagaagacccagaggcaaccatgaggaacaccctccttggtct
ttttggagttgctggactcggggcaacactggccctgttgatcagatggaaatga
>gnl|bcl2dbcds|A0A3Q2EDX8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=MCL-1 (length=795 residues).
atgagttaccttattcttccacaaaatggagtcgtggacggacaaacgcactacagcccggagattgcagcaccagaaat
accaatgaactccccaatgggatctcttcaccgaaacttaatgaaacgtccgaaggatctgcaagtagcaacgaatggat
acgttggaaaaaacctttcagacaacagcgcagacgacggcgggtctctgccgtgcaccccggagatgccaacggacagc
caccccgccacaccgggcggccatgcgggggacgaagcgctggacaacgacacgaaggagcttattagcagtttcctaag
agactttacgggacttcctaaacaacggcggaatcaaactaaagctctgtctaccatgaaaagggtggtggaggacgttt
tgtcgaaacacagatacgcttacaatggtatgatgaataagctttgtttagatgaagtaccggacaacatgggatttgtg
agttcagtcgccacgagcctcttttcagacggaaccacgaattggggccggatagtgagcctggtggccttcggggctgt
ggtgtgtcagcacctgaaggagaaaggcagagagaactgcgtggagctggtgagccaagagatctccacatacctgctgc
aaaatcagagggactggctagtaaagaacaattcatggaatggatttgtggagttcttcagagtagaagatcctgaagca
acaatgaggaacactctcatggcttttgttggagtggctggtattggggcaacattggcctttctgatcaggtga
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=921 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggccatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctgatcc
tccagctcactgtggcagcacctgctgtggttacctgagccaggctgttaaactcagtggaatacaggtaaagccatgtg
acaacacatgtactaatctgcacattcttgttctatggtaa
>gnl|bcl2dbcds|A0A8C1JUN1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=744 residues).
atgtttcctgggagtaaagtttcaaacgacaacggcctttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccactagtaatgccagaaccgaaagcccagaacgagttcgcagggaacggtctgcagg
gctcggtaccatcctcgcctgagtcggactgcgaggaaatagttgattacagccccgtctgcgccgctctggaaatggac
acgcgcgagattattgacattttcttaaaaagcttcacaggactccctcattctaaaagtggaaaaaaacagatcctatc
tacgatgaagcgggttgtggacagtctcgtggtgaagcacgaattggcttacaaaggtatgattgcacggctgaatctgg
aggagaaaggagaagatgtgagttttgtcaagactgtggcaacagagctcttcagcgatggcatcacaaactgggggcgc
attgccagcctgctgacttttggggccattgtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacggcactggctgctcaaaaacaaagcatgggatggcttcgagg
aatttttccatgtcccggatacagagggagctgtgagaaacgcattgatggccattggtagttttgcaacattcggagct
gcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A8C1YDY0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio GN=MCL-1 (length=783 residues).
atgactctaagttttgggattaaacgaacggccgcgttgagtgtcttcgcgcaaggcgcgcacacgtcgcttgtacccgg
gcccgcgctcaaaccgcgcacggaggacgagcttgacgggtacgcggatgacacggaagccgcgctgaagccgccgaggc
ccgggacgaacggcttgaaagggctgcagctggacgggcggttcgtgtccgcgggggacggctctctaccggccaccccg
gacccgaaggagctgggttccgtcgagctgcatctggacacgcggcagcttatgttggatttctatcgcacgcacacggg
aatgtgtccgccggaccggaagcgtcatcacgcgttaccgacaatgaggcgcgtcgtcgcggacattctgataaagcacc
agatcacttacaaaggaatgttgcagcgtctgcagctggactctcaaccggacgacatgagcttcatcagctgtatagcc
aagaccatgttcaaggaccacaccacgaactggggccggatcgtgagtctggtggcgttcggagccgtggtgtgcacgca
gctgaaggagctgcagagagagcagtgcgtggaggcggtggccgagcagatctcctcctatctgatctcagaacagcacg
actggctgctcaacaacaagagctggcatggattcgtggagtttttccgcgtggaggacgtggagtctgtggttcgcagc
gctctgatggctgttgtgggatgtgctgggattggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A2BF68_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|A2BF68_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=390 residues).
atgattctctggactctttcaggtatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagca
agtggcaacagagctctttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgt
gcaaataccagaatgacagaggacatagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagag
cagcgggactggatactcagaaacaaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgt
gagaaacacacttctaacaattggtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q1L8X3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacattgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtctgttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|Q568V1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=732 residues).
atgagcttcctcgcgcagggcgttcaaactccgacgctgaagacgtgcgtcgaagacgaactggacgggtacattgagga
ggaggaggcgcctctgaagcggcttagacctggtacaaacggcctgaaggggctgcagctggacggtcgatttgtttcta
cgacagacggatctctaccgaccaccccagatccagaggagctcgactacgccgaactggaacgcgatactcggcagctc
ttattggatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
ggtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagctggactctcagccgg
cctctctggacttcatcagatgtatagcaagcaccatgtttaaagatggcgtcactaactggggccgaatcgcgagtctg
gtggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatcagtgtgtggagagagtggctgagcagat
ctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctgtcatgggttcgtggagtttttccacc
aggaggacgtagagtctgttgtccgtcatggtctgttggcgctggtcggatgtgccggtatcggcgccggtctggccttc
ctcatccggtga
>gnl|bcl2dbcds|Q568W5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaataatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q8UWD6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtagtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q9I9N3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacactgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggtttgtggagtttttccaccaggaggatgtagagtctgttgtccgtcatggtcttttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|A0A8C4BCS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Denticeps clupeoides GN=MCL-1 (length=774 residues).
atgagcctgagcgccatgaagcgtccggcgggcagcgtgatcggcctgctctgctcgcacttcgcggttccatgcgcggt
cgcggacaacaaaggggaccccggggacgagctggacgaggcggactctttcgcgctgaagcccgagcgccgggacatgg
gcctggacagcggcttccagagctccgacgacgacgcgtccctgcccgcgtcccccgacgggccgccgcgcacgatcctg
gaccgcgaccgcgacgccctggagctcgagaccaggcagctcgtcggcgacttctaccggatctacgtcggagggaagcc
cgccgacacgcgtccgcacaacgcgctgccgaccatgaggaaagtcgtggacgaggtgctgcggaagcaccagatatctt
tcaaaagtatggtccagaaattggtgctgcagtctcagaacgagaagatggcctttgttacggcagtcgccaagaacata
tttaaagatggaaccaccaactggggccgcatcgccagcctggtggcatttggggccgtggtctgccgagaactgaaggc
gattgacagggaggactgtgtggagaccgtgactacgcagatctgcacgtacctcgccaccgaacaaagggagtggttcg
tcaataacagcggctgggttggctttgtggacttctttcacgtggaggatccagagactgtagtctggaacaccttgatt
gcagtagcaggcttcgcggggctgggagctggcctggcgctcatgatcagatga
>gnl|bcl2dbcds|A0A8P4G790_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=MCL-1 (length=1101 residues).
atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaacatgagcgtatttctcactcaaaatggagg
cgtcgacggacacatgcactacggaccaggagattcatcccctcagatcgcaatgggctcttctctagcctctcacaacg
ggagtgtcggctccagcgacgccccgaaacggccaaagaacctgggagtgagtccgactaatgggtatttaacaaaagcc
attcgcggggtcagcgacgacgtcgaggacggctctctgccgtgcaccccggagctcctctcggacactgaaatcgacgt
ctccgggtgtccagcgggggacgaagtgttgaacagtgaaacgacgcaactcattgactgtttcctgagagactttactg
gactttctaaatctcggtggaacgaaagcaaagcactagcaacgatgaaaagagttgtggatggcgttttggagaaacac
agatacgcgtacaatggtatgatcagaaaactgtcattagatgaaagggaggacgatgcaagctttgtcggggcggtagc
aaagagcctctttgcagatggaaccaccaactggggtcgtgttgccagcctggttgcctttggagcggtggtgtctcagt
acctgacggagaagggcaggggcaactgtgtggagctggtgggacaggagatctcctcgtacctgctgacgcaccagcgg
gactggctggtcaagaacaactcttgggatggctttgtcgagttctttcgagtagcagacccggagtccacagtgaggaa
cacactcatggcctttgctggatttgccggtatcggggcgacactggccctgttgatcagacggcctaggctgctgtttc
ctcgaaatttgatgagactgcagcagcgcctccatcacactaagcgctcagctgcatccgccgagttgcacagttctttg
caaagctggtgcataacatctgaatgcaccagcacaagctatattgtgaaactggggttaaagagttcaaaattgtgtac
cactctatttcctgggttggaaggctacctagaaactggggactttaaacaaatacattga
>gnl|bcl2dbcds|A0A8P4G790_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=MCL-1 (length=1176 residues).
atgaatataattcagacaaatcgggccgcctacagcctaacgaacggaaacatgagcgtatttctcactcaaaatggagg
cgtcgacggacacatgcactacggaccaggagattcatcccctcagatcgcaatgggctcttctctagcctctcacaacg
ggagtgtcggctccagcgacgccccgaaacggccaaagaacctgggagtgagtccgactaatgggtatttaacaaaagcc
attcgcggggtcagcgacgacgtcgaggacggctctctgccgtgcaccccggagctcctctcggacactgaaatcgacgt
ctccgggtgtccagcgggggacgaagtgttgaacagtgaaacgacgcaactcattgactgtttcctgagagactttactg
gactttctaaatctcggtggaacgaaagcaaagcactagcaacgatgaaaagagttgtggatggcgttttggagaaacac
agatacgcgtacaatggtatgatcagaaaactgtcattagatgaaagggaggacgatgcaagctttgtcggggcggtagc
aaagagcctctttgcagatggaaccaccaactggggtcgtgttgccagcctggttgcctttggagcggtggtgtctcagt
acctgacggagaagggcaggggcaactgtgtggagctggtgggacaggagatctcctcgtacctgctgacgcaccagcgg
gactggctggtcaagaacaactcttgggatggctttgtcgagttctttcgagtagcagacccggagtccacagtgaggaa
cacactcatggcctttgctggatttgccggtatcggggcgacactggccctgttgatcagatcctccccgttgtctcggg
ttacaggacaaacaacactcatcgaggtcttaggaggaaatggagtagagcctctccatggtgatgatccacagcagacc
tccctgtgtcctctcctgtggctaatgatgttagccaccaccctggttacccctgcacagttcattgtgaagaacaggct
gctacacaatggggaattgaggctgaggcaattttctagagcggtttgcaccatacacaagtgtattgggagtgcagaaa
acagactgcactgcagtgtcttggggctgaatatgcaaagcacccttggtctttga
>gnl|bcl2dbcds|A0A8C4K2K9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=MCL-1 (length=537 residues).
cctgtggggaggcctctggggggggtgtgtgggcctggcctgtgtggggccctcgaggtgggtgggcaccggctctgccc
cgcggctgcaggcagctctgggggctgggggcgacctgggcccccaccagctttgggggctggagcgaggctgcagatcg
cctctcccgcagggatgctgcggaagctggacatccagaaggaggaggacctgcagtccgtgtgcgaggtggcagcccac
gttttcagtgacggagtaacaaactggggcagagttgtgacactcatctcgtttggtgcctttgttgcgaaacacctgaa
gagcataaaccaggagaagtgcatcagctcgttagcagggatcatcacagacgcgctggtctcctctaaacgggagtggc
tagtgagccagggaggctgggagggcttcgtcgacttcttccgcgtggaggacctggaagggagcatcaggaacgtcctg
atggctttcgcgggcgtcgccggactgggcgcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A665TFT7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Echeneis naucrates GN=MCL-1 (length=816 residues).
atgagcctttttcaaacacacaagtcttctgccttcgggtccgcctccacctccatgaacctgctaatctgcgacccgaa
cgtactgccgaagatgtggaccggcggggccggggcctcctccgtggactctccgatccggagcgacgtcgccaaacgac
ccaccaacctggaggtgagctctaaaggcggctgcccgccgaaaatcgtccgggaaaacagcggcggggagtccgtagct
tgcaccccggagagcaactcagacagcgaggccgaggcctcctctccggccgagagggagctgctcagggccgatacatg
ccagctcataagccagaccatgaggtggtacaccgagtggtccacgccgaggacgaagcagcacagagggctggacacca
tgaagagagtcgtggacgggctcctggagaagcacggaatcgcctacaatggtatggtcaacaaactgtcactggacaac
acagaggacatgagttttgtctgtttggtggcccagaaactcttctcagacggcaccaccaactggggccgtgtggccag
cctggccgccttcggggtggtggtgtgtcggaggctgaaggagatgggcagggagagctgtgtggaatctgtaggaatgg
agatctccaaatacctgttgtctgaacagaaggactggctgctgaagaacaattcatgggatggctttgtggagttcttt
cacgttgtggacccagagtcatcagtgaggaacacactcatggcctttgctggagtggcaggcatcggcgcaacactggc
cctgttgatcagatga
>gnl|bcl2dbcds|A0A4W4F1X6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=795 residues).
atgagtatgacgacgatgaagcgcacgacagcgatagggctgctgtgtaacggggctcaacacggagtgaaggacagctt
cgtcctcggggtgcgtcccacaatggcggcggaggacgagctggacggatgcgcggaggacacggatgggtggcccctca
aacccgccaggcacggtagaggcttgacactcgacacccggttccctcagtcttcaaacgcagacggctctctgcccact
tcccccgactcccaggagactctcccggacttcaggtctgatctggacgcggagactcgggagcttctcggatactttta
tcggacttacacaggacttccgcacaggagaactaaactcagcgctctgcccacgcttacgagggtcgtgggcgatgtga
tctgtaagcaccggattgcatataatggtatggtacagaagctgcagatggaggagcagagtgacgacctggaggttgtg
agcactgtggccaagagcatgttcagtgacggcatgactaactggggccgtgtggccagcctggtggcatttggcgcggt
gctgtgtgagagcctgaaggagagtgggagagatcactgtgtcgacaccgtagcccatcgcatctcatcctacctcacca
cctaccagcatgaatggctcctcaacaacaagtcctgggatggctttaaagaatttttccaagtggaggatccagagtct
gtggttcggaatgctttgatggcagtggcaggatttgctggtcttggggcagggctagctctcctgatgaggtga
>gnl|bcl2dbcds|A0A4W4H9I6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Electrophorus electricus GN=MCL-1 (length=693 residues).
atgattaatccacaagatatgtgttacagcaaggagagctccggaccaggaatgagacccgtgctatctttaggaatcac
ctctgacaaaagggtcattggcgaaggctcgttaccaaattcccccgagtcagactgcgaggagttgagcgtagttcgct
tcacggagggcagaactctggagaacgacacgcgagaaatcattaacgattcgcttctcgagcttacaggccgttctaat
tactacagtcgtcataggaaggtcgtaggaacaatgaagcgcgttgtaaacagcctggtggagaagcatgaacttgctta
taaaggtatgattgtgaaactgaatttggaggagagaggcgaagatatgcgtgtgattacgacagtagctaaggagatgt
tcagtgatggcaaaaccaactggggccgcattgccagtttgctggcctttgggtccatggtgtgcaaatatcataatgag
aagggccaaggccaccgtgtgcgtctggtgggagaagaaatctcctcttatctcctttctgacaaaagggactggctatt
gaaaaataaagcatgggatggttttgtggatttttttcatgtttcggatcctgagtcgaaactgaggaatgcgttaatga
ccattgctactgtggcagggattggggctggaattgccttttttagaagataa
>gnl|bcl2dbcds|A0A8C4L244_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus asinus asinus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttggcggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgcccccctccaggctgcgtttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcgccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggatatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A5F5Q151_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=1053 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctgcggggaaggaggccacggcccggcgagagggagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgggagcccccagaccaccctcgcgccggactccctgagggtcgcgcggccctcc
cccattggcgccgagggccccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcccacccgctgcgcgtcgcc
gcctgaggggatggaagccccggccgccgacgccatcatgtcgcccgaggaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagtttgtccgggaggccagcagtggcccctgcacggacggctcgctc
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcaatcgctggagattatctctcgttaccttcg
ggaacaggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgc
ggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggcgctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A5F5Q151_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Equus caballus GN=MCL-1 (length=594 residues).
atgtttggcctgaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcggcggcgg
cgcctcgtcgccgggagggcggcttttggctaccggcaccaaggacacgaagccaatgggcgggtctggggccgccagcc
ggaaggcgttagagaccctgcggcgggtcggggacggagtgcagcgcaatcacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggcccacgttttcagtgacggagtgacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggcgctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C4RFB4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=MCL-1 (length=888 residues).
atgaatcctgcgcttgcaactatgaaccgcagccccgctaccagcctagtccagatgttatactgctctggaccgtcggg
tttgaatggcgtttttaagcacgatgccctgcatcttgcgaagggggctgactttacgggaagcacgcaaatgatgtcgg
tgcagctggatgaaggcgagctagacgattgtttggatgaggtcgattcagtctcgcagcttcacaagtcctcgtcgaag
aattgcttaaaaaatctcctgttctcggccgagagctcaaatgcagatggctctcttccagcatctccggagacgccttc
tagcccaatggacagcagtcagcccggatttacgcctgctgctgacgcccagctggcgcaggaaacagaggagcttattg
cggcctacttatttcgatcggccggattaccctgctcacgtatccgtaatggaaacaaatctttcgacacccttgtacgt
gttggggattctgtcatcgagaaacataaattcgcgtttaacggaatgctccggaagcttaatatctcccaggagggaga
catgggattcatgacccctgttgctgaaagcatcttcagcgatggagtgataaactggggacgtgttgtaagcttggtag
cgtttggggcagtggtagccaagcacctaaagcaagtcaacctagaacgctgcatcaggcctttggcagaccagatttct
actttcctgcttacacgccaaaaggattggattgtgaataacagagcttgggagggctttgtagagttctttcgcattga
agatccagaagcaggaatacgacaggccttgatcacctttgctggaatggcaggcattggagctggtattgcttatttga
tccgatga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1056 residues).
ctctcttattcctacagacagaacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgag
cgctgaggagttagatgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgcc
agcgtgatcagaccaagaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctcta
gagcatgcggacagagaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgg
gcagatccccatcaatgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgt
gtgacatagcagccatcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtacc
atcgccaacacagagggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctac
gaatgtggaggagacccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggaca
ttcccatcccaacgctgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacc
cgtagcaatgaccctgtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtc
gaacttcatcaccagtgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcg
acaatcagagacagaagctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaag
atcggctaccacttcacccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgattcgtca
acagaggctaagatga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1077 residues).
cttgcagacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
tgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgccagcgtgatcagacca
agaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcggacaga
gaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgggcagatccccatcaa
tgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgtgtgacatagcagcca
tcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaacacagag
ggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctacgaatgtggaggagac
ccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggacattcccatcccaacgc
tgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagcaatgaccct
gtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtcgaacttcatcaccag
tgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcgacaatcagagacaga
agctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaagatcggctaccacttc
acccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgattgtctatggttttcctacatg
cgatgatctgtcacataggcgtttcagtttcacatga
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=1038 residues).
gaggcgtgtttgtacatgtcaaaaagcgacccacgggacatcgacgaggatgccatcctcaaagggatgagcgctgagga
gttagatgcgctggagtatgagctgcaagagatggacccagagaatgccatgctgcctgcagggttccgccagcgtgatc
agaccaagaagagcccgacaggggttttcgaccgtgacgccctgctggatcacttggagaaaactgctctagagcatgcg
gacagagaagacctagtgcccttcactggagagaagaaagggagagcgtttgttcctaaggagggccacgggcagatccc
catcaatgagcagatcaccctggagcctgagcttgaggaggccctgaagaatgctacagatgctgagatgtgtgacatag
cagccatcctgggaatgtacacactgatgagcaacaagcagtactacgacgccctgggcaccactggtaccatcgccaac
acagagggcatcaacagcgtcgtaaaaccagatccattcaagatcttcccagacgagccgcccaaccctacgaatgtgga
ggagacccttcagcagatccagactaatgacagcagcctgcttgaagtgaacctcaataacattaaggacattcccatcc
caacgctgaaagagatctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgccgccacccgtagcaat
gaccctgtggcctttgctgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcgagtcgaacttcat
caccagtgagggcatgacggccattgtcaaggccatggccaacaacaatacactgaccgagatcaagatcgacaatcaga
gacagaagctcggggactcctgcgaaatggagattgccagcatgttggagaacaactccagcatcctaaagatcggctac
cacttcacccagcaagggcctcgtgccagagcagccatcgccatcaccaggaacaatgacctgagtgagcatctatag
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=915 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
cacccttatggcctttgcaggagttgctggaattggggcaacacttgccctgttaatcagacagagtcctgctcacccct
ggggttgtgaggcgtgtttgtgtgaccctagctag
>gnl|bcl2dbcds|A0A3P8Y1W8_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=864 residues).
atgaacctgtcgaaatcgcttacacgagccacaactacgatgctcaacgttcaaaatggagtcgtgggatctttgtattc
tggtgcccctttgtgctattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaaaatggacgttgatt
taggaaatgggactgctgatactcctgtccgacctacgaagttagaagtaaatatgacgaaacccaacgtattggatagt
cgtttgtcagacctggccgacgactccgacgactcattgccgtgcactcccctgatggttactgagtgtagtgcggggtt
atcacattgcccatcgggcaatgaggttttggacaacgataccagacaactcattgagaatttattaagggactacacag
gactgtctcaacctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcac
acatacgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatgacatgggtttcatcacgtctgtggc
caagagtctgttcagtgatgggactacaaactggggtcgcattgccagcttggtgggctttggggcagtagtgagtcaac
acctgaaggagatgggcaagggaaactgcgttgagttggttggccaagaaatctccacatacctcctcactgaccaaagg
gcctggctcgtgaaaaacaacgcttgggatggatttgtagagttttttcatgtagaagatccagagtcctcagtaaggaa
cacccttatggcctttgcaggagttgctggaattggggcaacacttgccctgttaatcaggtga
>gnl|bcl2dbcds|A0A6Q2XQM7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=603 residues).
atgagagtattttcaaaatcgaagatgtcgctaatctcccagggaaccggtgagtgtgttgacgaatgcagaaacagagc
ctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagactttactgaacatttgaaacctaggtggaacg
aaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaatggtatgctc
tacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggctcttcgcagatgg
gaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgtggtgtgccggtacctcaaggataagggcaaag
acaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagaccagagagactggctggtaaaaaacaac
tcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgagaaacgtactcctaacatttgctggctt
cggggcagcgctggccatgttgaaaatggtcgggtaccaatag
>gnl|bcl2dbcds|A0A6Q2XQM7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=648 residues).
tgtctagagtgccacgtgccctatgctgtatacttattttcaaaatcgaagatgtcgctaatctcccagggaaccggtga
gtgtgttgacgaatgcagaaacagagcctcgctggacaccgagaccaggcaactcgtgaaatctttcctaggagacttta
ctgaacatttgaaacctaggtggaacgaaagcaaagctctgtcaacaatgaaacaagttgtcaccaaatcattggacaaa
cacagatactcatacaatggtatgctctacagactgtccttgggtgacagcccaggggattacgtgagattcgtgagtgt
aatcgctaacaggctcttcgcagatgggaccacaaactggggccgcgttgtcagcctgctcgcgttcgggactgtggtgt
gccggtacctcaaggataagggcaaagacaactgtgtggaagcggtgggacaggagatctccatgtacctactgacagac
cagagagactggctggtaaaaaacaactcctgggacggattcgtggagttctttcgggtagcagaggagtctacattgag
aaacgtactcctaacatttgctggcttcggggcagcgctggccatgttgaaaatgtatgtggtcactggaaagagtttgt
acatgtag
>gnl|bcl2dbcds|A0A6Q2XXK6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=759 residues).
atgagcggagtatatccccagggatctaactttaccagccgggtaaccgttacagttaaagggtttggcatatccgcact
aaagcgtagagaaagtggtcagtacgaatcacctgaggggttgaaatcccataccggacctgatgtcgacaccattcgaa
ttttagtattttcaaaacagaagatgtcgctaatctcccagggaaccggtgagtgtatttacgaacgcagaaacagagcc
tcgctggacacggagaccaggcaactcgtgaaatctttcctagaagagtttactggatgtttgaaacctaggtgtaacga
aagcaaagctctgtcaacaatgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaatggtatgctct
acacactgtccttggatgacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggctcttcgcagatggg
gtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgcggtgtgccggtacctcaaggataagggcaaaga
gaactgtgtggaagcggtgggacaagagatctccatgcacctactgaccgaccataaagactggctggtcaaaaacaact
catgggacggattcgtcgagttctttcgggtagcagaggagtctacattgagaaacgtactcgtaacatttgctgcattt
gctggcttttgggcagcgctggtcatgttggacatgtaa
>gnl|bcl2dbcds|A0A6Q2Y9Q3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Esox lucius GN=MCL-1 (length=759 residues).
atgagcggagtatatccccagggatctaactttaccagccgggtaaccgttacagttaaagggtttggcatatccgcact
aaagcgtagagaaagtggtcagtacgaatcacctgaggggttgaaatcccataccggacctgatgtcgacaccattcgaa
ttttagtattttcaaaacagaagatgtcgctaatctcccagggaaccggtgagtgtatttacaaacgcagaaacagagcc
tcgctggacacggagaccaggcaactcgtgaaatctttcctagaagagtttactggatgtttgaaacctaggtgtaacga
aagcaaagctctgtcaacaatgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaatggtatgctct
acacactgtccttggatgacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggctcttcgcagatggg
gtcaccaactggggccgggttgtgagcctgctcgcattcggtgctgcggtgtgccggtacctcaaggataagggcaaaga
gaactgtgtggaagcggtgggacaagagatctccatgcacctactgaccgaccataaagactggctggtcaaaaacaact
catgggacggattcgtcgagttctttcgggtagcagaggagtctacattgagaaacgtactcgtaacatttgctgcattt
gctgtgtcaatggtacactatattagggctgtgtactga
>gnl|bcl2dbcds|A0A8C4U2H6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Falco tinnunculus GN=MCL-1 (length=1539 residues).
atggtgcgggctgcgagggctgcgaggccggtgcccgggggcgcctgctttgccggggggagttggggcactgcagcacc
ccgtggtgatggggtgggagggggtggcacgcctgggtctgaccgggctgggaggcacaagcagggcagacacaaggcac
cgagcagggccaggccgggggaggcggcgtgtgcagcggggccgggggtgcccggtgtggggccgcaggaggcccggcgg
ggtgacgcctctccgcgggggcggcgggggctctttcgccctttttcaccccaaaaagccccggcctggcgaggcgtgac
acccaccccccccgggccgtgccggaagcggggccggaaacgcggccggaagtggaccggcgcggcctcgctccgccccc
gtcgtgccccgcgtcgcgtcccgtcacgtcaccgccgccatataagcggcagcgacgctcaccgccgcgcagctcgccgt
tcgtgcgcagtggccgccatgttcgctgtgaagcggaacgccgtcattagcttcaacctctactgcggtggcggcctggc
cctggcgcctgcctcgcccggggggggcccgacgccgccgccgcccgccgtcgtccccgccacggccgccgccgccgccg
aggtgccctgggccgccgccagtcgccccgaggtaccccgcacgctgattggccaggccgcagccccccgctcgctgatt
ggctgcggcgcggccccccgcgccgcgctgccccccggcgggcggccggccgcgctgtggagccccgaggaggagctgga
cggctgcgagcccgagcccgagcgcggcccggcgggggactcgctgcccggcccgcccgacgggctgcggcaggactcgc
tggagctcatcagccgctacctgcgggaggcggcgggcgagtccgagcccggcgccaagaagcttttcccggggctgctg
ggcgggcctggccggcccggcgatgccgtgatggagaaggcgctggagacgctgcggagagtcggcaacggagtgatgca
gaagcacgagctcaccttccagggaatgcttcagaagttggacatccagaaagaggaagatctgcagtcagtgtgtgaag
tggctgcccatgtgttcagtgatggagtaacaaactggggtcgagtggtgacgctaatctcatttggtgcctttgttgca
aaacacctgaaaagcataaaccaggagaagtgcatcagctcgctggcaaggatcatcacggatgctctcgtctcatctaa
gcgcgagtggcttatgagtcagggaggctgggatggctttgttgacttctttcgagttgaggacctagaaggcagcatca
gaaacatactgatggtgtttgcaggtgtggctggactgggagcaagcttggcctacatgatccgagctaatgatgcaaaa
aggaggatttttgaatgtggtagaactgcttatgggtgcactgtacttcattcctcatgtgaagtagcatttttgtggcg
aagccttctcctgccttga
>gnl|bcl2dbcds|A0A337S3J9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=993 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggagataaggcttga
>gnl|bcl2dbcds|A0A337S3J9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=996 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctggggcaaggaggccccaacttctctc
tgcttggcccatttgctgtgttcagagcaggtgtag
>gnl|bcl2dbcds|A0A337S3J9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A337S3J9_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|Q7YRZ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Felis catus GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
aacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=1638 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatggaat
gccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgggggactatgaccgcgacgccctgca
ggactacctggagaagagcgccctggagcacgaggacagggaagacctgatccccttcaccggggagaagaaagggaagg
cgtttgttcccacggcgaccgggcagatccccctaagcgagcagatcaccctggagccggagctggaagaggccctgaag
aacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtataccctgatgagcaacaagcagtactatga
tgctctgggttgcacggggaagatcgccaacacggagggcatcaacagtgttgtaaaacaagatcccttcaagatctttc
cggaagagcccccaaacaccaccaacgtggaggagaccgtggagaggatccacaacaacgacagtggtctgacggaggtc
aacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttgaggccatgaagggaaactcttacgttga
gatcctgagcatcgcagccacacggagcaacgaccccgtcgccttcgcatgtgcggagatgctgcaggagaacaccagtc
tccagagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggctgtagtcaaggccatggccagcaacgcc
acgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcggtggagatggagatcgccgccatgctgga
gaacaactccagcatcctgaagttcggctaccacttcacccagcaggggccccgggcccgggccgccatggccgtcacca
ggaacaacgatatgcttcgccaacagaggctgagatga
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=834 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgaccgtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtga
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=885 residues).
atgctgtcacagaaactaacttcaaactacggaaccagcttagtccagacctgctggtttaacagccctcaaaatggagg
cgaagagcgaaacatggacttccactccgaaggttcacacaccacgacagagggggccttgcctctaatggcgacgttca
aaagcggagacgaacgtaaaccaagacccacggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaa
ggaaacggttcgctgcctagcactccggaactccagtcagaagtagacacggacagccaggcgggggaagaagtgttgga
taacgacaccaagcgaatcattcgcatttttctcagagactatgcaggggcatcaaaagctaaaaggacaagacaagacg
aggttcaagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaatacgcatacaagggtatgatccagaaa
ttggaattggacggccgaggggaagacatgagttttgtcacgtctgtggccaagagtctcttcgcagacagcacaacaaa
ctgggggcgtatcgccagcctggtggccttcggagcagcgttgtgtcagtacctagaggccaggggtaaagaaggctgcg
tgtcgctggtggccgaggagatttcctcatacctcctttcagaccaacgggaatggttggtcaaaaacaactcatgggag
ggcttcgtagagttttttcgagtgtcagaccctgagacgaccgtgagaaatacactcatggcctttgctggatttgctgg
tattggtgcaacaattgccctactaatcaggtcagagggccaagtctccagggagaagaacagaaatttaccccaacaga
cgtaa
>gnl|bcl2dbcds|A0A8C5CE84_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gadus morhua GN=MCL-1 (length=1026 residues).
atgtcggaccccagggacatagacgaggatgccatcctcaaaggcctcagctctgcagagctggaacagctggagtgtga
gctccaggacctggaccccgagaatgccatgctcccagcgggctaccggcagcgggaccagaccaagaagacccccacgg
gggactatgaccgcgacgccctgcaggactacctggagaagagcgccctggagcacgaggacagggaagacctgatcccc
ttcaccggggagaagaaaggtaggaaggcgtttgttcccacggcgaccgggcagatccccctaagcgagcagatcaccct
ggagccggagctggaagaggccctgaagaacgccactgacgctgagatgtgcgacatcgcagctatccttggaatgtata
ccctgatgagcaacaagcagtactatgatgctctgggttgcacggggaagatcgccaacacggagggcatcaacagtgtt
gtaaaacaagatcccttcaagatctttccggaagagcccccaaacaccaccaacgtggaggagaccgtggagaggatcca
caacaacgacagtggtctgacggaggtcaacctcaacaacatcaaggacattcccatccccacgctgaaggaggtgtttg
aggccatgaagggaaactcttacgttgagatcctgagcatcgcagccacacggagcaacgaccccgtcgccttcgcatgt
gcggagatgctgcaggagaacaccagtctccagagtcttaacattgagtctaacttcatcaccgcagagggcatgaaggc
tgtagtcaaggccatggccagcaacgccacgctggtggagctcaagatcgacaaccagaggcacaccctgggagactcgg
tggagatggagatcgccgccatgctggagaacaactccagcatcctgaagttcggctaccacttcacccagcaggggccc
cgggcccgggccgccatggccgtcaccaggaacaacgatatgcttcgccaacagaggctgagatga
>gnl|bcl2dbcds|G3PJT0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=MCL-1 (length=957 residues).
atgaatataattcagagaccgaaactggccgcgttaaacatgaccggagtcatgagctgcattattctccctcaaaatgg
agtcgcgcccatgcgacagctcgcaatgggctcggcgaaggactcccacaacggcaacgcggggacaaacgacaccccga
agcggcccagcgccctcggggtgaactccgcgaacggctacccatcaaaaccgcagcgggaggacagcgaggacaccgac
aacgactcgctgccgtgcaccccggagtcggacagcgaaaccgacgtctccgactccccggcgggggccgcggctctgga
gagcgacacgaggcaactcctcggccgcttcctgagagaatttacgggactgtcgaaaacccagtggaacccgagcaggg
agctcaccaccatgaagagggtggtgggcgacgttttggagaagcacagatacgtattcaatggtatggtgaacaaattg
tcactggacgaccgaggcgacgacgccagtttcgtgcgggaggtcgccacgagcctcttcgcggacggcaccacgaactg
gggccgcatcgccagcctggtggccttcggggcggtggtgtgccaacacctggcggagcgaggccgggggaactgcgtgg
agctggtggggcaggagatctcggcctacctgctgtcggaccagcgggactggctgatcaaaaacaacgcctgggttggc
ttcgttgagttctttcgagtagcagacccagagtctgcggtgaggaacactctcatggctgtggctggattcgctagtat
tggggcgacactggccctgttgatcagtggaccttcaaaagtgcaaaggcagcttctcaccattgaattgttgcagatcg
tgcgctctcagaggggaggacaccggctgcagcgtgatgtgagcaccagaccttctccgacatccggctctggacta
>gnl|bcl2dbcds|A0A8C4YAJ9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gopherus evgoodei GN=MCL-1 (length=954 residues).
atgttggcgctgaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccctccgcgcc
ggcctcccccagcggcgcggggacccctcccgcccccgggcctgcggcggagggcgtccggccggcgacgctgattggcg
gagcctcttggggttccaacggtcattctgagggggcccgggcgctgattggctcccccgcagccgccccgtctctggtg
gccggggggccccggcccggcccgctgtggcggccggaagaggaactggacggctgcgaccccgacgccgagcggatggg
cccgccgggcgccgccggcggctccctgcccagcaccccgcccgcggaggacgacgacgagctggacgggctgtaccagg
actcgctggagctcatcagccgctacctgcgggaggccgcggagctcggcgggcccggcggcaagaagctcctcaagcgg
ctgctgagcgggccgcggggcgccggccccgccgccatggagaaggcgctggagacgctgcggagggtcggcgacggcgt
cattgagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaagaatgaggatgatctgaagtcagtga
ctgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgtgacactcatctcttttggtgccttt
gttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcac
aggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggta
gcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagcttggcctatatgatgcgatga
>gnl|bcl2dbcds|A0A2I2YJ87_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I2YJ87_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatgacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I2YJ87_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttagccaccggcgccaaggacacaaagccaatgggcaggtctggggcaaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C5H9Y5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gouania willdenowi GN=MCL-1 (length=984 residues).
atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagcaacacaaaatggaggcgtagaaggacgaat
caactaccagcagaaggatccgcctcgggatcaccacgccatagacacgtctctagactctctgaacggaaacattgcct
ccagtgagaccccgaaacgacccaaaaaccttagtgtggcttccaccttcgtgcctaaagctctgcgggaggacagcgag
gacatggaggacggatctctgccgtgcacaccggaggtgcattcggacactgaggccgaggtctcgaattgcagtggcgg
ggcggaggtgctggagaacgacaccaggcaactaatgtcccggttcttagccgactatacaggactttctaagcgcgatt
ggaatgaaagcaaagcactgtcgaccatgaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatgga
atggtcaacaagttatcactggataactgtagtgatgatatgacatttgtcagcgctgtggcgaagagccttttcgcaga
ccaacgcaccaactggggtcgtattgctagcctagtggcctttggggctgttgtgtgtcaacacttgaaagaacggggca
ggtcaaactgcgtggagctggtggggcaggagatttccacataccttcttaccgagcagcgagaatggctggtgaaaaac
aattcatgggatggctttgtagactttttccgagtagcagacccagagtcaacagttaggaacacacttatggcttttgc
aggattcgctggcattggggctacactagcctttctgatcaggagggcatgtgggtgcctgaagaatgagaaggcgtgta
agcgtgggaggaggagacatcaaagaaaggggaaatcggatcccctcttcagacaaagcgagccaaggggttcagagaca
aaggaaacgagatccgccatgtga
>gnl|bcl2dbcds|A0A8C5H9Y5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Gouania willdenowi GN=MCL-1 (length=846 residues).
atgaatatcgtgtcgacgaagtcaactagtttaatgaactgccttttagcaacacaaaatggaggcgtagaaggacgaat
caactaccagcagaaggatccgcctcgggatcaccacgccatagacacgtctctagactctctgaacggaaacattgcct
ccagtgagaccccgaaacgacccaaaaaccttagtgtggcttccaccttcgtgcctaaagctctgcgggaggacagcgag
gacatggaggacggatctctgccgtgcacaccggaggtgcattcggacactgaggccgaggtctcgaattgcagtggcgg
ggcggaggtgctggagaacgacaccaggcaactaatgtcccggttcttagccgactatacaggactttctaagcgcgatt
ggaatgaaagcaaagcactgtcgaccatgaagagagtggtggaggacgttctggagaagcacagatacgcgtacaatgga
atggtcaacaagttatcactggataactgtagtgatgatatgacatttgtcagcgctgtggcgaagagccttttcgcaga
ccaacgcaccaactggggtcgtattgctagcctagtggcctttggggctgttgtgtgtcaacacttgaaagaacggggca
ggtcaaactgcgtggagctggtggggcaggagatttccacataccttcttaccgagcagcgagaatggctggtgaaaaac
aattcatgggatggctttgtagactttttccgagtagcagacccagagtcaacagttaggaacacacttatggcttttgc
aggattcgctggcattggggctacactagcctttctgatcaggtga
>gnl|bcl2dbcds|A0A3Q2VNL8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Haplochromis burtoni GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacgtcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacgctcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
>gnl|bcl2dbcds|A0A087WT64_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=459 residues).
atgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacga
gacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatcc
atgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttg
aagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactg
gctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-06 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-07 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A087WT64_MCL1-09 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|B4DG83_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|B4DLY8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=717 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttggggatgg
cgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgt
tgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcc
tttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgt
aaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaag
gtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|B4DU51_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=840 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggctacggagatggaagccccggccgctgacgccatcatgtcgcccgaagagg
agctggacgggtacgagccggagcctctcgggaagcggccggctgtcctgccgctgctggagttggtcggggaatctggt
aataacaccagtacggacgggtcactacccttgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtc
gctggagattatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcca
ccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatg
cttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgt
aacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaa
gctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggc
tgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgt
tgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|B4E3L8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=723 residues).
atggaagccccggccgctgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcg
gccggctgtcctgccgctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcactaccctcgacgc
cgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggcc
accggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttacgacgggttgg
ggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtga
aatcgttgtctcgagtgatgatccatgttttcagcgacagcgtaacaaactggggcaggattgtgactctcatttctttt
ggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgt
tctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacc
tagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
tag
>gnl|bcl2dbcds|C8YZ26_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Homo sapiens GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccgcccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
agactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccaagtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaaaaagatag
>gnl|bcl2dbcds|A0A4W5KYB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=765 residues).
atgtaccacgttccacatacggttgacaaacacaaatgctggacgtgtaagctcgaaatcgacagctttgtggagaacga
taccctactgggtgagcacatctaccacgtatacaacacaggcggacactgcaggtacctcgcggacaggtacaccaatc
gagaagaggagataatgctcatactggggaaggaacggtacaggaagggaacagtcgcgttccctgaaaccatggaaacc
tgtgatgctctggacacagacaccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtg
gaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggta
tgatcaacacactctacatggatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagac
gggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggag
agacaactgtgtggaggcggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacaca
actcctggaacggtttcgtggagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtc
ggattggctggtattggggcagcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=879 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcaggaattcagcagattag
>gnl|bcl2dbcds|A0A4W5LP06_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=1050 residues).
atgagtctgtcggttacacgagccacaactacgatgtggcattatcaaaatggagtcttcggaccttcgtactctgctgg
tgctagccctttgtgctatttcgcgactggggccgtatgtcctggggcgtcaccgaagtcaaaagtggatactgacttgg
gtaatgggactggcgacactccaccacgacccacgacgttaggagtgaatggcgtgaaaagcaacgtcctgggtaatcat
ttgtcagacctaagcaacaatgacgactctggcgattctttgccatgcactccagagatggcgtcagaatgtgggcctga
actatcgaattgtccatcggccgatgaagtattggaacatgataccagacaagtaattgaagacttattgggggactaca
caggactgtctcaacctcgttggaaggaaagcaaggctcttacgacgatgaagcgagtggtgaaggatgtaatagcaaag
caccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagcttcatcaaatctgt
ggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcattcggagcagtggtgagcc
agcaactgaaggagaggagcaggggacactgcattgggttggtgggccaagagatcgccacatacctcctctctgaccaa
agggactggctagtcaaaaacaatgcttggaatggttttgtagacttctttcatgtgcaagatccagagtcctctgtaag
gaacaccctcctagcctttgctggatttgctgggattggggcaacactcgccatgttgatcagatcccaccatccctctc
tgctgtcctccgcagtttttgagctttctccattgataatgaatgaagaacggcggcttatttcatctgaggcacctctt
tcagatagttttccagatggaaatgcaatatatagatctgtactcgattctctattctacaaggcaaagggtcttggctg
ttgtaggtga
>gnl|bcl2dbcds|A0A4W5LZB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=585 residues).
atgaataacacccatggagttgcatgtacgcacacaatgaagatatcacatcaggaaacctgtgatgctctggacacaga
caccaggcaacttatgacatgtgtcctaggacaatatacgggacttctgaaacgtgggtggaacgaaagcaaagctctgt
caacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggtatgatcaacacactctacatg
gatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgagacgggaccgtcaactggggccg
cgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgaggggagagacaactgtgtggaggcgg
tgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacacaactcctggaacggtttcgtg
gagttcttttcagtagcagaaacggagtccagatcgaggaacatcatcgcgacccttgtcggattggctggtattggggc
agcaatgaccttgttagctatgtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=606 residues).
gcagataaagtcacagttaaccgagcccgggcaggtgacaatggaaacagccaagcggaaaacatatcacatcaggaaac
ctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaatatacgggacttctgaaacgtgggt
ggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggagaaacacagatacacatacaatggt
atgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtacactagcccatatcatctttcgaga
cgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtgtcagtacttgaaagacgagggga
gagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcaccacaaggactggctagtcaaacac
aactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcgaggaacatcatcgcgacccttgt
cggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5Q5Q2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=789 residues).
atggaaacagccaagcggaaaacgctcctgagtctcttcgacggcacaggcagtatttgcaagcccttcgttgaagctgg
ctggaccgtgcgaagactagacatcgacagtcgacacggtgctgatatcgttgtggacatacgaaagtgggaccctttgg
actctgtcagtgctagagctcggatgaataacacccatggagttgcatgtgtatataagtgccaacgctgtaaagggatc
ctgagtagttgtgagcttgaaacctgtgatgctctggacacagacaccaggcaacttattaaatgtgtcctaggacaata
tacgggacttctgaaacgtgggtggaacgaaagcaaagctctgtcaacaatgagtagagtcgttggtcaattactggaga
aacacagatacacatacaatggtatgatcaacacactctacatgtatgacagaggggatgatgtgaggtttgtcagtaca
ctagcccatatcatctttcgagacgggaccgtcaactggggccgcgttgccagcctgacatcatttggggctgcggtgtg
tcagtacttgaaagacgaggggagagacaactgtgtggagttggtgggagaggagatatcagcatacctggtcactcacc
acaaggactggctagtcaaacacaactcctggaacggtttcgtggagttcttttcagtagcagaaccggagtccagatcg
aggaacatcatcgcgacccttgtcggattggctggtattggggcagcaatgaccttgttagttatgtga
>gnl|bcl2dbcds|A0A4W5QGT1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Hucho hucho GN=MCL-1 (length=852 residues).
atgagtctgtcgaagtccattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtaccttgctaa
tgatgctagccctttgtgctatttcaacggggctggggcgtcaccgacgtctaaagtggacttgggaaatgggactggcg
atactccaccacgacccacgacgttaggagtgagtgtcgtgaaaagcaacgtcctcgataatcatttgtcagaccgaagc
aacaatgacgactctgacgattctttgccgtgcactccccagatggcgtcagaatgtgggcctgagctatcgaattgtcc
atcgggcgatgaagtattggaacatgataccagacaactaattgaacattttttgagggactacacaggactgtctcagc
ctcgttggaagcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatacgcattc
aatggtatgatcgccaaacttgacttggatgatcgatgcgatgacatgcgcgtcatcaattctgtggccaagaccatgtt
cggtgatagggtcacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctgaaggaga
atggcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtc
aaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaacaccctcctagc
ctttgctggagttgctgggattggggcaacacttgccatgttgatcaggtga
>gnl|bcl2dbcds|A0A287DCH9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=1002 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcggcgc
caccccgccgggagcgcagctcttagccgccgagaaggaggccgcggcccggcgagaggcagggggaggggaagccgccc
agccgcccagcgcccgcagggtcgcgcggccggtgcccattggcgccgaggtccccgacgtcaccgcgaccccggcgagg
cgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgtcgcccgaaga
ggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgttggagaggccg
ccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagctgtaccggcag
tcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtgggtcgggggc
cgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggccttccaaggca
tgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacgga
gtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaaga
aagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtcaaacaaagag
gctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttcgcaggt
gttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A287DCH9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=MCL-1 (length=852 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgaggtccccgacgtcaccgcgac
cccggcgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatggaagcccccgccgccgccatgt
cgcccgaagaggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcctgcccttgctggagctcgtt
ggagaggccgccaagagtcccggcgcggacgggtcgctgccctcgacgccgccgcccgcggaggaggaggacgacgagct
gtaccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaaggacgcgaagccgctgcgtg
ggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagacggcc
ttccaaggcatgcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgtttt
cagtgacggagtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagca
taaaccaagaaagctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtc
aaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggc
tttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A3Q3B4P5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=819 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagtgtttgttggccttga
>gnl|bcl2dbcds|A0A3Q3B4P5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=MCL-1 (length=1047 residues).
atgttcccgaagccgaaaccgagctatattttttttcttcaaaatggagtcgtggacggattacacagagacacctctcc
ccaggtctccattggcgcctcgctaggctccgagaacggcagcgtggcgtcgtgcaattcctccaaacgaccgaaggacc
tggtgatgcctccgctgaagggataccaagacaagcgctttcaggagctcggcgacgaccacggctcgttaccgagcacg
ccggaggtggacggtaaccccgacgtccccggcggtgctgaggacgaagtgctggagaacgacacgaagcatctgatcag
ccgtttcctacaagagtttactggactatcaaaacgtcagtggtcagagagtaaggagttatcgacgatgaacagagtgg
tggaggaccttttgacaaaacacagattcgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgaggac
atgacgtttgtaacaaaaacagcccggagccttttcgcagacgggatcaccaactggggtcggatctccagcctggtggc
ctttggcgcagtggtggcggtgcacctgaaggagaaggggagggaggaatgcgtggagctggtgggccaggagatttcca
catacctgctgtctgagcagaaagactggctgctcaaaaataactcctggagtggctttgtggagttctttcgaataaca
gaccctgaatctacagtcaggaacacactgatggctgtagccggatttgctgggcttggggcaacactggccttattgat
aagcacttggtcagcaaaatgtgagcacaggcctctggaaaatgaatcatgtgtatctctggcgcctgggatcagaagtt
gctacctaagcacaaccacacatttaagttgggcagcagaaatctgggctgcaggtgtggatcaacaggatgagtcaaac
cttaatattgggtggatcctgcctcttcacaatgactgctggagacaggcaccagctccctgcgtctctgcagggaaaag
ggagtaa
>gnl|bcl2dbcds|A0A3Q3GP42_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Labrus bergylta GN=MCL-1 (length=825 residues).
atggatatcattaatatgaagcgggcggcggtcagcgtatctgccggagtcatgagctttatgatgccacaaaatggagt
cgggaagggacagatgcactacggcccggaagcgtcctctccacaaatagcgatgggatcctctttagcctcacaaaatg
ggaatgtcgggtcgaatgaaaccaccaagcggcccaaggctctggttgttaactcgggaaacgacgatatcgaagacggc
tcgctgccgtgcaccccggagccggacagtgaaaccgaagtctccagctgtcccactgggggcgaagtcctggagagcga
caccaggcaactcatcagcgccttcctcagagagcatactgggctttcaaagcctggttggaatgagagtagtgcactat
cgacgatgaaaagagtcgtggaggacgtgctggcgaaacacagatacgcgtataatggtatgatcaacaaactgtcactg
gaagacagaggggacgatgcaagttttgtcagcgctgtggcaaagagcctttttgcggatggaacaacaaactggggcag
gatcgccagcctggtcgcttttggagcggctgtgtcacaatacctgaaggagaatggcagggggcactgtgtggagctgg
tggggcaggagatctccacgtacctgctgtctgaccaccgggactggctggtcaaaaacaacgcctgggacggctttgtc
gagttctttcgagtagcagacccagagtccacagtgaggacaacactcatggcttttgctgggttcgcaggaattggggc
cacgttggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=888 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcaggtctttctgtgaatttgggtcagggctgaagtctttcatcctccccc
atggatga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=918 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagatcctcccgttgtcttgggttacaggacaaacacaacactcatcgag
gtcttaggaggaaatggagtagagcctctccatggtga
>gnl|bcl2dbcds|A0A4W6CDF4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lates calcarifer GN=MCL-1 (length=978 residues).
atgaatatcattccaacaacgaagcggaccgccctcatgaactgttttattcttcctcaaaatggagtcgcggagggact
gcactacagctcaggagattcctcaccacagatcgccatgggctcaactatagactctcgcaacgggaatgttgggtccc
caaagcggcccaagaacttggaagtcagctcaacaaatgggtatccagcaaaaagccgtcttgaggacagcgacgtcgac
gacggctctttgccgtgtaccccggagctgcagtcggacagtgaaatcgatgtctccagttgtccagcaggggacgaagt
gttggagaatgataccaggcaactgattagccagttcatgagagactttactggactttcgaaaccacggtggaataaaa
gcaaagcactaccaacaatgaaaagagttgtggacggcgttttggaaaaacacagatacgcatacaacggtatgatcaac
aaactgtcgttggatgacagaggggatgatgtgtcgtttgtcagcgtagtagcaaagaacctgttcggagacggcaccac
aaactggggtcgtattgccagcctggtggccttcggcgcagtggtgtgtcagcacctaaaggagaggggcagggtggact
gtgtggatcttgtggggcaggagatcgccacatatctgctgtcagaccagcgggactggcttgtgaaaaacaactcctgg
gatggctttgtggagttctttcacgtatcagacccagaatcaacagtgaggaacacgctcattggccttgctggatttgc
tggtatcggggccacactggctttgttgatcagcaattacccagcagcaagagtgtttgtatgcaaggccaaggcaggaa
gggagagctgcatttttccatgtcttgcagtcatgaagcccatttccatagagcccattgacaagcctcggatcatttgt
atggattcaactttgtga
>gnl|bcl2dbcds|A0A8C5WWU9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Laticauda laticaudata GN=MCL-1 (length=978 residues).
atgttcaacaagaagacgatggttctctattgcggcggctcccccggattggcaccagccgcccctcagtcccccggcgg
cggcggcggcggcggcagcgagggcggcctggctctccttcccggcggcgttcgaggaggcctgggcgggggtctgtgct
ggcctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggtcgcgcgcagggcccctctcgctgattggg
cccccggacgcggacgcgcgcgcgctgattggccaggcggcactgccgccggcgacccccgaagaggagctggatggctg
cgagcccgaggcggagaccggagtggagccttccgtcgcctcttcctccgccccgccgtcgcccggggacccgctgcgcc
aggtgacgctgcagctggtggcctcatacctgcgagaggcggccgaccaggagccctccaagcaggacggctgcggcggc
gggaagttcctgcagggcctgctgggccgcttcggtccctgccccgccgaggcggagacggcggctcgggccctggagac
gttgcggagggtctgtgacgacatcatggagaagcaccagctggccttccaaggaatgctgaggaaagtgcagattgaca
aagcggatgacttgaagcttatgtcggaagttgcaacgcaacttttcaacgatggcataacaaactgggggcgaattgtg
actctcatttcttttggtgcctttgttgccaaacacttgaagagcataaatcaggaaagcggcatcagcactttggcgga
gattatcacggaggtgctggtgacagagaagagagagtggctgctgcatcacaacgcctgggagggctttgttaaattct
tccatgtagaggacctggaaggcagcatcagaaacattctggtggcttttgcaagcgtggctggcctaggagcgagcttg
gcttacttgatccggtga
>gnl|bcl2dbcds|H3AR18_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=591 residues).
atggaattaccgggggacgggtgcccgcaggacggggacatggcggagtttcgcaaggagacgctgaagctgttgcggag
ttacttgtgcgaggtggcgggctgcgagagcacggagacggccttcaggttcggtctagatcagtggagcggtggcgaga
agccgctggacaccctccggcgggtcggggatagcatcatagacaaacaccgcatcgcctttaatggaatgcaacaaaag
ctaaacatccataaggaggacgacctccacattatacccgaaattggtaaccagatctttaaggacggtgcaacaaactg
gggtcgcattgttagtcttattgcttttggagcagtcgttgccaagaagctcaaaaagatgaacctggaagacagcattg
aacagttggcagtgtcgatcacagactttctggtgcagaataagggagactggatcctcaagaaccaaggctggaaagga
tttgttgactttttccatgtagaagatgcagagggtacaatcaaaaatgtattgatgacatttgcgggcgttgctggact
gggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|H3AR18_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Latimeria chalumnae GN=MCL-1 (length=624 residues).
ggttacaacgccgacggctccgtgccgccttcgccgcccaccccgtcgacccccgaggacggggacggggacatggcgga
gtttcgcaaggagacgctgaagctgttgcggagttacttgtgcgaggtggcgggctgcgagagcacggagacggccttca
ggttcggtctagatcagtggagcggtggcgagaagccgctggacaccctccggcgggtcggggatagcatcatagacaaa
caccgcatcgcctttaatggaatgcaacaaaagctaaacatccataaggaggacgacctccacattatacccgaaattgg
taaccagatctttaaggacggtgcaacaaactggggtcgcattgttagtcttattgcttttggagcagtcgttgccaaga
agctcaaaaagatgaacctggaagacagcattgaacagttggcagtgtcgatcacagactttctggtgcagaataaggga
gactggatcctcaagaaccaaggctggaaaggatttgttgactttttccatgtagaagatgcagagggtacaatcaaaaa
tgtattgatgacatttgcgggcgttgctggactgggtgcaagtctggtctacttgatgagatga
>gnl|bcl2dbcds|W5MMB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=MCL-1 (length=882 residues).
atgagcctctcctcgctgaagcgcacctcggccagcgccgtgatacagctctattgccccaacgccaccaccattcaccc
cggcctcgccagcctggggccctgtccgggcgggtccgccgcccgcacggctgtcctggaccccatgctcaaggcggact
acgccgaggacgaactggacaactactcggcggagcccgtggcgaccagcgcctggatccccaagtcgccgcggtcgctg
cccgcggggctgaagctgggcggccacttcccggagagcggccacgccgacgggtccctgccctccaccccggacacccc
gctggactgcggcagcgtccccgagttcctctccgaggcccacgggcagctgaacgcggagacccgggagttaatcggga
cctttttgcagatgtacacggggttgccgcaccgccggagccgaggcaaggccctggagaccctgaagcgcgtcgtggac
agtgtggtggcgaagcatcagatcgcctaccacggcatgatcgcgaagctggagctggagaacaagggtgaggacgtgag
cttcgtgacgggcgtggccaaaagcttgttcagcgacgggaagaccaactggggccgcatcgccagcctggtgtcgttcg
gcgcggtggtggccaagcagatgaaggactcgggccgggagagctgcgtggaggcggtgggccaggcgatctccaactac
ctactgcaggaccagcgcgagtggcttctgaacaaccgaggctgggacggcttcgtggagttcttccgcgtggaggaccc
cgagtcgacgatcaggaacgccctgatggcgtttgccggggtggcggggctgggcgcggggctggccctgctgatcagat
ga
>gnl|bcl2dbcds|A0A8C5PJK5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Leptobrachium leishanense GN=MCL-1 (length=1431 residues).
atgtgcacgtgcacgctaatggagaggggttcaaggtgggcagggccagaccagaggggctggcttaagcgcagggccgc
catgagagcgaagccaggcaccctccttcactcgctacgagaaggctatggatggattcccggccctgtgcttccccctg
atcacttcaataaagtttataaaaggcaaccaaacgccgtcttacggctgtctcaccaatgtcgtgaaagggcagctttt
acagcagcagagagagacgccgcacgctgcctctcgctttgcggccactccctcgcacgcccggccactcccccgcgctt
aaaactggttggcttgcagtttcccgcgctgtctgctcagatcattatcaagatggaggcaggaaaggtggctgttgcga
tggcactgagagaaaaagaggtgcaggaagatgccgcaggctacggggacacctgccgagccccggagagcatcatgcag
gcctcaaatgccgagaagaaggagagagaggaccacggggacacctaccaggcccaggagaactccatgcaatcctcaga
ggccgagagagagggtgaggagggccctgaaaccaccagagacacctgtcagacccaagagaaccccatgcaaccctcag
aggccgagagagaggagggccctgaaagcacctgtcaggcccagaagtgcttcttggagacctcagaggccctggaggag
agacaaggtgaggagagccctgaagacagcacagacacctgtcagtccctgcagaacttcttggagtcttcagaggccga
acaggaggaggaggatagagatgacaaaaagatggaggctgatgtcccggggcccagtcctccgcctgaggatccgcagt
gcagacaggacgagctcttcctttactcccgcctgctgctcctaaccttcttcagggagtatgccggtggaccagacccg
ggcccagtgagggctctcatccagctggccatgcccaacacggccctgcagaccctactgagggtggcgagagagaccat
agagaggaaccacgcatgcttccagaacaccctgaacaggctttgcattgagaggccagaacacctgcagaagctctccc
tggtaaccttcgcactgttcagtgatggtgccatcaactggggcagaatcgccaccctgttcagcttcaccgccctcgtg
gcccgacacctgaagaacctagggatgaatgacagcatctttacgctcgcagacggcgtcgcccgattcctcaccatcac
caagagaagctggttccaggaacatcaaggctgggacggttttgtggagttcttccttgtcagtcgctggcaaaccggca
tcaggattgccctgttggcactcgctatctttgcaggaatcgccacaagcctcctgtaccttatcatgtga
>gnl|bcl2dbcds|A0A8C5QRL7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Leptobrachium leishanense GN=MCL-1 (length=603 residues).
atgaatggggccgggcattttgtggtggccgggctgttttgtgatggcagagggacatgttgtttgagtggagctttatt
gcgtttctcctggatattccccatgttttgcagtatttgccccccctctcgtttccctggtggtctctcgtgccgtcgcg
tttcgctcaggcttgcacattacatgaagctgctgtacaagggccggcggtgtctgtgccgaccagctccgctacatggc
atgctgacgaagctgtctatccagcaagcggaggatctccagaagctctctgaggtgccttccttggtcttcaacgatgg
gatcacaaattggggcaggattgtgacattaattagctttggcgctttccttgcaaaacatttgcagagcataaaactgg
aggactgtatcgttccactggcagataatttcacggattaccttatgaccagcaaacgggaatggattatgcaacaaaaa
agctgggatggttttgtagagtttttccacgttgaggactatgaaagcggactcagaactgttctgatgacctttgccgg
agttgctggaatcggagcaagtcttgcctatatgatccggtga
>gnl|bcl2dbcds|G3T756_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Loxodonta africana GN=MCL-1 (length=1026 residues).
atgttcggcttcaagagaaacgcagtaatcggactcaacctttactgtgggggggccggcttgggggccggcggctgcgc
cacccctccgggagggcgacttccagctcctggaaaggaggccacggcccggcaagaggtagggggaggggacgccggcg
cgagccccccggccgctgtcgctccggacggccggagggtcgtgcggccggcgcccattggcgccgagggccccgacgtc
actgcgattcccgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtggagatggaggctctagccgc
cgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagccgctcgggaagcggccggctgtttttcccc
ggctggggctggtcggggaggccagtaatggccccggtaccgacgggtcactaccctcgacgccgcccctagcagaggag
gaggaggacgagttgtaccggcagtcgctagagattatctctcggtaccttcaggagcaggcaaccggcgccaaggacac
caagccaatgggcgggtctggggcggccagcaggaaggcgttagagaccctccggcgagtcgcggacggggtgcagcgca
accacgagacggccttccaaggaatgcttcggaaactggacatcaaaaacgaagatgatgtcaaatctttatctcgagta
atggcccatgttttcagtgacgggataacaaactggggcagaattgtgactctcatatcttttggtgcctttgtggccaa
acacttgaagagcgtaaaccaagaaagccgcatcgaaccattagcagaaagtatcacagatgttctcgtaaggacgaaaa
gggactggttagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaga
aatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G3TVG9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Loxodonta africana GN=MCL-1 (length=723 residues).
ggagcccagggccccagcgtcaccgcgacccctgcgaggcccatgctctttgcatccatcccctgcacgtcgccgcctga
ggaggcgaatgcctcagttgcggaggccatcatgtcagctgaagaggagctgggcaggtacaagctggagacgctgggga
agcggccagctgcccttcccctgctggtgcttgtgggggaagccagtaactgccctggtacgcacggggcacttccctca
acgcagcccccagcagaggaagaagaagacaagttgtacccgcaatcgctggatattatctttcggtaccttcacgagca
ggccatcggcgccacccagggccgccagctggaaggggtgagaaacctgccgcgggtcgcagacggtgtgcagcgcaacg
aggagacggtctcccaaggcatgcttcggaaaccggacttcaaaaacgaaaatgatgtgaaatctttgtctggagcgatg
gtccatgttttcagtggtggaataacaaaatggggcagaattgtgactatatcttttggtgcctttgtggtcaaacactt
cgggagcataaaccaagaagctgcagcagaatgtatcacagatgttctcctaaggaaacggtactgcttagacaaacgaa
ggggcggggatgggcttgtggagttcgtccacgtaaaggacccacagggcgactgtagaaatgtgcagctggcttttgca
ggt
>gnl|bcl2dbcds|A0A667GXX5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lynx canadensis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggccaggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccac
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A667GXX5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Lynx canadensis GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgctgtaatcggactcaacctctactgtgggggggccgggttggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgaccggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccacgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5W0Y7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1041 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacaccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccggca
cggtgattggcggaagcgccggcgcaagcccccgggccctcacgccagacgcccggagggtcgcgcggccgccgcccatt
ggcgcggaggtccccgacgtcaccgcgagccccgcgaggttctttgcgcccacccgccgcgcggggccgcttgaggagat
ggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggc
cggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcactaccctcgacgccg
ccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccac
cggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgacgggttgggg
atggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaa
tctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttgg
tgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttc
tcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggaccta
gaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagata
g
>gnl|bcl2dbcds|A0A2K5W0Y7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=591 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacaccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcagga
aggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactg
gggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcg
aaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5W0Y7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=804 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacaccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccggca
cggtgattggcggaagcgccggcgcaagcccccgggccctcacgccagacgcccggagggtcgcgcggccgccgcccatt
ggcgcggaggtccccgacgtcaccgcgagccccgcgaggttctttgcgcccacccgccgcgcggggccgcttgaggagat
ggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctctcgggaagcggc
cggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcactaccctcgacgccg
ccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggccac
cggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttacgacgggttgggg
atggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagaggacctagaaggtgg
catcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttact
gtaa
>gnl|bcl2dbcds|I7G687_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca fascicularis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcagcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgtttttagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F7HUE9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca mulatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcgtcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6ECQ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6ECQ5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacccgccgcgcggggcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6ECQ5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Macaca nemestrina GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggcgaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5XSB2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K5XSB2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K5XSB2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A3Q3S6A5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=891 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagcagaaataataaaatgctgacttctcaaagtgccatcagcgcgcctg
tctcagcatag
>gnl|bcl2dbcds|A0A3Q3S6A5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mastacembelus armatus GN=MCL-1 (length=852 residues).
atgagcttcattccgtcgacgagacgagccgccctcatacccggagtcatgatcgtccttccccaagatggagtcctgga
gggacccgtgcactacgactccagagatccctccacacagtttaccttggactctcgcaacgggaacggcgggacggcta
atccgaaaagacccaagaacctggaagtcagctccacaaacgggtacgcgacaaaatccatcgtggccgacacggacgac
atagaggacgggtcgttaccctgcaccccggagctgcagtcggacagcgaagcccccagctgcccggccggggacgaggt
cctggagaacgacaccaggcagctcatctgtcaatacctgaaagacgtttctggactttctaaaccccggtggcacgact
ccaaagcactgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagatacacatacaatggtatgatcaac
aaactgtccttggacgacagaggtgatgatgtgagattcgtcagcactgtagccaagagcctgtttgctgatgggaccac
caactggggtcggatcgccagcctggtggccttcggggccgtggtgtgtcagtacctgaaggagaaaggcaggggggact
gtgtggagctggtggggcaggagatctccacctacctgctgtcagaccagcgggactggctggtcaaaaacaactcctgg
gatggctttgtagagttttttcgagtagcagacccagagtccacggtgaggcacacactgatggctgttgctggtgttgc
tggtcttggggcaactctggccctgttgatcagttactgtggtgtaatgtga
>gnl|bcl2dbcds|A0A3P9BVM3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Maylandia zebra GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgtaccctaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatctggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccagagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcttttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaattacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|G1MPY7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Meleagris gallopavo GN=MCL-1 (length=519 residues).
atggaggtggggtccctgctctgctcattctgtggcagggcctgcagcagcagctgctctgtcacagctttcagacccca
ggtacagaggctgtgtcctctcactggtggcttggcatggctcagcccgtctctaagctggaatctcttttcaggaatgc
ttcggaagctggaaatcaaaaaagaagaagatctgcaggcggtgtgtgaggtggctgctcacgttttcagtgatggagta
acaaactggggccgagttgtcacactcatctcatttggtgccttcgttgcaaaacacctgaaaagcatcaaccaagagaa
atgcatcagctcgctggcggggatcatcacagacgctttggtctcatccaagcgcgagtggctgatgagccagggaggct
gggagggctttgtcgacttcttccgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgcaggagtg
gccggcctgggggcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccactgcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacccgccgcgcggtgcc
gcctgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccggcacggaagggtcacta
ccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8B7GKA0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtggaggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccatcagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaatcaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagattggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C5VC33_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Microcebus murinus GN=MCL-1 (length=426 residues).
ctctgtgtcttatatctcagttgtgggaaaaaggatcccatgtgtttcttcctatgtctggttagaaacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactctaatttcttttggtg
cctttgtggccaaacacctgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctt
gtaaggacaaaacgagattggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctcga
aggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtagcagctggtttggcatatctaatagatagcc
ttgtatgtgcagtaatgggcttctaa
>gnl|bcl2dbcds|A0A3Q3VP02_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mola mola GN=MCL-1 (length=789 residues).
atgaacgtgttgtttcaaaatggagtcgtgtcgggaccgacgcgttcctcgcaaatcgggatgggctcctgtctagactc
tcacaacggtaatgtcgctttaaacgatacctccaaacggcctaatttactagtagtgaacccaacgaaggaatatatgg
gaaaacccatccgaaaagacagcaccgacaccgacgacgacggttcgctgccgtacacgccggatatgtccccggacagt
gaactcaacgtctccggttgtttggcgggggatgaactgttggagaaggacacgaggcagctcattagccgcgtcttgat
ggaactttctggacacggaagagcacgatggactgaaagcagaacactatcaacgatgaaaagagtcgtggccgagcttt
tggaaaaacacagatacgtatacaatggtatgacaaaaagactgtcattggctgacacacaggacaatgtgagttttgtc
agcactgtatccagagatctgttttcagatggagcaacgaactggggccgtattgccagcctggttgcctttggggtcgt
ggtgtcccagtgcctgaaggagaacggcaagagtgaccgtgtggagctggtggctcatgagatctccacatacctgttga
cagaccagcgggactggatgtgtgtgggcggtgatggctttgtcgagttctttcgagtagcagacccagaatccacggtg
aggaacgcgctcatgaccattgctggagttgctggtattggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A5F8GAQ2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1191 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctggaaaggcctc
cttgctcaagacacggaagaagccacccgaaccggcgatccctgcgccccctcctcggcatacctcctcctctgcgcaga
acccttgttctggtggtgccagctcacagcatcgggctgtcatgttccggataagcccaggaatgtgcttactgaggaga
gaaaatgggctgcctcgctgcaacgttctcacaacaaattctccacttcaatgataactcatggactctag
>gnl|bcl2dbcds|A0A5F8GAQ2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1002 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctggtcagggaag
gagagagtggatccaagaggccttgtctcaggaggaaactga
>gnl|bcl2dbcds|A0A5F8GAQ2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodelphis domestica GN=MCL-1 (length=1068 residues).
atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactgtggcggggcagggatgggcgccggcggcgg
cgccagcggtcccccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagagtactccgccgcagcgcg
atggaggggaagtggaaacagggacggcgggggcagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtc
tcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggaggcccccgacgtcaccaccgatccgatgccgag
cctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggccgatggggctgcggacgtcccaatgtgccctgagg
aggaactggacggttacgagcccgagcctcccgggaagcggccctcccgcctggctgtgctggaaatagcccgggaaggt
ggggacagcccgaacggctctttgccttcgacgccgcccccagctgaggaggatgaagaagaggatgaactatacgggca
gtccttggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggaggccaagcccctacgcagcggcaagg
ccttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaaggcatgcttcggaaattg
gatatcaaaaacgaagaggatattaaagctgtgtctcgagtggcgacccatgttttcagtgacggtataacaaactgggg
caggattgtgactctcatttctttcggtgcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcatagacc
cgctagcagaaagcataacagatgttctggtcaagacaaaacgggactggctgattaagcaaaagggctgggagggattt
gtggaattctttcatgtacaggacctagaaggtggcatcagaaatgtgctgctcgcctttgccggtgttgctggagtagg
agctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4V5P8C2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodon monoceros GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtagggggaggggaag
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggtctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggccagtaacagcccgggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgccagccggaaagcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A4V5P8C2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Monodon monoceros GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgcca
gccggaaagcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
>gnl|bcl2dbcds|A0A8C6E5E6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Moschus moschiferus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccggactaggacagggcagcggcgc
ctcctctccgggggggcggcttttggttgcggggaaggaggccgcggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgggcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctcccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccggcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctccg
ggaacaggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
gccgagttggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgtgtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtcctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C6E5E6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Moschus moschiferus GN=MCL-1 (length=591 residues).
atgttcggcctcaagagaaacgcagtaatcggactgaacctctactgtgggggagccggactaggacagggcagcggcgc
ctcctctccgggggggcggcttttggcaaccggcgccaaggacgcgaagcccctgggcgggtctggggccaccagccgga
aggcgttggagaccctgcgccgagttggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaa
ctggacatcaaaaacgaagacgatgtcaaatctttgtctcgtgtgatggttcatgttttcagtgacggagtaacaaactg
gggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcg
aaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatggg
tttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtcctgctggcttttgcaggtgttgccggagt
aggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=954 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggc
ctccatggttaaaggttcagccccacttcacagtgacatgttcatataaaggaagccaatcacccaactgctga
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=996 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
atgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
ggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=933 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
ttgtacttctaattcagttggataatcttcagagcagtggattcaaaccgtga
>gnl|bcl2dbcds|M3XZZ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mustela putorius furo GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcaccggggg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacccaccgcgcgtcgcc
gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacgagccggaacctt
tggggaagaggcctgctgtcctgcctttgctggagttggtgggggaggccagcagtggcccctgcacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtctctggagattatttctcggtacctgcg
ggagcaggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtgcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|G1PZ39_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=795 residues).
gccccgccctctcccattagcggccgagggccccgacgtcatcgggacccttcgcgcggcggctgtttgcgccccttggc
tgtgcggggctgcccgcggagatggaaagccgcggccgccgacgccatcatgtcgccggaagaggagctggacgggtacg
agccggagcctctcgggaagcggccggccgtcctgcccttggtgcagctggtcggggaggccagcggcggccccggcgcg
gggggctcgctgccctccacgccgccccccgcggaggaggaggaggacgagctgttccggcagtcgctggagatcatctc
tcggtaccgggagcaggcgaccggcgccaaggacgccaagcccctgggcgggcccgcggcctccagccggaaggcgctgg
agaccctgcggcgggtcggggacggcgtgcagcggaaccacgagatggccttccaaggtgagcgggggccgcgcgccctc
tgtcttgtccgcgatcgctgggctcccgtgggtggaaaccgagacgagcccgggctggaagggctctccgcccgtttccg
aaaccagcatattctggccatgagtcattgtttccgcccacccgattccttgggaaccgctctccgctcaaaggccggaa
aggtgtgggagacctccaacacttgccatggcttcaaggatgggtttgtggaattcttccatgtagaggacctagaaggc
ggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1QAV8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myotis lucifugus GN=MCL-1 (length=975 residues).
atgtttggccccaaaagaaatgcattcatcggactcaacctccactgcgggggggcagttgggggcctgtggcggcagcg
aagcctacatctccttcaggaaggaggtccctgcccccaagagtcaggggcggggagggaaacgggcacggtgattggct
ggagcgctggcgcgagcccccaagccactctcgcgagggatcctgggagggtcgctcgcccctcgcccatgggcacggag
ggtcccgatggcaccgcggcccctgccaggtggctgttctcgcccatcagccggaattgccctgaagagctgggagctct
ggcagccgacgccatcatgtcgcccggagaggagctgggcaggtatgagccggagccgaagcagccggctgtcctgccct
tgctccagctggtcggggaggccagcgaaggccccgcaggtggctcactgccctcgaccccgccccctgctgaggaggag
gaggaattgtcactgctggagatgatccctcagcaccttagggaacgggctggcgccagggaccaaagccagggcccgcg
ggtcggcggggtgcagcggcgtgcagcagggtgcagcggggtgcggcaggagactgccttcctaggtatgcttgaactgg
acaccgaaaacgaagacaacgtcaaatcttcgtctcaagcgatggttcatgcttttagggacggagtgacaaacggcagg
attgtgactcatttcttttggtgcctttgtagccacttgaagagcataaaccaagaaagctgcattgaaccgttagcaga
agacatcacagatgttctcgtagggacagaacgaggctggctagtcaaacagagaggctgggatgggtttgtggaattct
tccaggtggaggacctagaaggcggcgtcagaaatgtgctgctggcttttgcaggtgctggagtaggagctggtttgcca
tatctaataaggtag
>gnl|bcl2dbcds|A0A667YZT5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myripristis murdjan GN=MCL-1 (length=840 residues).
atgaacatcgtttcgaagcgggcaaccattggagcaattggaagttgttttatttttcctcaaaatggagtcgtcgaggg
acaaatgtactacggctctggagattcctcccctcagatagcaatggcctccaccctggaaaacgggaatgccgtctcca
gcgacacgccgaagcggccgaaaaacctaggagttaacgggtttacagcgaaaaacagccgggacgatagcaccgacaac
gacgacgggtctttgccgtgcacgccggagctgcagtcggacagcgaggccgacgtgtccggcagcccggcgggggaggc
ggtggtggacaatgacacaaggcatctggtggagactttcttaagagactatagtgggctttccaggccgcggtggaggg
aggacaaggcactagaaaccatgaaaagagtcgtggaggatgttcttgagaaacaccgatacgcttacaatggtatggtg
aggaaagtcgcgctggacgagaggggagacgacatgagtttcgtcacgtccgtggccaagagcctcttcggggacggaac
caccaactgggggcgcatcgccagcctggtggccttcggggccgttgtgtgtcagcacctacgggaaaaaggcagggatc
actgcgtgagctcagtgagccgagaaatctctacatacctgctgtcggatcaacgggagtggctgatcaggaacaattca
tgggatggttttgtggagttctttcgagtagcagacccagaatccacggtgaggaacacactcatggcctttgctggatt
tgctggcatcggggcaacgctggccctgctgatcaggtga
>gnl|bcl2dbcds|A0A667YZT5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Myripristis murdjan GN=MCL-1 (length=843 residues).
atgaacatcgtttcgaagcgggcaaccattggagcaattggaagttgttttatttttcctcaaaatggagtcgtcgaggg
acaaatgtactacggctctggagattcctcccctcagatagcaatggcctccaccctggaaaacgggaatgccgtctcca
gcgacacgccgaagcggccgaaaaacctaggagttaacgggtttacagcgaaaaacagccgggacgatagcaccgacaac
gacgacgggtctttgccgtgcacgccggagctgcagtcggacagcgaggccgacgtgtccggcagcccggcgggggaggc
ggtggtggacaatgacacaaggcatctggtggagactttcttaagagactatagtgggctttccaggccgcggtggaggg
aggacaaggcactagaaaccatgaaaagagtcgtggaggatgttcttgagaaacaccgatacgcttacaatggtatggtg
aggaaagtcgcgctggacgagaggggagacgacatgagtttcgtcacgtccgtggccaagagcctcttcggggacggaac
caccaactgggggcgcatcgccagcctggtggccttcggggccgttgtgtgtcagcacctacgggaaaaaggcagggatc
actgcgtgagctcagtgagccgagaaatctctacatacctgctgtcggatcaacgggagtggctgatcaggaacaattca
tgggatggttttgtggagttctttcgagtagcagacccagaatccacggtgaggaacacactcatggcctttgctggatt
tgctggcatcggggcaacgctggccctgctgatcaggttctga
>gnl|bcl2dbcds|A0A8C6VLE3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Naja naja GN=MCL-1 (length=1080 residues).
cgtcaccgcgcgggggcatttataacgggcgctccgggcgcgcgccactcccctcctcagaaccaagccgtgctcgaggc
cggtcgccatgttcaacaagaagacgatggttctgtattgcggcggctccccggattggcaccggccgcccctcagtccc
ccggaggcggcggaggcggcagcggcgagggcggcctggctctccttcccggcggcgttcgaggaggcctgggcgggggg
ctctgctggcctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggccgcgcgcagggcccctctcgct
gattgggaccagggacgcggccgcgcgcgcactgattggtcaggcatcggcggcgacgacccccgaagaggagctggacg
gctgcgagcccgaggcggagaccggagcggagtcttccgccgcctcttcctcttcttcttcccccgccccgccgggagaa
gccggggacccgctgcgccaggtgacgctgcagctggtggcctcatacctgcgggaggcggccgaccaggagccccccaa
gcaggacgactgcggcggcggcgggaagttcctgcagggcctgctgggccgcttcgggccctgccccgccgaggcggaga
cggcggctcgggccctggagacgctgcggagggtctgcgacgacatcatggagaagcaccagctggccttccaaggaatg
ctgaggaaagtgcagatcgacaaagctgatgacttgaagcttatgtcggaagttgcaacacaagttttcaacgatggcat
aacaaactgggggcgaattgtgactctcatttcttttggtgcctttgttgccaaacacttgaagagcataaatcaggaaa
gcggcatcagcactttggcagagatcatcacggaggtgctggtgacagagaagagagagtggctgctgcatcacaatgcc
tggacgggctcgattaaattgcaaaaaagaaaaggaacattttgcatgccggaaaaaaagaaaacattcaaaaagaaaag
aaaagcctctggagatgattgggaccctccgaagagttaa
>gnl|bcl2dbcds|A0A8C6VLE3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Naja naja GN=MCL-1 (length=1080 residues).
cgtcaccgcgcgggggcatttataacgggcgctccgggcgcgcgccactcccctcctcagaaccaagccgtgctcgaggc
cggtcgccatgttcaacaagaagacgatggttctgtattgcggcggctccccggattggcaccggccgcccctcagtccc
ccggaggcggcggaggcggcagcggcgagggcggcctggctctccttcccggcggcgttcgaggaggcctgggcgggggg
ctctgctggcctcccgccggctgcgctgaggggcctcgagcgctgattggcggagggccgcgcgcagggcccctctcgct
gattgggaccagggacgcggccgcgcgcgcactgattggtcaggcatcggcggcgacgacccccgaagaggagctggacg
gctgcgagcccgaggcggagaccggagcggagtcttccgccgcctcttcctcttcttcttcccccgccccgccgggagaa
gccggggacccgctgcgccaggtgacgctgcagctggtggcctcatacctgcgggaggcggccgaccaggagccccccaa
gcaggacgactgcggcggcggcgggaagttcctgcagggcctgctgggccgcttcgggccctgccccgccgaggcggaga
cggcggctcgggccctggagacgctgcggagggtctgcgacgacatcatggagaagcaccagctggccttccaaggaatg
ctgaggaaagtgcagatcgacaaagctgatgacttgaagcttatgtcggaagttgcaacacaagttttcaacgatggcat
aacaaactgggggcgaattgtgactctcatttcttttggtgcctttgttgccaaacacttgaagagcataaatcaggaaa
gcggcatcagcactttggcagagatcatcacggaggtgctggtgacagagaagagagagtggctgctgcatcacaatgcc
tgggagggctttgttaaattcttccatgtagaggacctggagggcagcatcagaaacattctggtggcttttgcaagtgt
ggctggcctaggtgcgagcttggcttacttgatccggtga
>gnl|bcl2dbcds|A0A8C6QA84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nannospalax galili GN=MCL-1 (length=1023 residues).
atgtttggcctgagaaggaacgcggtaatcggcctcaacctgtactgcgggggcgccagcctcgcggcaggcggcagttc
tccggcgggagcgcgcctggtggccgaggaggccaaggcacggtgcgaggggggaggggaggccggcgcgggctcgggcg
gaagtgtgagcggccctgcagccctgctgccagacgcgcggagggtcgcgcggccgccgcccattggcgccgaagtcccc
gacgtcaccgcgacccccgagaagctgatgctcttcccagcgggtcgtgcgtcgccgcctgaggacatggccgcgccggc
cgccgccatcatgtctcctgaggaggagttggacggctacgaacccgagccgctcgggaagcggccggccgtgctacccc
tgcgggggctggtcggcgaggcggcgaagagctcgggcactgacggctcgctgccctccacgccgccgccggtcgaggag
gacgacgagctgtaccgccagtcgctggcgatcatctcccggtacctgcgcgagcaggccacaggcgccaaggacgcgaa
gcctctgggcggggcgggggcggcgggccggagggcgttggagacccttcggcgagtgggcgacggtgtgcagcgcaacc
acgaaacggccttccaaggcatgcttcggaaactggacattaaaaatgaagatgatgtcaaatctttgtctcgagtgatg
gtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactctgatttcttttggtgcctttgtggccaaaca
cttgaagagcataaaccaagaaagttgcatcgacccattagcagaaagtatcacagatgttcttgtaaggacaaaacgag
actggctagtcaaacaaaaaggctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaat
gtgctgctggcttttgcaggtgttgctggagtaggggctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6SVR4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neogobius melanostomus GN=MCL-1 (length=741 residues).
gtatgctacctgcaaaacggacaaaattcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggagtcacc
cacagccctgcaagtcaagaacgaccattcaagaaagcacaaaaacctacgggagggcgattacgaccacaactcggacg
gcggctcgctcccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggctactccgtggagaacgacacg
aggcagcttctcggcgactttttcgagctaatcacggggatttcgcagccgggttggctccagcgacccgctttaacgac
aatgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtaggctgaatttgccttcaaatccaa
actggggggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacggcaccaccaactggggtcggatc
gccagcctgatatccttcggggcggtggtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagtggc
tgaagaaatttcctcataccttctttcagaccaacgagactggctgatcaggaacaactcctgggatggttttgttgagt
tctttagagtagacgacccagaatcaaaagtgaggaacacacttatggctgtggccggactagcaggaatcggtgcaacc
ctggccatgttaatcaggtga
>gnl|bcl2dbcds|A0A8C6SVR4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neogobius melanostomus GN=MCL-1 (length=822 residues).
atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggagtcgtgga
ggcggagggagctatgactatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaacagcagagaccca
cagccctgcaagtcaagaacgaccattcaagaaagcacaaaaacctacgggagggcgattacgaccacaactcggacggc
ggctcgctcccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggctactccgtggagaacgacacgag
gcagcttctcggcgactttttcgagctaatcacggggatttcgcagccgggttggctccagcgacccgctttaacgacaa
tgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtaggtatgataaacaaactgtcagtgga
cgacagggggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacggcaccaccaactggggtcggat
cgccagcctgatatccttcggggcggtggtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagtgg
ctgaagaaatttcctcataccttctttcagaccaacgagactggctgatcaggaacaactcctgggatggttttgttgag
ttctttagagtagacgacccagaatcaaaagtgaggaacacacttatggctgtggccggactagcaggaatcggtgcaac
cctggccatgttaatcaggtga
>gnl|bcl2dbcds|A0A8C6SVR4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neogobius melanostomus GN=MCL-1 (length=819 residues).
atgctacctgcaaaacggacaaaattcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggagtcgtgga
ggcggagggagctatgactatggacgctcgcaacggcaacggctctctcagtcactgccacccgcaacagcagagaccca
cagccctgcaagtcaagaacgaccattcaagaaagcacaaaaacctacgggagggcgattacgaccacaactcggacggc
ggctcgctcccctgcacgcccgagttccagtcggacagtgaacaggagatgtccggctactccgtggagaacgacacgag
gcagcttctcggcgactttttcgagctaatcacggggatttcgcagccgggttggctccagcgacccgctttaacgacaa
tgaagagagtcgtggacaaccttttagagaaacacagaatcgcgtacaatggtaggctgaatttgccttcaaatccaaac
tggggggacgatgtaacgttcatgggcgacgtagccagaagtatattcgaagacggcaccaccaactggggtcggatcgc
cagcctgatatccttcggggcggtggtgtgccagtacctgaagtccaaaggaagggaaagctgcgtggagagagtggctg
aagaaatttcctcataccttctttcagaccaacgagactggctgatcaggaacaactcctgggatggttttgttgagttc
tttagagtagacgacccagaatcaaaagtgaggaacacacttatggctgtggccggactagcaggaatcggtgcaaccct
ggccatgttaatcaggtga
>gnl|bcl2dbcds|A0A3Q4HLQ8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neolamprologus brichardi GN=MCL-1 (length=819 residues).
atgaccaactatatgatgtcgaaaaggaaccagtgcaccttcatagactatcttattcctcaaaatggagtcctagaggg
accaatgcactatggatcgggaaattcctcaccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataccacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttcgcagcctcaacgaaaggaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtgttgt
cagctttgtggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactgcgtggcgctagttagcc
aagagatttctgcatacctgctgtctgagcagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A8C7BMW8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neovison vison GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggggg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagtaccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagctgccgacgccatcatgtcgcccgaagaggagctggatgggtacgagccggaacctt
tggggaagaggcctgctgtcctgcctttgctggagttggtgggggaggccagcagtggcccctgcacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtccctggagattatttctcggtacctgcg
ggagcaggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C7BMW8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Neovison vison GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggggg
cgcctcctcttcgggagggcggcttttggcaacgggcgccaaggacgcgaaaccactgggcgggcctggggctgccagcc
ggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=816 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=1053 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtcagtcctcacaccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I3GB35_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nomascus leucogenys GN=MCL-1 (length=444 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
catgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=822 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcaggtga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=873 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcagttgttgcaggcatgacaccagttttcagacagttccctcaataccttcatattga
>gnl|bcl2dbcds|A0A1A8A7I9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=MCL-1 (length=822 residues).
atgcttcaacggaaaacccccagctctgtctttggctgtcttttctctcaaaatggagtcgtggatggaccattacacta
cggaccgggagattcccctcctcacatcgcaactggcgccacgttagactctgctaatgggaacgtagagtccggtgacg
gccccaaacgcccgagcaacctggaagtgtctccgcacaatggatttgctgctaaacgcttcagccacgaggaggaggac
ggctctctgccgtgcaccccggagtttcacgcaggcagcgagaccgaggtccccagcggtcatgccggagatgaggcgct
ggcgaacgacaccagacaactaatcaaccgcttttttatggagtttactggacagttaaagcctcagtggcgcgatagca
gagagctatcgacaatgaaaagagtggtgaacgacattttggaaaaacacagatacgcttacaaaggtatggctgcgaaa
tgcacttccgatgacctgacgttcatcagcaaagtggcagaaaacatgttttcagacgggatcaccaactggggtcggat
cgtgagcctgctggccttcggggcggtggtggcccagtaccagaaggacaacgggaggcaaaacaacgtagagctagtca
gccatgaggtttcaacctacctgttgtctcaacagagagactttctgctcagaaacaactcatggcaaggctttgtggag
ttctttcgtgtaacagacccagagtcaacagtcaggaacacactgatggccatagctggggtagcaggcatgggggcgac
tctagccctgctgatcaggtga
>gnl|bcl2dbcds|A0A8C6YT47_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Nothoprocta perdicaria GN=MCL-1 (length=705 residues).
atgggggtcacagtggtgacaggcatccttggcagtgctcgaggggcagtggatgtatcggggcgggggcagagtgagac
cgacattgggggaccacagcagtgctatagggcccaacgccgccgggggcgggtgcaggcttggcggtgctataggggcc
atgcctataaggaccaacacggggggggggagggggcgggatcaggcccagctaagctcttctcgggccttctcagcggc
cccggccggcccggcggcgcgggccttatggagaaggcgctcgagacgctgcggagggtcggcgacggcgtcatgcgcaa
gcacgagctcgccttccaaggaatgctgcggaagctggaaatccagaaggaggaagacctgcagtcagtgtctgaggtgg
ctgtccatgttttcagtgatggagtaacaaactggggtagagttgtgacactcatctcatttggtgcctttgttgcaaaa
cacctgaagagcataaaccaggagaaatgcatcccttcgttagcagggatcatcacagatgctctcatctcatccaaacg
agagtggcttctgagccaaggaggctgggagggttttgttgacttctttcaagtagaggacctagaacgaagcatcagaa
atgtcctcgtggcttttgcggggtttgctggactgggagcaagcctggcgtacatgatccggtga
>gnl|bcl2dbcds|A0A8C7H1W6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=867 residues).
atgagtctgttgtcgtcgtcgattgcccgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagc
tgatgatgctagccctttgtactatatcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaa
atgggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttg
tcagaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactattggaaca
tgataccagacaactcattgatgatatgttgagggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatc
ttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaatggtatggtcgtcaaacttgac
ttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcacgaactgggg
tcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtggcaggggacactgcgttgatt
tggtgggccgagagattgccacatacctcctctctgaccaaagggactggctggtcaaaaacaatgcttggaatggattt
gtagagttttttcatgttcaagatcctgagtcctcggtaaggaacaccctcctagcctttgctggagttgctgggattgg
ggcaacacttgccatgttgatcagaaagtgccctgctctaccccaggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A8C7H1W6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=825 residues).
atgagtctgttgtcgtcgtcgattgcccgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagc
tgatgatgctagccctttgtactatatcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaa
atgggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttg
tcagaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactattggaaca
tgataccagacaactcattgatgatatgttgagggaatacacaggactgtctcagcctcgatggaagcaaagcaagtatc
ttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaatggtatggtcgtcaaacttgac
ttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcagtgatgggatcacgaactgggg
tcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtggcaggggacactgcgttgatt
tggtgggccgagagattgccacatacctcctctctgaccaaagggactggctggtcaaaaacaatgcttggaatggattt
gtagagttttttcatgttcaagatcctgagtcctcgaaaatggactatgcccgcaagttctctgaaatccttgatagcac
catggttggaatgagtacccagtga
>gnl|bcl2dbcds|A0A8C7H400_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=909 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacccctttgtgctatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataatagca
aagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcatcaattc
tgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtga
gccagcacttgaaggagattggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctctctgac
caaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagt
aaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcagacagtgccctgctc
taccccaggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A8C7H400_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=882 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacccctttgtgctatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataatagca
aagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcatcaattc
tgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtggtga
gccagcacttgaaggagattggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctctctgac
caaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagt
aaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcaggaattcagcagatt
ag
>gnl|bcl2dbcds|A0A8C7N2B4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=MCL-1 (length=963 residues).
atggcatgtcctgacattggtaaccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgacagcactcc
tttgttcactagcagaggacctgaacatgagtacagatggggagacctcgaaacggatagctccttagcttacggcagca
aacactttggtgtactaggagagtctgccaacatgtaccaccttccaaatacggttgacacacacaaatgtttcatgtgt
aacctcgaaatcaagaactttgttgagaacgacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgctcttactggggaaggaacggtacaggaggg
gaaaaattgcattccctgatagcatcatcaccaactcgaccggagccctggacaccgacaccaggcaactcattaaatgt
gtcctaggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttatcgg
gcagttactagagaagcacagatacacatacaacggtatgatcaacacactctatgtggatgacagaggggataacgtga
agttcctcagtgcagtagcccatagcatctttgaagacgggaccgtcaactggggccgtgttgccagcctgacatctttt
ggggctgcggtgtgccggtacttgagaggcaaggggagagacaactgtgtggatttggtgggagaggagatatcagagta
cctggtcactcaccacaaggactggctagtcaaacataactcctggaatgggttcgtggagttctttccagtagcagaac
ctgagtccagatgtcggaacatcatcatgaccatttttggattggctggtattggggcaacaatgaccttcttggttatg
tga
>gnl|bcl2dbcds|A0A8C7LPD4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=849 residues).
atgagtctgtcgaagtcgattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctagccctttgtactatttcgacggggccgtatgtgctgcggcgtcaccgaagtctaaagtggacttgggaaatg
ggaccggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacgtcctcgataatcatttgtca
gaccgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtcc
atcgggcgatgaagtattggaacatgatatcagacaactcattgagaattttttgggggactacacaggactgtctcagc
ctcgatggaagcaaagcaagcctcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatac
aagggtatggtcgtcaaacttgacctggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgtt
cagtgatgggatcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggaga
gtggcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtc
aaaaacaatgcttgggatggatttgtagagttctttcatgttcaagatcctgagtcctcgaaaatggactatgcccgcaa
gttctctgaaatccttgacagcaccatggttggaatgagtacccagtga
>gnl|bcl2dbcds|A0A8C7PM33_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=888 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcaggtggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcat
caattctgtggccacgaccatgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaacactcgccatgttggtcaggaattcag
aagattag
>gnl|bcl2dbcds|A0A8C7PM33_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=876 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcaggtggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcat
caattctgtggccacgaccatgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaacactcgccatgttggtcaggtga
>gnl|bcl2dbcds|A0A8C7PM33_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=933 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcaggtggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgtctccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagaaagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgatgacatgagtttcat
caattctgtggccacgaccatgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagatgggcaggggacactgcattgagtcggtgggccaaaagatcgccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaacactcgccatgttggtcagtctgttgg
attatagtggcggactgaattgggacagtgctttggtgtcaagctcaagttag
>gnl|bcl2dbcds|A0A8K9V051_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=MCL-1 (length=963 residues).
atggcatgtcctgacattggtaaccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgacagcactcc
tttgttcactagcagaggacctgaacatgagtacagatggggagacctcgaaacggatagctccttagcttacggcagca
aacactttggtgtactaggagagtctgccaacatgtaccaccttccaaatacggttgacacacacaaatgtttcatgtgt
aacctcgaaatcaagaactttgttgagaacgacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgctcttactggggaaggaacggtacaggaggg
gaaagattgcattccctgatagcatcatcaccaactcgaccggagccctggacaccgacaccaggcaactcattaaatgt
gtcctaggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttatcgg
gcagttactagagaagcacagatacacatacaacggtatgatcaacacactctatgtggatgacagaggggataacgtga
agttcctcagtgcagtagcccatagcatctttgaagacgggaccgtcaactggggccgtgttgccagcctgacatctttt
ggggctgcggtgtgccggtacttgagaggcaaggggagagacaactgtgtggatttggtgggagaggagatatcagagta
cctggtcactcaccacaaggactggctagtcaaacataactcctggaatgggttcgtggagttctttccagtagcagaac
ctgagtccagatgtcggaacatcatcatgaccatttttggattggctggtattggggcaacaatgaccttcttggttatg
tga
>gnl|bcl2dbcds|A0A8C8CMB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=888 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgactccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcgatgacatgagtttcat
caattctgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagattggcaggggacactgcattgagtctgtgggccaaaagatcaccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcaggaattcag
cagattag
>gnl|bcl2dbcds|A0A8C8CMB3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=1401 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgactccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcgatgacatgagtttcat
caattctgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagattggcaggggacactgcattgagtctgtgggccaaaagatcaccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcagccaaccac
caatacagaatcaaatacctgtagctcaggagtggattactagcatacctgtggtggtgttctcttcacccagtggttgc
aagcacactcattacagaataacacctcacctaaggggtgtcagtgtaaatgacgttgggtccttgagccgccacaggct
cccctgcctcagccggctcatcgggctttcatgcctcagccggatcgccagactcccctgcctcagccggctcatcgggc
tttcatgcctctgccagatcgcaagactcccctgcttccaccggcttgtcaggatctcatgcctcagccggtctgtcagg
ttcccgcgccccagccggctcgacaggttcccgcgcctcagccgacgtgacaggtttccacgcttcagcaggggtcacca
atctgctcctgatccctgggtttgtctcccttatcggcgccctgcggctggagccgcgcgtcggggagggggcagtgtca
cgtatactctctctccgacctctaggtcatcaggctgctga
>gnl|bcl2dbcds|A0A8C8LPV9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=849 residues).
atgagtctgtcgaagtcgattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctagccctttgtactatttcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaaatg
ggactggcgatactccacgacccacgacgttaggaatgaatgtcgtgaaaaccaacgtcctcgataatcatttgtcagac
cgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtccatc
gggcgatgaagtattggaacatgataccagacaactcattgagaattttttgggggactacacaggactgtctcagcctc
gatggaagcaaagcaagcctcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaat
ggtatggtcgtcaaacttgacttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcag
tgatgggatcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtg
gcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtcaaa
aacaatgcttggaatggatttgtagagttctttcatgttcaagatcctgagtcctcggtaaggaacaccctcctagcctt
tgctggagttgctgggattggggcaacacttgccatgttgatcaggtga
>gnl|bcl2dbcds|A0A668RLC9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis aureus GN=MCL-1 (length=837 residues).
atgaccaactatttgatgtcgaaaaggaaccagtttaccttcatagactatcttcttcctcaaaatggagtcccggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcatttggacagtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacatgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|A0A668SNL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis aureus GN=MCL-1 (length=723 residues).
atgttctccttaaattgctgtctgtctgagtggtgtccaaacaacgatgtgggctttatagataattgggaaaccctctg
taggaaacctggtcttgttaggagagacggcatccatcccactttggatggagcagctctcatttctagaaatctggaag
acggttcgttgccgagcaccccggagtttcatttggacagtgaatccgacgaggagctggagagagaaacgaaactcatt
attcacagttttttgggagactttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacgatgaaaag
agttgttgcggacgtattagaaaagcacagatatgcttacaacggaatgattaataaattgtcattggatgaaagagaag
aagatatgtcatttgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgtcagctttgtggccttc
ggagcagtggtgtctcagcacctgaaggaaaagggcagggacaactgcgtggtgctagtgagtcaagagatttctgcata
cttgctgtctgaacagcgagactggattatcaaaaacaatgcatgggatggctttgtggcgttcgttcgagtagcagacc
ctgagtcgatagtcaggaacacactcatggcctttgctggatttgcttgtattggagcaacactggcactgttgatcagg
tga
>gnl|bcl2dbcds|A0A669C7T2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=837 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggttctgggatgcattattgtga
>gnl|bcl2dbcds|A0A669C7T2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=972 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacggtcaggaacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcaggacaaacactcactcaggtctcaggaagaaatggagagtgtctcgccatggtgatgatccacagc
aggcctcccctaatcttctcctgtggctaatgttatctaccacccaggttacccctgtagttaactgtgaagaacacact
ggtagacaatag
>gnl|bcl2dbcds|A0A669C7T2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=885 residues).
atgaccaactttttgatgtcgaaaaggaaccagtgtaccttcatagactatcttcttcctcaaaatggagtcctggaggg
accaatgcactatggatcggggaaatcctctccgcagaatgccacaggctcctctaaagactctagcaacgggattgtgt
ctaatggtacccccaaacggccgaacaacctcggggtaacctcaacaaacgggtatacaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtatcatttggacggtgaatccgacgaggagctggagagagaaacgaa
actccttattcacagttttttgggtgattttactggactttctcagcctcaacgaaaggaaaccaaagcactaaaaacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaactgtcattggatgaa
agacacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttgcagaccacacgaccaactggggtcgtattgt
cagctttgtggccttcggagcagtggtgtctcagcacctgaaggaaaagggcagagacaactgcgtggcgctagtgagcc
aagaggtttctgcatacctgctgtctgaacagcgagactggattgtcaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtccacgacccgggaggtggaatggacaaaaggaaaaatgtttcaaattacattatttaa
ttcacagagatctatttttgctaaaagatgccataataaaaaggaaaaagacattttttttccttttttgctagtctttt
tttaa
>gnl|bcl2dbcds|I3KXG5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oreochromis niloticus GN=MCL-1 (length=684 residues).
atgttctccttaaattgctgtctgtctgagtggtgtccaaacaacgatgtgggctttatagataattgggaaaccctctg
taggaaacctggtcttgttaggagagacggcatccatcccactttggatggagcagctctcatttctagaaatctggaag
acggttcgttgccgagcaccccggaagaaactaaactcattattcacagttttttgggagactttactggactttctcag
cctcaacgaaaggaaaccaaagcactaaaaatgatgaaaagagttgttgcggacgtattagaaaagcacagatatgctta
caacggaatgattaataaattgtcattggatgaaagagaagaagatatgtcatttgtagcgaagagcctctttggagacc
acacgaccaactggggtcgtattgtcagctttgtggccttcggggcagtggtgtctcagcacctgaaggaaaagggcagg
gacaactgcgtggtgctagtgagtcaagagatttctgcatacttgctgtctgaacagcgagactggattatcaaaaacaa
tgcatgggatggctttgtggcgttcgttcgagtagcagaccctgagtcgatagtcaggaacacactcatggcctttgctg
gatttgcttgtattggggcaacactggcactgttgatcaggtga
>gnl|bcl2dbcds|A0A6I8NSR7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=MCL-1 (length=1392 residues).
atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgggggcgccggcagcggcgcgggggcctcccc
gcccggagggcgcctgcggcccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcggcggcccggc
gcgcgggcgggggaggggaggccgcggcgccgctgattggcggaggcgccggcgcgagcccctcggcggcggccggcctg
ggggtcgcgcgcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcgcccgcccggcgcgcgccgcc
tgaggggacggagccgccgccgccgtcggccgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct
acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggacctgcccggccaggccggcggctccctgccc
tccacgccgccgcccgacgaccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatcacccactacct
ccgcgagcaggcggccggacggaaggacgagccccggggccgggaccgccgggcgctggagaccctgaggagggtgggcg
acggcatccagcgcaaccacgagaccgccttccagggtgagggaggcctccggcgcatgcgcgaagcgggcgcgcccctc
cccccccctccgtcctacgtactgagcgccctcccggagcctaatggcacccctccccccccccccgtcccctctccccg
caggcatgctccgcaagctggacatccagaaggaggaggacctgaaggccgtgtcccgcgtcggcacccacgttttcaac
gacgggacgacgaactggggccgcatcgtgacgctcatctctttcggcgccttcgtggccaagcacttgaagagcatcaa
ccaggagggctgcatcgaccccctggccgagagcatcacggaggtcctggtgaccaccaagagggactggctggtcaaac
agaaaggctgggaaggatttgtggaattcttccacgtggaggacatggaaggcagcgtccggaacgtgctcctgctcttc
gccggggtggccagcctgggagccggcttggcctatctaataagatgatggggggacccccccccccttccccctcggac
gctcagagactgacttcacatcggagcagaccagccccaggcgccggccacccgtcggaactgtcgcttctgccgccggg
aagctttatttatgaagcccagcgtccagccgcccagaattggcaccgacaggcaccgagcggcggcccagccaggcaag
agggtttgggctggtttggggacggatattaa
>gnl|bcl2dbcds|A0A6I8NSR7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=MCL-1 (length=1041 residues).
atgctgggcctgcagaagaacgccgtcatcggcctcaacctctactgcgggggcgccggcagcggcgcgggggcctcccc
gcccggagggcgcctgcggcccgacaaggcggcggcggtcggcgagggcccggcggcggcggcggcggcggcggcccggc
gcgcgggcgggggaggggaggccgcggcgccgctgattggcggaggcgccggcgcgagcccctcggcggcggccggcctg
ggggtcgcgcgcccggcccccattggcgccgagggccctgacgtcatcgggaccctcgcgcccgcccggcgcgcgccgcc
tgaggggacggagccgccgccgccgtcggccgccgccgccgccgccgccctcctccgccccgaggacgaactggacggct
acgagcccgaggccccggccaaacgtccggcccacctggccgtgctggacctgcccggccaggccggcggctccctgccc
tccacgccgccgcccgacgaccgcgacgacatggcggacgggctgtaccgccagtccctggagctcatcacccactacct
ccgcgagcaggcggccggacggaaggacgagccccggggccgggaccgccgggcgctggagaccctgaggagggtgggcg
acggcatccagcgcaaccacgagaccgccttccagggcatgctccgcaagctggacatccagaaggaggaggacctgaag
gccgtgtcccgcgtcggcacccacgttttcaacgacgggacgacgaactggggccgcatcgtgacgctcatctctttcgg
cgccttcgtggccaagcacttgaagagcatcaaccaggagggctgcatcgaccccctggccgagagcatcacggaggtcc
tggtgaccaccaagagggactggctggtcaaacagaaaggctgggaaggatttgtggaattcttccacgtggaggacatg
gaaggcagcgtccggaacgtgctcctgctcttcgccggggtggccagcctgggagccggcttggcctatctaataagatg
a
>gnl|bcl2dbcds|G1T2Q0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=1059 residues).
atggcgatgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtgg
cggcggcgtcgcccctccggcagagcggcttttggctgcggagaaggaggccgcggcccggctagaggtagggggagggg
aggccggcgcggtgattggcggaagcccgggcgctagccccccggccgcgctggcgccggacgcccggagggtcgcgcgg
ccggcgcccattggcgccgagctccccgacgtcagcgcgacccccgcgaggctgctgtacttggcgcccacccgccgcgc
gtcgccgctcgaggagatggaagccccggctgcggacgccatcatgtcgcccgaagaggagctggacggctacgagccgg
agccccttgcgaagcggccggccgtcctgcccctgctggacttggtgggggaggccagtaaggtccctagcacggacggg
tcgctgccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatcgcccggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgcgagccggaaggcgctcgaga
ccctgcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcggaaactggacatcaaa
aacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaactggggcaggattgt
gactctgatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatagaacctttagcgg
aaagtatcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttc
ttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccggagtaggagcggggct
ggcttatctgataagatag
>gnl|bcl2dbcds|G1T2Q0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryctolagus cuniculus GN=MCL-1 (length=594 residues).
atgtttagcctgagaagaaacgcggtaatcggactcaacctctacttgggggggcccgggttgggagccggtggcggcgg
cgtcgcccctccggcagagcggcttttggcgaccggcgccaaggacgcgaagccgatgggccgggccggcagcgcgagcc
ggaaggcgctcgagaccctgcggcgggtcggggacggtgtgcagcgcaaccacgagacggccttccaaggaatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgatggcgtaacaaa
ctggggcaggattgtgactctgatttctttcggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tagaacctttagcggaaagtatcacagatgttctcgtcaggacgaaacgggactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaagcggcatcagaaatgtgctgctggcttttgcgggtgttgccgg
agtaggagcggggctggcttatctgataagatag
>gnl|bcl2dbcds|A0A3B3IJ04_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|A0A3B3IJ04_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=858 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctccccaacaccccg
gagttggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaaacgacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaa
tatgatggccatttttaaaggacttcctgcttctaccagacttcacaactcgagatag
>gnl|bcl2dbcds|A0A3P9ILF6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=804 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagagc
gggagagatgtccgcgcgcgtgcctctgccgtccacattggcctctcgcgtggcaaatcccgacccgtccgatcagttca
aaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccggag
ctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaa
tttctttaggaactttgttggaatttctcagtatccacaccgggataataaatacatgtcgaccgcgaaaagagtggtga
acgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgatatg
tcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcctt
cggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgcacgt
acctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttcagac
ccagaaactacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttagtag
gtga
>gnl|bcl2dbcds|A0A3P9ILF6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=855 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagagc
gggagagatgtccgcgcgcgtgcctctgccgtccacattggcctctcgcgtggcaaatcccgacccgtccgatcagttca
aaagaccgcaggacctcgagtattccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccggag
ctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcaccaa
tttctttaggaactttgttggaatttctcagtatccacaccgggataataaatacatgtcgaccgcgaaaagagtggtga
acgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgatatg
tcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcctt
cggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgcacgt
acctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttcagac
ccagaaactacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaatat
gatggccatttttaaaggacttcctgcttctgccagacttcacaactcgagatag
>gnl|bcl2dbcds|A0A3P9L1F3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=807 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtccctctgccgtccacattagcctctcgcgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtactccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccc
gagctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaatctacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttag
taggtga
>gnl|bcl2dbcds|A0A3P9L1F3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias latipes GN=MCL-1 (length=858 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagcag
agcgggagagatgtccgcgcgcgtccctctgccgtccacattagcctctcgcgtggcaaaccccgacccgtccgatcagc
tcaaaagaccgcaggacctcgagtactccgcgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccc
gagctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgaggacaccacggaattcctcac
caatttctttaggaactttgttggaatttctcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgat
atgtcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggc
cttcggggcggcggtgtgtcagtccttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgca
cgtacctgctgagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttca
gacccagaatctacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaa
tatgatggccatttttaaaggacttcctgcttctgccagacttcacaactggagatag
>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=906 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgcaaggtccataccgtatttggcaggatatgacatcatgtcacactaatctatccaaaaataaagttggaagatcac
caagttttgctgttgaagggccgtaa
>gnl|bcl2dbcds|A0A3B3CEX1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias melastigma GN=MCL-1 (length=813 residues).
atgcttcctttgcaaaaacacatggttaacagctacattacgccgagctgtggatgtacggcactcttcggcggagcggg
agagagatccgcgcgcgtgcctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccgaacagatgaaaa
gaccgcaggacctcgacatgttagggaataaatctccgtatgcggcgaggaggtttcacgacgacgacggcggctctctc
ccgaacaccccggagctggagtgcgacaacagcgtacttgtacccaacgacccaccgataaaccaggacaccacggaatt
cctcacgaacttctttaggaactatgttggattatctcaatctcgccaccgggagagcaaatacatatcgacggcgaaaa
gagtagtgaacgacatgatggataaacatcggttcgcctttaatggtatgatcaataggctgtctttggaagacaatttg
gacgatatgtcatttattagccgcgtagcagagaacatgtttgcggaccggaccaccaactggggccgcatcgccagcct
gctggccttcggggcggcggtgtgtctgcagctgaaggagaagggcagaggtcactccgtggacctggtcagtcaggaga
tctgcacgtacctgctgcgtgagcagcgggactggctgatcaacaacaactcatgggatggtttcgtagagttctttcac
gtcccagacccagaatcaacagtcaggaacactttggtggccgtccttggacttgcaggcgttggggctttactggccca
ggtgtgtaggtga
>gnl|bcl2dbcds|A0A8C7X109_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oryzias sinensis GN=MCL-1 (length=855 residues).
atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactgtggatttacgggacacatcctcggcagagc
gggagagatgtccgcgcgcgtgcctctgccgtccacattggcctctcgcgtggcaaaccccgacccgtccgatccgatca
aaagaccgcaggacctcgagtattccacgaggaggtttcacgacgtcgacgacgatggctctctcccgaacaccccggag
ctggagtgcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgagaacaccagggaattcctcaccaa
tttctttaggaactttgttggaatttctcagtatccaaaccgggataataaatacatgtcgaccgcgaaaagagtggtga
acgacgtgttagagaaacacaagattacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatgatatg
tcatttgtcagcagcgtagcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtcagcctgctggcctt
cggggcggcggtgtgtcaggacttgaaggaaaagggcagaggtcactgcgtggacctggtcagtcaggagatctgcacgt
acctgctgagtgagcagcgaaactggctggtcaacaacaactcctgggatggtttcgtagagttctttcgcgtttcagac
ccagaaactacagtcaggaacactttggtggccttccttggaattgctggcgttggggctttactggcccagcttaatat
gatggccttttttaaaggacttcctgcttctgccagacttcacaactcgagatag
>gnl|bcl2dbcds|H0XFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggcgccgggctgggggctggcagcggcgg
cgccacacccccgggagggcggcttttggctgcggagaaggaggccgcggcccggcgagaggcagggggaggggaagccg
gcgaggtgattggcggaagccccggcgcgagttccccggcctccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggtgccgaagtccccgacgtcaccgcgacccccacgaggctgctgttcttcgcgcccaccctccgtgcggcgcc
gcgggaggagatggaagcccctgccgccgacgccatcatgtcgccggaagatgagctggacgggtacgagccggagcctt
tggggaagcggccggcggtcctgcctttgctggagttggtcggggaggccagtaacggccccagcactgatgggtcactt
ccttcgacaccgcccccagcagaggaggaggaggatgagttataccggcagtcgctggagatcatctctcggtaccttcg
ggagcaggcgaccggtgccaaggacgcgaaaccaatgggcagggcaggagccgccagcaggaaggcgctggagaccttgc
gccgcgttggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|H0XHA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otolemur garnettii GN=MCL-1 (length=582 residues).
ctaccagaccagatggaagcccaagttgccgatgccgtcaagtcgcccgaaggtgaggtggcctcgtgcgagccggagcc
tctcaagaagcaaccggagggcctgcctttgctggagtttgttggtgaggccggtaacggccccagcactgacacacttc
cttccacacctcccccagcagaggaggaggatgagttatactggcagtcgatggagatcatctctcggtacctatgggag
caggaaactggagaggatatcaactctttgtctcgagtgatggcccatgttttcagttacggcgtaacaaattggggcag
gattatgaccctaatttttggtggctttgtggccaagcacctgaagaccataaaccaagaaggctacatcaaaccgctag
aagaaaatatcgcagatgtccttgtgaggacaaaaccggactggctagtcaaacaacgaggctgggatggctttgtggag
ttcttctacctggaagacctggaaagcagcgtcagaaacgtgctgctggctttcgcaggtgttgctggagtaggagctgg
cttgacctatctaataagatag
>gnl|bcl2dbcds|A0A8C8B1M7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Otus sunia GN=MCL-1 (length=1290 residues).
atggtgcaggctgcgagcacggcgtgcccggtgccgggggacagcggcacggcggggggtggtggtgctggggtgtgtgt
agctgcacgggggggccctgcgctgctgaggggctgctgcacggggctaagaacggccggggcccggcagcaccgagggg
cggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngagctggatggcttcg
agcccgaggccgagcgcggcccggcgggggactcgctgcccggcaccccgcccgggccgcccgcgccgcccgatgggctg
cggcaggactcgctggagctcatcagccgctacctgcgggaggcggcgggcgaggccgagcccggcgccaagaagctctt
cccggggctgctgggcgggcccggccggccgggcgggtcgggcgacgccgtgatggagaaggcgctggaaacgctgcgga
gggtcggcgacggcgtcatgcagaagcacgagctcgccttccagggaatgcttcggaagctggaaatccagaaagaggaa
gatctgcaatcagtatgtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcat
ctcgtttggtgcctttgttgcgaaacacctgaagagcataaaccaggagaagtgcatcagctcgctggcagggatcatca
cggacgcgctcgtctcatcgaagcgcgagtggctactgagccaaggaggctgggagggctttgtcgacttctttcgagtc
gaggacctggaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggccggactgggagcgagcttggcctacat
gatccggtga
>gnl|bcl2dbcds|W5QI41_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ovis aries GN=MCL-1 (length=807 residues).
gggagccggaaaccccgccctgccccaggccccgcccctgccttgaccccgccggttaggtgccgtgcgcaaccgccgga
agctttcgctgccttccccatttacgggatgcagataaagaggcagcagcagtggttcaagatgtttggcttcaagaggc
gccctgccgtccggcctttacctttgatggtcggagaagccagtaacaacagtccaggctcggacggctcgctgccctcg
acgccgcccccatcagaggaggaggaggacgagttatatcggcagtccctggagattatctctcagtacctcctggagca
agcaaccggcaccaaggacgcgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgcgcagag
tcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaagacgat
gtcaagtctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttc
ttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagcatcacag
atgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccgtgtagag
gacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcatatctaat
aagatag
>gnl|bcl2dbcds|A0A2R9BPJ5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2R9BPJ5_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2R9BPJ5_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan paniscus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=816 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgctggcgcaagccccccgtccaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggcgctggagaccttac
gacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcgacttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggcgctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2I3RTV4_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=378 residues).
agtgttgaaacgtgcatgcttcggaaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatcca
tgttttcagcgacggcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttga
agaccataaaccaagaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactgg
ctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgct
gctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G2HFR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pan troglodytes GN=MCL-1 (length=444 residues).
atggacatttgccggctctcagcagcaatgcgtgaattttacattgtgcatctggatatatacccaccacctgagtgtac
cattcacatgttactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacg
gcgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaa
gaaagctgcatcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaag
aggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaggaatgtgctgctggcttttgcag
gtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C8Y0M9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Panthera leo GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggctggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggctgtggggaaggaggccacggcccggcgagaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccagccactctcgcgcccgacgcccggagggtcgcgcggccctcg
cccattggtgccgagggccccgacgtcaccgcgacccctccgaagctgctgttcttcgcggccacccgctgtgcgtcgcc
gcctgaaaagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggaactagacgggtacgagccagaacctc
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcagtggccccggcacagacggctcactg
ccctcgacgccacccccagcagaggaggaggaggacgagttgttccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgactggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtgaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccac
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C8Y0M9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Panthera leo GN=MCL-1 (length=594 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggctggcggccgggagcggcgg
cgcctcctcttcgggagggcggcttgtggcgactggcgccaaggacgcgaaaccactgggcgggtctggggcggccagcc
gaaaggcgttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttcttgtgaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccacgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C9K7H4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Panthera tigris altaica GN=MCL-1 (length=573 residues).
atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgggggggccgggctggcggccgggagcggcgg
cgcctccgcgactggcgccaaggacgcgaaaccactgggcgggtctggggcggccagccgaaaggcgttagagaccctcc
gacgggtcggggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccac
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A096MRS6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=984 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctcttggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctggggaaaaacatgcagtcctctagtg
ttcatgtgcattctgtgggggtga
>gnl|bcl2dbcds|A0A096MRS6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctcttggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A096MRS6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A096MRS6_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Papio anubis GN=MCL-1 (length=1032 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttagctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggctgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctcttggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggctattttttgttccagttcagtt
gaatactcttcagtggattcaaaccatgaagaaataagtcaccaggggaggatagctgaaatacattcctaa
>gnl|bcl2dbcds|A0A3B3R4U0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=MCL-1 (length=816 residues).
atgaatctgatcaatcgtaccacggccaccggcttgttctgccccggcattaaaaatggcgtgaagcagaacggcttcta
cagctttgtatcggcgtctctgcccgtagccccgctcaaagcgaaaagcgaagaggagctggacagtctggatgaaggcg
aacgttttcatggagcgccgaaaacagagaggcgtgattgcgaacaccacttacgggcgtcgggcaacgaagacgggtct
ttgccgtccacgccggggacgccgccggactgcgggaaaatgctgacgtttcccaacagggggctcagccaggagactca
tgagcttatcgggaccttcttacggacttacagcggcctcccggcctcggccagccgacacaaagcgtaccctgtcctca
gacgagtggcggagactgtcataggaaagcacttgatcgcgtacaatggcatgattaaaaaactagaactggataagcgt
ggggacgacacaagtttcgtcacgaaggtggccgaggaaatcttcagtgacaaggtcaccaactggggtcgcatcgccag
cctgatagcgtttgggggtgtcgtgtgcaagtacctgaaagatcacggacagaccaactgcgtggatgatgtggcaagcc
ggatcagctgctacctgctggaacaccagagggactggctaaaccgtaacaatggctgggagggatttacagacttcttc
tatatggaagacccagagtccactgtgcgtaatgctcttgtggcatttgcaggagttgcaagcctgggggctggacttgc
tctgttgatgaggtga
>gnl|bcl2dbcds|A0A3B3SG34_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=MCL-1 (length=888 residues).
atgaatccacaaagcttgaagagttacgcgccgattatggtgagcatgaactaccacagacccctgcaccatggcgtcct
ggggaaaagcattttgcagtgtctcgattcgtctgcaagagccgcaaacacaccctgtctggagtcctccgggttatggg
acgacgagctggacaactgtacggacgaggtggacgtgtgtccctgctcgacaagactcgccaaaagggattctgaaaaa
gagccgtgtcggggaagccggttgcccgggagcacaaacgcggtcggctcactgccgacttccccggacggcgacttgcc
agcttacggacccatttgtggtttctctcgcagcgccgtcgaaatgctggaccaagagactagcgaattaatcacgactt
tcttcgccgaatacacggggctgtgtgcgacattacagagacgaaacgaggcgctctccacactgaagcgggtggtggcg
actgttgtcgaaaaacacaagtttgcttacaatggtatgattggaaaactaagtttgaatcagcagagtgatgacatgac
cgtaatcaaaactgtagctgagagaatattcagtgatggaaccacaaactgggggcgtattgccagccttgtggcctttg
gggcagaggtgtgtaaatacctgaaggagactgggcgggagcactgcgtggaggctgtggggaagcagatctcctcctac
ctgctctcagagcagcgacaatggctactcaagaacaaggcctgggatggatttgtggagttctttcatgtagaagacac
tgaatcgttggtcctccagaaggttcttgtacatgtttctgagtgcggatcctttgaattacatgaccttaaagccttgt
gcatgtaa
>gnl|bcl2dbcds|A0A8C9EP12_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pavo cristatus GN=MCL-1 (length=1068 residues).
atgtttgccgtcaagcggaacgccgtcatcggcttcaacctctactgcggcggaggaggcccgggcctggtgcccgcttc
accagcaggagaccaaaccccgccgcccgccgccgccgccccggccgccgccaccgccgctgaggtaccgcggccgctga
ttggctccgcggggttgtgggccgccgccggccgcgccgaagccccccacgctcccattggctccgaggcggccccccac
tctctgactggctccgaggaggccccccgcgctccgattggttccgccgcggcccgccgggcgccgccggactccacgcc
gcggcccgtcgcgctgtggagccccgaggaggagttggacggctgcgagcccgagtccgagcgaggccccggaggcgatt
cattgcccagcacgcctcccgagctgcccgacgagctgcccgacgagctgcggcgggactctttggagctcatcctccgg
tacctccgggaggcggcgggagaagccgagcccggcgttaaaaagctctttccggggctcctgggagggcccgggcggcc
cggcagggcgggcagcgccgtcatggagaaagcgctagaaacgttgcggagggtcggggacggcgtgatgcagaaacacg
agttggccttccaggggatgcttcggaagctggaaatcaaaaaggaagaagatctgcagtcggtgtgtgaggtggctgcg
cacgtttttagtgacggagtaacaaactggggccgagttgtcacactcatctcatttggtgcctttgttgcaaaacacct
gaaaagcatcaaccaggagaagtgcattggctcgctggcagggatcatcacagatgctttggtctcatccaaacgcgagt
ggctgatgagccagggaggctgggagggctttgtcgacttcttccgagttgaggacctggaaagcagcatcaggaacgtg
ctgatggcctttgcaggagtggccggcctgggggcgagcttggcctacatgatccgttatgcagctggacttgagctgaa
ccctggagaatatctaggcatcccctga
>gnl|bcl2dbcds|K7FPN7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=MCL-1 (length=366 residues).
gggatgcttcggaaactagacatcaagaatgaggaggatctcaagtcagtgtcatcagttgcaacccatgttttcagtga
tggaataacaaactggggtagaattgtaacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaacc
aggagaattgcatcaacacgctagcagggatcatcacagatgtgcttgtctcagacaaacgagattggctagttaaccaa
agaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgc
aggctttgctggactgggtgcaagcttggcgtacatgatgcgatga
>gnl|bcl2dbcds|A0A8C8RUG9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pelusios castaneus GN=MCL-1 (length=981 residues).
atgttggcgctgaagcggaacgctgtgatcggcctcaacatttactgcggagggggcccggcgctggcgccctcctcgcc
ggcttctgccagcggcggcggcgccccccctgctcccaccggcccttcttccacggagggcgttcggccggcgacgctga
ttggcggagacccttggggtcccaacggtccttctgagggggctcgggcgctgattggtcaggagccccaggaggggccc
cgggcgctgattggctcccctgccccttccccggttgctgggacgccccggccggactcgctgtgcttcccggaagagga
gctggacggctgcgacccggaacctgagaggatgggccccgcggacggctccttgcccagcaccccgcccgacgaggagg
acgacgggggcccggacggcttgtaccaggactcgctggagctcatcagccgctacctgcgcgaggccgctgaacccggc
agcaagaggctgaaggggctgctgggcgagccgcgccggccagggggagccggccccgccgccgtggagaaggcgctgga
gacgttgcggagggtcggcgacggcgtcatacagaagcaccagatcgctttccaagggatgcttcggaagctagacatca
agaatgaggaggatctgaagtcggtgtctgcagttgcaacacatgttttcagtgatggaataacaaactggggtagaatt
gtgacactcatctcttttggtgcctttgttgcaaaacacctgaggagcataaaccaggagaactgcatcaacacactagc
agggatcatcacagatgttcttgtcacagacaaacgagagtggctagttaaccaaagaggctgggagggatttgttgact
tcttccgcgtagaggatctagaaggtagcatcaggaacgttctgatggcttttgctggcgttgctggactgggagcaagc
ttggcctatatgatgcgatga
>gnl|bcl2dbcds|A0A3B4AFB7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=MCL-1 (length=741 residues).
gacaccacatgcctacagggtgtgctaactccaccgcttggcacagcccacatttgcggctctcctcatccacgacccac
agctcttgtaatgaaaaacgaacttttaaataagaacacgcgagaagaggattacgaaaactcagaggggtctctgccat
gtacgccagaattccactcagacagtgaaatggagctctccagctactcggcggagcacgaagtgttagagagcgacacg
aggcagcttcttagcgattttttcaagcttttcacggggatttctcagccgaagtggaaacaacgtccggccctatctac
aatgaagggagttgtggacaagcttttggaaaagcacagatacgcatataatggtatgataaacaaactggctctggacg
acaggggggacgacgtatcgtttattggcacagtagccaagagtatctttgaagatggtaccactaactggggtcgtatt
gccagccttatagcctttggggctgtggtgtgccagtacctcaagacaaaaggaagagaaagctgtgtggagcgagtggg
ccaagaaatttcctcatacctcctgttggaccaacgagactggctagtcaggaataatgcctgggatggctttgtcgact
tcttcagagtagaagacccagagtcagcagtgaggaacacgcttatggctgtagctggattagctggtattggtgcaacg
ctggccatgttgatcaggtga
>gnl|bcl2dbcds|A0A3B4AFB7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=MCL-1 (length=858 residues).
atgaatattattaattctccgaagaggaccgcgttaaaactgtccaccatgggcttgtttctgcctcaaaatggactcgc
ggagggggacatgcactgtggggctgcagattcttccgcgcagatgcctaggcctgcaactatggacactcgtaaaggga
atacggcctccagcggctctcctcatccacgacccacagctcttgtaatgaaaaacgaacttttaaataagaacacgcga
gaagaggattacgaaaactcagaggggtctctgccatgtacgccagaattccactcagacagtgaaatggagctctccag
ctactcggcggagcacgaagtgttagagagcgacacgaggcagcttcttagcgattttttcaagcttttcacggggattt
ctcagccgaagtggaaacaacgtccggccctatctacaatgaagggagttgtggacaagcttttggaaaagcacagatac
gcatataatggtatgataaacaaactggctctggacgacaggggggacgacgtatcgtttattggcacagtagccaagag
tatctttgaagatggtaccactaactggggtcgtattgccagccttatagcctttggggctgtggtgtgccagtacctca
agacaaaaggaagagaaagctgtgtggagcgagtgggccaagaaatttcctcatacctcctgttggaccaacgagactgg
ctagtcaggaataatgcctgggatggctttgtcgacttcttcagagtagaagacccagagtcagcagtgaggaacacgct
tatggctgtagctggattagctggtattggtgcaacgctggccatgttgatcaggtga
>gnl|bcl2dbcds|A0A8C8UMK7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=MCL-1 (length=441 residues).
gggggagtgaggagccgggctcctgtggcagccattggacaactctgtggggctggcccgctccttcccccttccggcat
gctccggaagctggacattaaaaacgaagacgatgtgaaatctttttctcgagtgatggtccatgttttcaaagatggcg
taacaaactggggcaggattgtgactcttatttcttttggtgcctatgtggccaaacacttgaagagcataaaccaggag
agctgcatcgaaccattagcagaaagtatcacagatgttcttgtacggacaaaacgggactggcttgtcagacaaagagg
ctgggatgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcctttgcgggtg
ttgctggagtaggggctggtctggcatacctaataagatag
>gnl|bcl2dbcds|A0A669R428_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Phasianus colchicus GN=MCL-1 (length=540 residues).
atgtttgcggtcaagcggaacgccgtcatcggcttcaacctctactgcggcggtggaggcccgggagggcccgggcggcc
cggcaggacgggcggagccgtcatggagaaagcgctggaaacgctgcggagggtcggggacggagtgatgcagaaacacg
aattggccttccagggaatgcttcggaagctggaaatcaaaaaagaagaagatctgcaggcagtgtgtgaggtggctgct
aacgttttcagtgatggagtaacaaactggggccgagttgtcacactcatctcatttggtgcctttgttgcaaaacacct
gaaaagcatcaaccaagagaagtgcatcagctcgctggcggggatcatcacagacgctttggtctcatccaaacgcgagt
ggctgatgagccagggaggctgggagggctttgtcgacttcttccgagttgaggacctggaaagcagcatcaggaacgtg
ctgatggcctttgcaggagtggctggcctgggggcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|A0A8C9BA52_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Phocoena sinus GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcgacttttggctgcaggaaaggaggccacggccgggcgagaggtagggggaggggaag
ccggcgaggtgattggcggaagcgccggcccgagccccccagccactctcgcggccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggtctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggccagtaacagcccgggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgccagccggaaagcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
cacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A8C9BA52_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Phocoena sinus GN=MCL-1 (length=597 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcgacttttggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgcca
gccggaaagcgttagagaccctgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaac
aaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggacttcttccacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
cggagtaggagctggtttggcgtatctaataagatag
>gnl|bcl2dbcds|A0A8C9I795_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgcaacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcttc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagta
tcacagacattctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C9I795_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgcaacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacattctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A670K3Y6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Podarcis muralis GN=MCL-1 (length=996 residues).
atgtttaacaagaagtcggtggtgttgtattgtgggggcgcaccgagcatggcgcccgccacgccggtctccccgggggc
cggcggaggcggcagcagtagtggagccccaaccgcctcagccgcggcggccgccgtcttcaccgccaacggccgctctg
agggcgccggcccgttctcgcctcggattgggcgcggctggggggccagcgtcttccctgaggggcccttgccgcggatt
ggctcaggggcgcccctggcggggcccctggcgcggattgggcccttcgaagtagcgccccgcgcgctgattggctcccc
cgccgcggcggccgttggcggcggcgccgcgcggccgttggcgctggcgctccctgagggagagctggacggctgcgacg
acgaggccgaggcccaggccgcccaggccggagacctgccttcgcccaccccttcgctggagtccatcccgtccgcgcag
ggcgacgacgacgacgcggcggtgacgctggagttggtgagccggtacctgcgcgaggaggccgccgcctcgccgggcgc
cgcgcaggcgctggagaccctccggcgggtcggggacaacatcctcgacaagcaccagctggctttccaaggaatgctta
ggaaaattgaaataaagaaagaggatgacctgaagactgtgtcagaagttgcaaagcaccttttcagtgacggcataaca
aactggggtcgaattgtgactctcatctcttttggtgcctttgttgccaaacatctgaagcgcatcaatcaggagagtgc
catcggtcgtttggcagagctcatcactgaggttctggttacagacaagcgggaatggatcctcaacaataatgcctggg
agggatttgttaatttcttccatgtagaggacgtagaaggcagcatcagaagcgttctgatggcttttgcaggcgtggct
ggaataggagcaggtttggcttacatgatccggtga
>gnl|bcl2dbcds|A0A087X830_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia formosa GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcattaaactatctaattttttctcaaaatggagtcggggatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccctacaagaaac
gcccgacgaatctcgcagtgtccgcatcgaatggatatgttgcaaaaagcctccagaagagcagcgacgacagcgacgaa
ggctctctgccatgcactccagcgcagcaagacagtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaatggagctcattagcagttttctaagaaattttacaggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcaacaggctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagaatctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgcagtgtgtcagcacctgaaggagaggggcagagagcattgcgtgg
agctggtgagcaaggaaatatccacgtatctcctggaaaaccagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagatcctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A3B3VM25_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia latipinna GN=MCL-1 (length=903 residues).
atgacggctaattcgacaaccgcgttaaactatctaattttttctcaaaatggagtcggggatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccctacaagcaac
gcccgacgaatctcgcagtgaccgcatcgaatggatatgttgcaaaaagcctccaggagagcagcgacgaaggctctctg
ccatgcactccagcgcagcaagacagtgaaaccgtcgcgtctgctgtacgtgcgagcaaccaagtgctggataacgacac
aatggagcttattggcagttttctaagaaattttacaggactttcaaagtgtcggtggagtcaaaataaagctctatcta
cgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcaacaggcttgctctggat
aaccagccggacaatatggggtttgttacggaagtagcacagaatctcttttcagacgggaccaccaactggggtcggat
cgtcagcctggtggcgttcggggctgcagtgtgtcagcacctgaaggaaaggggcagagagcattgcgtggagctggtga
tccaggaaatatccacgtatctcctggaaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtggag
ttctttagagtatcagatcctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtattggggcaac
attagcctttctcatcagaaagctacgatcagcgcttggtcagcaaaagctaaatacaagccttttggaaatgagagact
gcacaagtctggagccaggataa
>gnl|bcl2dbcds|A0A3B3YCD0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia mexicana GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcgttaaactatctaattttttctcaaaatggagtcggggatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggagccactgtagattctcttcattcgcctaaggatccctacaagcaac
gcccgacgaatctcgcagtgaccgcatcgaatggatatgttgcaaaaagcctccagaagagcagcgacgacagcgacgaa
ggctctctgccatgcactccagcgcagcaagacagtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaatggagctcattagcagttttctaagacattttacaggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcaacaggctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagaatctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgcagtgtgtcagcacctgaaggagaggggcagagagcattgcgtgg
agctggtgagcaaggaaatatccacgtatctcctggaaaaccagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagatcctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A3P9Q4I8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia reticulata GN=MCL-1 (length=834 residues).
atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaatggagtcgggaatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatcccttcaagaaac
gcccgacgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccggagagcagcgacgacagcgacgaa
ggctctctgccatgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaacggagcttattagcagttttctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcagcaagctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagagtctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgtagtgtgtcagcacctgaaggagaggggcagagagcactgcgtgg
atctggtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagaccctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcagcaagtaa
>gnl|bcl2dbcds|A0A3P9Q4I8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Poecilia reticulata GN=MCL-1 (length=831 residues).
atgacggctaattcgacaaccgcgttaaactatctcattttttcacaaaatggagtcgggaatggacaaacacactacga
ccaggggctcgttgtgcctgaagtcgcaatgggctcccgtgtagaatctcttcattcgcctatggatcccttcaagaaac
gcccgacgaatcttgcagtgactgcatcgaatggatatgttgcaaaaagcctcccggagagcagcgacgacagcgacgaa
ggctctctgccatgcaccccggcgcagcaagacggtgaaaccgacgcgtctgctgtacgtgcgagcaaccaagtgctgga
taacgacacaacggagcttattagcagttttctaagaaattttactggactttcaaagtgtcggtggagtcaaaataaag
ctctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagatatgcatacaatggtatgctcagcaagctt
gctctggataaccagccggacaatatggggtttgttacggaagtagcagagagtctcttttcagacgggaccaccaactg
gggtcggatcgtcagcctggtggcgttcggggctgtagtgtgtcagcacctgaaggagaggggcagagagcactgcgtgg
atctggtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggctagcaaaaaacaactcatgggagggc
tttgtggagttctttagagtatcagaccctgagtctacagtgaggaacacgctgatggcgtttgttggggtcgctggtat
tggggcaacattagcctttctcatcaggtga
>gnl|bcl2dbcds|A0A8I5TL14_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pongo abelii GN=MCL-1 (length=816 residues).
atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggtgctggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtctaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccattgggcaggtctggggccacctgcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A8I5TL14_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pongo abelii GN=MCL-1 (length=1053 residues).
atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggtgctggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgcaagccccccgtctaccctcacgccagactcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggaatctggtaataacaccagtacggacgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccattgggcaggtctggggccacctgcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtgaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8I5TL14_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pongo abelii GN=MCL-1 (length=594 residues).
atgttcggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggtgctggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccattgggcaggtctggggccacctgca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtgaaatcgttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C8YP84_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=600 residues).
atggacgggttattacccgcaaagccccccgcagcagaggcggaagaggaccatttgtactggcagtcgctggagattat
ctctcagtacttttgggagcaggcgaccggcgccaagggcccaaaaccaatggtcaggtttgggggcgccagcaggaagg
cgctagagaccttacgacgtgtcggggagagtgtgcagcgcagacacgatattgccttccaaggcatggttcgcagactg
gacatcagaaacgtagatggtgtgaaagatttgtctgaagtgatggtctgcgttttgaatgagagcgtaataagctgggg
caggattacgactctaatttcttttggtgcctgtgtggcgaaacacttgaagagcataaatcaagaaagatgcatcgaac
cattagcagaaagcatcacagacgttattgtaacgataaaacgtgactggctagtcgaacaaagaggctgggatgggttt
gtggagtacttccatgtagatgacctagaaggtgacatcagaaatgtgttgctggctgttgcaattgttgctggaatagc
agctggtttggtgtatctatctaatgggatgaccttctaa
>gnl|bcl2dbcds|A0A8C9AD42_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=441 residues).
gtgcgcaactctccggaagctgccgcccttttccccttttatgggattccgctgacgccgccgccgcctaggaccggcat
gcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcg
taacaaactggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaa
agctgcatcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagagg
ctgggatgggtttgtggagttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtg
ttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C9AD42_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgggggggccggactgggagccggcagcggcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagccg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctctcgccagacgcccggagggtcgcgcggccggcg
cccattggtgccgaggtccccgacgtcaccgcgacccccgaaaggctgctgtttttcgcgcccacccgccgcgcgttgcc
gtccgaggagatggaggcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggcctgctgtcctgcctttactggagttggtcggggaggccagtaatggctccagcatggacgggtcacta
ccctcgacgccgcctccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggaggcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8C9AD42_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Prolemur simus GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaatgcggtaatcggactcaacctctactgtgggggggccggactgggagccggcagcggcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggaggcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggaggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6F6N9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=411 residues).
gatctgtggattaacctggggatcagctgcgggcgggcagatctaggctgggcctggctgggtttgaaggccttccaagg
catgcttcagaaactggacatcaaaaacgaagacgatgtcaaatctttatcacgagtgatggtccatgttttcagtgaca
gcgtaacaaactggggcaggattgtgactttaatttctttttgtgcctttgtgtccaaacacttgaagaccataaaccaa
gagagctgcatcgaaccattagcagaaagtatcacagacattcttgtaaggacgaaacgagactggctattcttccatgt
agaagacctggaaggcagcatcagaaatgtgctgctggcttttgctggtgttgctggagtaggagctggtttgacttatc
taataagatag
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=813 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=1053 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggctgccgagaaggaggccacggcccggcgagaggtagggggaggggaagacg
gcacggtgattggcggaagccccggcgcaagccccccggcctccctcacgccagaagcccggagggtcgcgcggccggct
cccattggtgccgaagtccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacccgccgcgcattgcc
gtccgaggagatggaagcccctgccgccgacgccatcatgtcgcccgaagatgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagtaatggctccagcacggacgggtcacta
ccctcgacgccgcccccagcagaggaggaggacgacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagcaggaaggcgctagagaccttac
gacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6GI15_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Propithecus coquereli GN=MCL-1 (length=594 residues).
atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggattgggggccggcagcagcgg
cgccacccccccgggagggcggcttttggcaaccggcgccaaggacgcaaagccaatgggcaggtctggggccgccagca
ggaaggcgctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggcgtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A670Z5Q4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pseudonaja textilis GN=MCL-1 (length=555 residues).
tgtgaaagtatcaggctgcagcagaaaggaaactgcactttgtactgtgggggaggggggggcaaccttgcaggcaggtc
cccctccccccatttgcaggaaatgaccagacaaaaccaggatacgtttgtcccctctttgaccttctgtggtgctttgc
ctaaagtccttccttcccttcttaattcaggaatgctgaggaaagtgcagatcgacaaagcggatgacttgaagcttatg
tcggaagttgcaacgcaggttttcaacgatggcataacaaactgggggcgaattgtgactctcatttcttttggtgcctt
tgttgccaaacacttgaagagcataaatcaagaaagcggcatcagcactttggcggagatcatcacggaggtgctggtga
cagagaagagagagtggctgctgcatcacaacgcctgggagggctttgttaaattcttccatgtagaggacctggaaggc
agcatcagaaacattctggtggcttttgcgggcgtggctggcctaggagcgagcttggcttacttgatccggtga
>gnl|bcl2dbcds|A0A3B4G4Z6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pundamilia nyererei GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaacgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttactggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacgctcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|A0A3B4C341_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=669 residues).
ttattttcatttgtgtgggaattttctaggaaatggccatggaattttctttgggaaaaactgatcgcagctgttacaga
cggttctctaccaacgtcccccgcgtcggattgtgaggagttggactcagaccaattcaaggaatctgaaactttggaca
gagacacttcagaaatagtcattgactttttgcaaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggtt
gtacagacaataaggagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctggg
tatggaagacagaggagatgacatgcatataattaggacagtggctaaggagctcttcagcgatggcatcaccaactggg
gtcgaatcgccagcctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagt
cttgtgggccaagagatttcctcatatcttctttcagaccaaaaagactggctactgaaaaataaagcatgggatggctt
tgtggagttttttcatgtcccggatcccgagtcaaaaatgaggaatgcattaatggccttggttactgcagcaggtgttg
gagcaggacttgttttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4C341_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=735 residues).
atggtcaggctgttcggtgttgggttgagagtggtccactatgcaaaatatccaaagactgtttttccttctttgctggc
gaagcgaccttttactctgggtatatcctctcaaacccgggcgcccaggatcgcagctgttacagacggttctctaccaa
cgtcccccgcgtcggattgtgaggagttggactcagaccaattcaaggaatctgaaactttggacagagacacttcagaa
atagtcattgactttttgcaaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataag
gagggtggtggacggcctggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctgggtatggaagacagag
gagatgacatgcatataattaggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgccagc
ctgctggcctttggtgcagtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttgtgggccaaga
gatttcctcatatcttctttcagaccaaaaagactggctactgaaaaataaagcatgggatggctttgtggagttttttc
atgtcccggatcccgagtcaaaaatgaggaatgcattaatggccttggttactgcagcaggtgttggagcaggacttgtt
ttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4C341_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=717 residues).
atgatgatgagtcccaaggagatgtattttgataagaagactgtttttccttctttgctggcgaagcgaccttttactct
gggtatatcctctcaaacccgggcgcccaggatcgcagctgttacagacggttctctaccaacgtcccccgcgtcggatt
gtgaggagttggactcagaccaattcaaggaatctgaaactttggacagagacacttcagaaatagtcattgactttttg
caaaacttcaccgggctgtctcggtcctgtggtcggcaccgtggggttgtacagacaataaggagggtggtggacggcct
ggtggtgaagcatgagctcgtctacaaaggtatgtttactaggctgggtatggaagacagaggagatgacatgcatataa
ttaggacagtggctaaggagctcttcagcgatggcatcaccaactggggtcgaatcgccagcctgctggcctttggtgca
gtggtgtgccagcaccagaaccaaatgggccgaggtcactgcgtgagtcttgtgggccaagagatttcctcatatcttct
ttcagaccaaaaagactggctactgaaaaataaagcatgggatggctttgtggagttttttcatgtcccggatcccgagt
caaaaatgaggaatgcattaatggccttggttactgcagcaggtgttggagcaggacttgttttattgtcaagataa
>gnl|bcl2dbcds|A0A3B4CGU9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=801 residues).
atggaagctcacggtggagttcagatcaacatggcagctcatcctggaggcagtatctgtgctccggttctccatggaag
ttcttttggaggtccagtcacactgatatacctcatacacggaggtcagggaggttccagttccagctcagctcagacgg
gttctcctgctgctcctgaactcactcacgtccaggtcaacagcattagcattagcagcaccaaggagcaaaccaccatc
agcctgtgtgacggagaggtgaccgtgctgattaaaccgaaaccaaagggccgagtcaggctggaggaggagaccctctg
catcatcggggatttttaccagggatacaggagccgaaaccagcacccagcctcggacacgctgagcagagtggtggagg
ggatgctccacaaacacagtgttgcctacagcggtatggtccagcgattgtgtttggagcagcaagacgatagcatggag
tttattagcagtgtggcgaagaccctgttcaatgatgggaccaccaactgggggcggattgccagtctggtggcgtttgg
tgcggtggtctgtgagcagatgaaggaagcaggcagagagcagtgtgtggagaacgtcatacaacacatctcaacgtacc
tcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaagacgactcc
gagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactgatgcgctg
a
>gnl|bcl2dbcds|A0A3B4CGU9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=801 residues).
atggaagctcacggtggagttcagatcaacatggcagctcatcctggaggcagtatctgtgctccggttctccatggaag
ttcttttggaggtccagtcacactgatatacctcatacacggaggtcagggaggttccagttccagctcagctcagacgg
gttctcctgctgctcctgaactcactcacgtccaggtcaacagcattagcattagcagcaccaaggagcaaaccaccatc
agcctgtgtgacggagaggtgaccgtgctgattaaaccgaaaccaaagggccgagtcaggctggaggaggagaccctctg
catcatcggggatttttaccagggatacaggagccgaaaccagcacccagcctcggacacgctgagcagagtggtggagg
ggatgctccacaaacacagtgttgcctacagcggtatggtccagcgattgtgtttggagcagcaagacgatagcatggaa
tttattagcagcgtggcgaagaccctgtttgatgatgggatcaccaactgggggcggattgccagtctggtggcgttggg
tgcggtggtctgtgagtggctgaaggaggtgggcagagagcagtgtgtggagaacgtcatacaacacatctcaatgtacc
tcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaagacgactcc
gagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactgatgcgctg
a
>gnl|bcl2dbcds|A0A3B4CGU9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=MCL-1 (length=729 residues).
atggagagcgccgccatcagcctgttctgtaacggagcggggaggatcccgttcaacaagggctcggagagccagctgga
ccgcccggaccggcccgaccgcggcctggagggactacaggcagcgcccggacccgctagcaaggccgccatggccggag
ggtcgctgcccgagtccccggagtccgacgacttcgtgcccgacttcggcggcagcgccctggtggaggagacccggcgg
ctcatcgggggcttttaccgcggatatatcggccagaagacccgggaccagcaccccgcccacggcacgatgagcagggt
ggtggagggggtgatcctcaagcacagcatcgcgtacaacggtatggtccagcgattgtgtttggagcagcaagacgata
gcatggagtttattagcagtgtggcgaagaccctgttcaatgatgggaccaccaactgggggcggattgccagtctggtg
gcgtttggtgcggtggtctgtgagcagatgaaggaagcaggcagagagcagtgtgtggagaacgtcatacaacacatctc
aacgtacctcagtacagaccagcgacagtggctcatcaacaacaaagcctggggaggttttgtggagttcttccgtgaag
acgactccgagtcacgcgtacggaacgctcttatggccttcgcgggattcgctggcctgggggcggggctagcactactg
atgcgctga
>gnl|bcl2dbcds|A0A8I5Y8B7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rattus norvegicus GN=MCL-1 (length=543 residues).
aagtttggcctgcggagaaacggggtaatgggcttgaacctgtactgctataatcttgcgctacttgctacttgtgggag
caggcgaccggctccaaggacgctaagcctcttggcgaggtcccctggggcgggccagagggcgctggagaccctggggc
gcttgagcgatcaggtgcagcccaaccatgagactgccttccagggcgtgcttcagaaactggacattaaaaacgaagac
aatttcagtggtttccatgttttcaaagatggattaacaaactggggcaggatttcttttggtgcctttgtggccaaaca
cttaaagagcctaaaccaagaaagctgcatcgaacctttagcagaaagtatcacagaggttcttgtaaggaagaagcata
actggcttgtgaaacaaagaggctgggatgggtttgtggagttcttccacttacaggacctagaaggcagcatcagaaat
gtgctgctggcttttgtgggtgttgctggagtaggggctggtctggcatatctaataaggtag
>gnl|bcl2dbcds|A0A8I5ZM43_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rattus norvegicus GN=MCL-1 (length=582 residues).
atgtttggcctgtggagaaacactgtaatccccttgaacctgaactgtacagccagtcgctggagatcatctcctgctgc
ctgcgggagcagagacaggctccaaggacctgaagcctctgggagaggaccccgcggggcgggctggagggcactggaga
ccctgcagcgcatgggcaacagcacccagctcaaccaggagacagccttccagggcatgcttctgaaactggacattaaa
cacgaagacaatgttaaatctttttctcgagtgatgactcatgttttcaaagatggcgtaacaaactggggcaggattgt
gactcatttcttttggtgcctttgtggccaaacacttaaagagctgaaaccaagaaagctgcatccacctttagcagaaa
gtatcacaaaagttcttgttcttgtaaggacgaagcttaactggcttgtgaaacaaagaggatgggatgggtttgtggag
ttcttccacttacaggacctagaaggcagcatcagaaatgtgttgctggcttttgtgggtgttgctggagtaggggctgg
tctggcatatctaataaggtag
>gnl|bcl2dbcds|A0A671G0G2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=1044 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggggaggggaag
ccggtgcggtgattggcggaagcgccggcgcgagccccccggccactctcgcgccggacgcccggagggtcgcgcggccc
tcgcccattggcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctccttccgcgcgtc
gccgcttaaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggaggccagtaatggacccggtatgagcggctca
ctgccctctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgccagccgcaaggcgttagaca
cccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
aacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcag
aaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctggagaatgccagcaagacaa
gtgcacttcgaagcagaggagcaggacacaggaccaaaatcctggcccaagttgagttctgagcagtactgttgctcctg
ttga
>gnl|bcl2dbcds|A0A671G0G2_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=1059 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggccgcggggaaggaggccaccgcccggcgagaggcagggggaggggaag
ccggtgcggtgattggcggaagcgccggcgcgagccccccggccactctcgcgccggacgcccggagggtcgcgcggccc
tcgcccattggcgccgagagccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctccttccgcgcgtc
gccgcttaaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggaactggacgggtacgagccggagc
ctctcgggaagcggccggctgtcctgcccttgctagagcgggtcgaggaggccagtaatggacccggtatgagcggctca
ctgccctctacgccgccccccgcagaggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggta
ccttcgggagcaggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgccagccgcaaggcgttagaca
cccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaa
aacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaacaaactggggcaggattgt
gactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcag
aaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttc
ttccacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtcggagctggtct
ggcatatctaataagatag
>gnl|bcl2dbcds|A0A671G0G2_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=MCL-1 (length=597 residues).
atgctgggcctcaaaagaaacgcagtaatcggactcaacctctactgtggggggtccgggttaggggccggcagcggcgg
cagcgcctccccttcgggagagcggcttctggcgaccggcgccaaggacgcgaagccaatgggcaggtctgcgtccgcca
gccgcaaggcgttagacacccttcggcgggttggggacggtgtgcagcgcaaccacgagacggctttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgacgtcaaatctttgtctcgagtgatgattcacgtttttagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagct
gcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccacgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtcggagctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=816 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6KRW9_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus bieti GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6PPI3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6PPI3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=816 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcgaaagcgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
tcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatctggtaatagctccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttactgtaa
>gnl|bcl2dbcds|A0A2K6PPI3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttatctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagttgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K6V5X4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=1053 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A2K6V5X4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=813 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggccgcggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccctccggccgccctgacgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgcccgaagacgagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagctggtcggggagcctggtcatggctccagtacggacgggtcactc
ccctcgacgccgccgcccgcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtacctccg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccctgc
ggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
tctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataa
gatagccttgtaa
>gnl|bcl2dbcds|A0A2K6V5X4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=MCL-1 (length=594 residues).
atgttcggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccccccgggagggcggcttctggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccctgcggcgggtcggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggatctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A672GRK8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salarias fasciatus GN=MCL-1 (length=912 residues).
atgaatattatgtcgacgaacaccaaacgggccgggttatttggctgccttatttttccacaaaatggagtcatgcacta
cggatcagaggatcccacccatcagctccccatgggcgccggtgtggacactcttcacggtcacgtagagacccccaagc
gaccgaagaacctggatgtagctgcggtgaacgggtacgcgtcgaaaaacctccgggaggacagcgaagacgtggacgac
gggtctctgccgtgcacaccggagctgcactcggacagtgaagcggacgtgtcgtacagtgcagcggggagcgaagtgct
cgagagcgacacgaggcagctcctcagccgctacttctcggaatttaccggactttcaaagactcaaagaggcgaaagta
aacccttatctactatgaagagggtcgtggaggacattctggcgaagcacagatacgcatacaatggtatgatcaacaga
ttatctatggaagagagagggggagatttgaggttcctccagtctgtagccaggacccttttctcagatgggagcaccaa
ctggggtcgtattgccagcctggtggccttcggggcagttgtgtgtcaacacatgagggagcaaggcaggccagactgtg
tggagctggtgggccaggagatttccacatacctgctgagtgaacagagagactggctgatcaagaacaactcctgggat
ggttttgtagagttcttccatgtagcagaccctgagtctacggtcagaaacacgctcatggctgttgcaggatttgcagg
cataggggcaactctggccctgctcatcagctgtagtggtaaaggtttgaaaacgagtcccaggccaaaacgggaagagc
aagctgcactagtccctgttgtgcagccatga
>gnl|bcl2dbcds|Q0KFR9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo salar GN=MCL-1 (length=858 residues).
atgagyctgtcgaactcgattacacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctaggccgttgtactatttccagggggctggggccatatgtgctggggcgtcaccgaagtctaaagtggacttgg
gaaatgggactggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacggccttgataatcat
ttgtctgaccgaagcaacaatgacgactctttgccgtgcactccccagatggcgtcagaatgtgggcctgaactatcgaa
ttgtccatcgggcgatgaagtattggaacatgataccagacaactcattgagaattttttgggggactacacaggactgt
ctcagcctcgatggacgcaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatac
gcatacaatggtatggtcgccaaacttgacttggatgaccgatgcgatgacatgggcgtcatcaattctgtggccaagac
catgttcagtgacgggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctga
aggagaggggcaggggacactgcgttgagttggtgggccaagagattgccaaatacctcctctctgaccaaagtgactgg
ctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgtacaagatcctgagtcctcagtaaggaacaccct
cctagcctttgctggagttgctggaattggggcaacactcgccatgttcatcaggtga
>gnl|bcl2dbcds|A0A673VWA7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=858 residues).
atgagtctgtcgaactcgattacacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctaggccgttgtactatttccacggggctggggccatatgtgctggggcgtcaccgaagtctaaagtggacatgg
gaaatgggactggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacggcctcgataatcat
ttgtcagaccgaagcaacaatgacgactctttgccgtgcactccccagatggcgtcagaatgtgggcctgaactatcgaa
ttgtccatcgggcgatgaagtattggaagatgataccagacaactcattgagaattttttgggggactacacaggactgt
ctcaccctcgatggaaacaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatac
gcatacaatggtatggtcgccaaacttgacttggatgaccgatgcgatgacatgggcgtcatcaattctgtggccaagac
catgttcagtgatgggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctga
aggagaggggcaggggacactgcgttgagttggtgggccaagagattgccaaatatctcctctctgaccaaagtgactgg
ctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgtacaagatcctgagtcctcagtaaggaacaccct
cctagccattgctggagttgctgggattggggcaacactcgccatgttcatcaggtga
>gnl|bcl2dbcds|A0A674D165_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=921 residues).
atgctgaggttccaaagcgggctgctagcattccccgagttcaagttgtactcgaatgttgggtacgttacaatcgcagg
tacaaaacattgcattatctgtgcatcgccaccaggccaagatcattacatcgcgtgccctgagattggtaacctcctca
aaacaaagttgaagcatctgaaactgtcagggtctatcgacagcactcctttgttcactaggagaggacccggacatgag
tacagctggggaggcctcgaacccgatagcgccttagcttacgacaccacaaacttcggtgtactccttccacatacggt
tgacacacacaaatgtttcatgtgtaacctcgaaatcaacaactttatatcacatcaggaaacataccatcaccagaccg
gagccctggacaccgacaccaggcaactcattaaatgtgtcctaggacaatgtacgggacttctgaaacctaggtggaac
gaaagcaaagctctgtcaacaatgagtagagttgttggtcaattactggagaagcacagatacacatacaatggtatgat
caacacactctatgtggatgacagaggggatgacgtgaagttcctcagtgcagtagcccatatcatctttcaagacggga
ccgtcaactggggccgtgttgccagcctgacatcttttggagctgcggtgtgccagtacttgaaagacaaggggagagac
aactgtgtggaggtggcgggagaggagatatcagcgtacctggtcacacaccacaaggactggctagtcaaacataactc
ctggaatgggttcgtggagttctttccagtagcagaaccggagtccagatctaggaacattattatgacccctgttggat
tggctggtattggagcagcaatgaccttgttggttatgtga
>gnl|bcl2dbcds|A0A674D1T7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=558 residues).
tcaccgaatcggcttacggcgccctcaccatccagggaaggtacctaccctccgagggacatcacccgcaactcattaaa
tggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttgttggtcaat
tactggagaagcacagatacacatccaatggtatgatcaacacactctatgtggatgacagaggggatgacgtgaagttc
ctcagtgcagtaacccatatcatctttcaagacgggaccgtcaactggggccgtgttgccagcctgacatcttttggagc
tgcggtgtgccagtacttgaaagacaaggggagagacaactgtgtggaggtggcgggagaggagatatcagcatacctgg
tcactcaccacaaggactggctagtcaaacataactcctggaatgggttcgtggagttctatccagtagcagaaccggag
tccagatctaggaacattattattacccttgttggattggctggtattggagcagcaatgaccttgttggttatgtga
>gnl|bcl2dbcds|A0A674ELG3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=903 residues).
atgagtctgtcgtttacacgagccacaactacgattttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgc
tggtacccctttgtgctatttcggcgagactgtatgtgctggggcgtcaccgaagtcaaaagtggatactgacttgggta
atgggactggcgacaccccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtccagggtaatcatatc
tcagaccgaagcaacgatgacgactctgacggttctttgccgtgcactccacagatggcgtcagaatgtgggcctgaact
atcgaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaattgaaaacttattgggggactatacag
gactgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgcgaagcac
caatacgcatacaatggtatgatcgccaaacttgaactcgatgaccgaagcgacgacatgagtttcatcaattctgtggc
caagaccctgttcagtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagc
gcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaatatcgccacatacctcctctctgaccaaagg
gactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaa
cgccctcatagcctttgctggatttgctgggcttggggcaacgctcgccatgttgatcagacagttccctgctcaacccc
aggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A674ELG3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=867 residues).
atgagtctgtcgtttacacgagccacaactacgattttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgc
tggtacccctttgtgctatttcggcgagactgtatgtgctggggcgtcaccgaagtcaaaagtggatactgacttgggta
atgggactggcgacaccccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtccagggtaatcatatc
tcagaccgaagcaacgatgacgactctgacggttctttgccgtgcactccacagatggcgtcagaatgtgggcctgaact
atcgaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaattgaaaacttattgggggactatacag
gactgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgcgaagcac
caatacgcatacaatggtatgatcgccaaacttgaactcgatgaccgaagcgacgacatgagtttcatcaattctgtggc
caagaccctgttcagtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagc
gcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaatatcgccacatacctcctctctgaccaaagg
gactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaa
cgccctcatagcctttgctggatttgctgggcttggggcaacgctcgccatgttgatcagaaattaa
>gnl|bcl2dbcds|A0A674ELG3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=876 residues).
atgagtctgtcgtttacacgagccacaactacgattttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgc
tggtacccctttgtgctatttcggcgagactgtatgtgctggggcgtcaccgaagtcaaaagtggatactgacttgggta
atgggactggcgacaccccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtccagggtaatcatatc
tcagaccgaagcaacgatgacgactctgacggttctttgccgtgcactccacagatggcgtcagaatgtgggcctgaact
atcgaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaattgaaaacttattgggggactatacag
gactgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgcgaagcac
caatacgcatacaatggtatgatcgccaaacttgaactcgatgaccgaagcgacgacatgagtttcatcaattctgtggc
caagaccctgttcagtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagc
gcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaatatcgccacatacctcctctctgaccaaagg
gactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaa
cgccctcatagcctttgctggatttgctgggcttggggcaacgctcgccatgttgatcaggaattcagcagattag
>gnl|bcl2dbcds|A0A8D0E7Q9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salvator merianae GN=MCL-1 (length=1104 residues).
atgccattgttgaatcggaaagcgatggtgctgtgctgtgggagcgcctcgggcctggccccggcggcccctgtctcccc
cggcgcgggcggcggcggcggcggcggctgcggcggcccgttaacggccctggcgtcgccgttctcggcgccgcgcatcg
gcggcttcccctggccgcgcccgggcctggcggagggggcgccgctggggctgtacaggcccctggagggggcgccccgg
ccccgagcggcgccgcccgcccgggaaggaggaggaggaggaggaggagaagaagagctggacggcttcgagccggagga
cgaggcgcccgcgggcggcgggccggcctctcccgcgtcgccggcctcggagggcgaagactccgactcggccgcctcct
cctcctcgtcctcgtcctccgccgccgccgccgaccgccacgacgacctgcgccgggtgacgctggagctggtgcggcgc
tacctgcacgaggccgccgagcggagcgacgccaagccggcggcggcggcggcaacggcgggcggcggcaagaagctctt
tcagggcctcatgggccggttcgggaccccctcggcgggcgccccttccgccttggcttcctcctcgtcgtcgccctgcg
tggcccaggcgctggagaccctccgcagggtgggcgacgccattctcgacaagcaccagctggccttccaaggaatgctt
aagaagctggaaatcaagaatgaagaagacctcaagactgtatcagaagttgcaactcatgttttcagtgacggagtgac
aaactggggccggattgtgactctcatctcttttggtgcgttcgttgcaaaacacctgaagaccataaacaaagagaacg
gcatcagtacgttggcagacatcatcacagacgtgctggtgacagataagcgagaatggctgctgaaccacaatgcctgg
gaagggttcattaaattcttccacgtagaagacatagagggcagcatccgaaatgttctggtagcttttgcgggcgtggc
aggtgtaggagcaggtttggcgtacctgatccggccaccagaattgtctctgagtcagatgtaa
>gnl|bcl2dbcds|A0A8D0E7Q9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salvator merianae GN=MCL-1 (length=1077 residues).
atgccattgttgaatcggaaagcgatggtgctgtgctgtgggagcgcctcgggcctggccccggcggcccctgtctcccc
cggcgcgggcggcggcggcggcggcggctgcggcggcccgttaacggccctggcgtcgccgttctcggcgccgcgcatcg
gcggcttcccctggccgcgcccgggcctggcggagggggcgccgctggggctgtacaggcccctggagggggcgccccgg
ccccgagcggcgccgcccgcccgggaaggaggaggaggaggaggaggagaagaagagctggacggcttcgagccggagga
cgaggcgcccgcgggcggcgggccggcctctcccgcgtcgccggcctcggagggcgaagactccgactcggccgcctcct
cctcctcgtcctcgtcctccgccgccgccgccgaccgccacgacgacctgcgccgggtgacgctggagctggtgcggcgc
tacctgcacgaggccgccgagcggagcgacgccaagccggcggcggcggcggcaacggcgggcggcggcaagaagctctt
tcagggcctcatgggccggttcgggaccccctcggcgggcgccccttccgccttggcttcctcctcgtcgtcgccctgcg
tggcccaggcgctggagaccctccgcagggtgggcgacgccattctcgacaagcaccagctggccttccaaggaatgctt
aagaagctggaaatcaagaatgaagaagacctcaagactgtatcagaagttgcaactcatgttttcagtgacggagtgac
aaactggggccggattgtgactctcatctcttttggtgcgttcgttgcaaaacacctgaagaccataaacaaagagaacg
gcatcagtacgttggcagacatcatcacagacgtgctggtgacagataagcgagaatggctgctgaaccacaatgcctgg
gaagggttcattaaattcttccacgtagaagacatagagggcagcatccgaaatgttctggtagcttttgcgggcgtggc
aggtgtaggagcaggtttggcgtacctgatccggtga
>gnl|bcl2dbcds|A0A8C9XS62_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sander lucioperca GN=MCL-1 (length=813 residues).
atgtctttgaaactgcacgacaacatggacaaggctcccctgtttaccttgaaccgttggggactcctcgaaaccgacag
tgccggagcgtgctccagtgacttccgcatactgggaccgcaagcaaacatgcactacattcatggtacggttgacgctc
actattgtttcagttgtaagtgcacaattagcaactttgtggagaacgacaccttactgggtgaacacctctatcacagc
aacggcaattccttggcaggtgaacccggcatcaccttgatatcccgagactcgccggacaatgagactaggcaactcat
acaaaggtgcctagacgacttcacgggacttgtgaaacctacgtgggatgaaagcaaagctctgtctacaatgaaaagag
ttgtggctggcctattgcagaaatacagatgtgaatataatggtctggtcaaacgtgtattggagcattggaccagaaat
gatgacatggggtttgtcagccagatagctatgaacatgttcaatgatgggaccatgaactggggccgcattgccagctt
gatagcatttggtgctgctttgtgtcagcgcttcaatgagattggcaaagaggactgtgtggcgcgagtgggagaggaaa
tctccctgtacctgctgactgtccacacggactggctggttagaaacgactcctggaacggctttgtggagttctttcgg
gtcccagaccaggagtctactttgacaaacatactcctcacggctgctggatttgctggcattggggctgctctgacctt
gttgatcaattga
>gnl|bcl2dbcds|A0A8C9XY04_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sander lucioperca GN=MCL-1 (length=852 residues).
atgaatattattccggcgaaacggaccgcgttcaacgtaacgaccggagtcatgagctgttttattcatcctcaaaatgg
agtcgtggagggaccaattctctacggctcagggaattcctccccgcagattgcaatgggctcatctaaagaatctcaca
acggaaatgcggggtcaaacgataccctgaaacgaccgaagaacctgggagtgaacgggtatgtaacaaaaagcctccgg
gaggacaacgacgaaatcgaggacggctcattgccgtgtactccggagccagacggtgaaatcgacgtctccagttgccc
ggcaggtgatgcagtcctggagaacgacacgaggcaactcattggccgtttcctgagagactttactggactttcgaaag
caaagtggaatgaaagccgagcactagcaacaatgaaaagagttgtggagggcgttttggagaaacacagatacgcatac
aatggtatgatcaacaaattgtcattggatgaaagaacggatgacgccagttttgtcagtgcagtagccaagagcctctt
tgcagacggaaccaccaactggggtcgtatcgccagcctgctggccttcggggcagtggtgtcacaatacctgaaggagc
gaggcagggagaactgtgtggagctggtgggacaggagatctccacgtatttgctaagcgaccagcgggactggctggtc
aaaaacaatgcctgggatggctttgtcgagttcttcagagtagcagacccagagtccacagtgaggaacacactcatggc
ctttgctggatttgctggtattggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A7N4PRP1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=1152 residues).
atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgggcgccggcagcgg
cgccagcgcttccccgtccggcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccgccgcggctgg
acggaggggaagtgggagcgagcaccacgacgacggcagcggcggcggtagggttaaggggcggaagcggcggcgcgaat
ccccccgaccccgtggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggaggctcgcgacgtcaccgc
cccgccgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagccgcggacgcca
tcctatcccccgaggacgagctggacggttacgagcccgagctccccgggaagcggcccgctcgcctggccatgctgccc
ttggccagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccgaggaggacga
ggacgaggaggaggatgagttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggcggtcggcacca
aggacaccaagcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccagaggaaccacgag
acggctttccaaggtatgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactca
tgtgttcagtgacggggtgacgaattggggcagaattgtgactctcatttctttcggggcctttgtggcaaagcacttga
agagcataaaccaggaaagttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaaaagggactgg
ctgatgaagcagaagggctgggagatgcccctgtgtgacctcagatggtccctgcaacccagcccttctccagtaatgaa
ccttcttgtctccgagtattcaaaaggtagtggactgggtgtcttatgtgagcaaggttggcaatatctggtgctggtgc
ccttttggttagctttgctaaaggtgttttga
>gnl|bcl2dbcds|A0A7N4PRP1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=1080 residues).
atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgggcgccggcagcgg
cgccagcgcttccccgtccggcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccgccgcggctgg
acggaggggaagtgggagcgagcgcggcggtagggttaaggggcggaagcggcggcgcgaatccccccgaccccgtggtg
ccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggaggctcgcgacgtcaccgccccgccgagaccgttctt
tttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagccgcggacgccatcctatcccccgaggacg
agctggacggttacgagcccgagctccccgggaagcggcccgctcgcctggccatgctgcccttggccagagagggtggg
gacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccgaggaggacgaggacgaggaggaggatga
gttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggcggtcggcaccaaggacaccaagcccctac
gcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccagaggaaccacgagacggctttccaaggtatg
cttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactcatgtgttcagtgacggggt
gacgaattggggcagaattgtgactctcatttctttcggggcctttgtggcaaagcacttgaagagcataaaccaggaaa
gttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaaaagggactggctgatgaagcagaagggc
tgggaggggtttgtggaattctttcatgtagaggacctagaaggtggcatcagaaatgtgctgctcgcctttgccggtgt
tgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A7N4PRP1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=MCL-1 (length=1098 residues).
atgttaggcccttttaagaaaaacgccgtcatcggcctcaatctgtattgcgggggggccggcttgggcgccggcagcgg
cgccagcgcttccccgtccggcgggcgcctgctgactaatggcaaaggaacggcggtggagagttcgccgccgcggctgg
acggaggggaagtgggagcgagcaccacgacgacggcagcggcggcggtagggttaaggggcggaagcggcggcgcgaat
ccccccgaccccgtggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggaggctcgcgacgtcaccgc
cccgccgagaccgttctttttcgcgccgggcggccgctgctcgccccccgccgaggtggccgatggagccgcggacgcca
tcctatcccccgaggacgagctggacggttacgagcccgagctccccgggaagcggcccgctcgcctggccatgctgccc
ttggccagagagggtggggacacatcgagcaatgcccgcggctcactgccctcaacgccgcccccggccgaggaggacga
ggacgaggaggaggatgagttgtacgggcagtccttggagttgataacccgatacctccgcgagcaggcggtcggcacca
aggacaccaagcccctacgcagtgggaaggcactggagaccctgcggcgcgtgggagacggtgtccagaggaaccacgag
acggctttccaaggtatgcttcgcaaactggatatcaagaacgaagaggacattaaggccgtgtctcgcgtggtaactca
tgtgttcagtgacggggtgacgaattggggcagaattgtgactctcatttctttcggggcctttgtggcaaagcacttga
agagcataaaccaggaaagttgcatagacccgctagcagaaagcataacagatgtcctggttaaatcgaaaagggactgg
ctgatgaagcagaagggctgggaggggtttgtggaattctttcatgtagaggacctagaaggtggcatcagaaatgtgct
gctcgcctttgccggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D2AJ70_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sciurus vulgaris GN=MCL-1 (length=1053 residues).
atgtttggccttaaaagaaacgcagtaatcggactcaacctctactgtgggggcgctgggctaggggccggtagcggcgg
cgccactccgcctggagggcggctcttggccgcggagaaggaggccactgcacggcgagaggcagggggaggggaagccg
gcacggtgattggcggaagcgccggcgcgagccccccggccgctcaggcgcaagacgcccgaagggtcgcgcggccggtg
cccattggcgccgaggtccccgacgtcaccgcgaccccggcgaggcgactgttcttcgcgcccacctactgcgtgtcgcc
gccggaggagatggaagcccccaccgccgacgccgccatgtcgcccgaagaggaactggacggatacgagcccgagcctc
ttgggaagcgaccggctgtcctgcccttgctggagttggtcggggaggccagtaagagccccagcactgacgggtcacta
ccctcgacgccgcccccagcggaggaggaggacgacgagttgtaccggcagtcgctggagattatctctaggtaccttcg
agagcaggcaaccggcgccaaggacgcaaagccaatgggcggatctggggccgccagcaggaaggcgctagagaccctac
gacgggtcggggacggagtgcaacgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gatgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
aatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgcatcgaacctttagcagaaagta
tcacagatgttctcgtaaggacaaaacgggactggctggtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8D2AJ70_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sciurus vulgaris GN=MCL-1 (length=594 residues).
atgtttggccttaaaagaaacgcagtaatcggactcaacctctactgtgggggcgctgggctaggggccggtagcggcgg
cgccactccgcctggagggcggctcttggcaaccggcgccaaggacgcaaagccaatgggcggatctggggccgccagca
ggaaggcgctagagaccctacgacgggtcggggacggagtgcaacgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagatgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaa
ctggggcaggattgtgactctaatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaaagctgca
tcgaacctttagcagaaagtatcacagatgttctcgtaaggacaaaacgggactggctggtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C9VMU9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus GN=MCL-1 (length=966 residues).
atgtggacagcgagtagctacaagtgccgcgacgagacgctttctgtgaacgggttatacatgtttaataattcattttt
tccaaaaatgagtcagtcgatgatgaagcctcctcacaccagttttatggacatttgctgtccgggaaataaagctcgag
gtggaggaacgaactatcaggacggctcagacaaagcgccccaggtggctctggcctctgaggtggaggacgagctgctc
tacgggctggatgaggtggacagctgcctccgctctcccaaaacggggggaaaaggaactccaaaaaagctcgtcttgga
gaggctcgtcccgaagtcgaggagcggcggggtcgaggataatggttctctgccttgtactccgggcaactcgccgacga
cggaatgcggacaaatgtgcgagttccacgacaatcatggcgacgaattgttggagcgggagacgcacgagttgctgggg
gatttcctactgctgtacgctgggatgtttcaggggaagccgagacggagcagagctctgcgcaccatgcagcgcgtcgt
ggaagatgtgctcctgaagcacagatttacatacaaaggtatgatttcaaagcagaggctggagcaggaaagtgatgaca
tgggcttcattaaagctgttgcccagaacctcttcagtgatcaggtgacaaattggggccgcatcgttggcctggtagcg
tttggcgcagaggtgagcaagcacctgaaggagagtgggcgtgagcactgcatcgggacagttggggcacagatctctac
ttacctcctcactgagcaaagagagtggctgctcaacaataaggcctgggaaggatttgtggagttcttcaccattgaag
atgctgagtcggtggtgagaaattcccttcttgcatttgcaaccatggcgtggatagggctaggaattgcatacttcatg
aaatga
>gnl|bcl2dbcds|A0A8C9WE28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scleropages formosus GN=MCL-1 (length=840 residues).
atgagtatgtcaacgatgaaccgcgtttccgctgttagtctgctctgccccggtgttaaggccaaagttttcgaccaagg
cccgttcccagccgcctcgtccggctcctccaagctgccgagcgaggaggagctggacgacgtgtccgatgaggtggact
ccgctccggcccccatcaagtcctccagcaagctctccttccccggcggcttccagcagagctccaacgcggacggctct
ctgccaaactcccccccggactcgccggatagctccccggacgcgccgctggccgcctgctgcttcccgaaggctgacgc
gcagctcgagcgcgacacccgcgcgctcgtcggcgccttcctgcgctcgttcgcgggcctgagccgcggcgactgcgccc
agtcgcgcgcgctgcccgtgatgcggcgcgtggttgaagagctgctcgagaagcatcacctggtgtaccagggtatgatt
caaaagctggatgtagaccatcgagaagatgacactagttttgtcacagctgtggccaagaacctcttcagtgatggaca
caccaactggggccgcatcgccagcctcatcgcgtttggtgctgttgtctgccagcgtctgaaggacagcggcagggagc
actgtgtagacagtgtcgccagtcagatctcctcttacctagtgacagagcaacaagattggttgagcaacaataaaggc
tgggagggctttgttgacttcttccatattgaggacacggagtctctagtgagaaatgcccttatggctttcgcaggggt
tgcaggaattggggctggacttgctcttctcatccggtga
>gnl|bcl2dbcds|A0A2U9CJ81_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=873 residues).
atgaatatcattccttccacaaagcgggccgccttcaacgttacgaccggagtcatgggctgcctcattcttcctcaaaa
tggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagatcgccgtgggctccgtgatcgactccc
gcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccaggtctccgcaacgaaggcgtacgcggcc
aagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctgccctccaccccggagtcggacggcga
gcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccagggaactcattagccagttcctgagag
actatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacgatgaagagagtggtggaccgactggtg
gagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaacagaagggacgatgtgacgtttgtcgg
cgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctccagcctggtggcgttcggggccgtgg
tgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggcaggagatctccacatacctgctgacg
gaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaatttttccgagtagcagacccagagacgac
aatgaggaacacactgattggccttgctggatttgctggtgttggggcgacactggccctgttgatcaggtga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=834 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcaggaggattgctgaggcctga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=828 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcaggctcctgtggtaa
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=879 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcagtgggactctgactttcgctacatccgcttctcctccaagctgcgtaaaaaaatgccagcgctga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=903 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcagggacacgtgttcatcgctccaaagtgacctccaaccaacaaggcacattccaaagattttcagtt
tgcaaaacagaaggatcctctga
>gnl|bcl2dbcds|A0A8D3B2J3_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Scophthalmus maximus GN=MCL-1 (length=942 residues).
atgggctgcctcattcttcctcaaaatggagtcgtggagggagcgatgcactacggctcaggaaattccttgccgcagat
cgccgtgggctccatgatcgactcccgcggcgggaacgtcggcgccggggacgccccgaagcggcccaagaacctccagg
tctccgcaacgaaggcgtacgcggccaagagctgccgggaggacggcggcggcggcggcgacgtcggcggcggctctctg
ccctccaccccggagtcggacggcgagcacgacgtctccggttgtccggcggcggacgaggcgctggacagcttcaccag
ggaactcattagccagttcctgagagactatgtcgcgcgcacggacccgcggtggaccgacagcaaagcgctgtccacga
tgaagagagtggtggaccgactggtggagaagcacagatacgcatacaacggtatgatgaatagactgtccttggacaac
agaagggacgatgtgacgtttgtcggcgccgtagccaggagcctcttcggggacggcaacacaaactggggccgcgtctc
cagcctggtggcgttcggggccgtggtgagtcagcacctgaaggagacgggcagggggaactgcgtggagctcgtcgggc
aggagatctccacatacctgctgacggaccagcgagactggctggtgaaaaacaactcctgggagggctttgtggaattt
ttccgagtagcagacccagagacgacaatgaggaacacactgattggccttgctggatttgctggtgttggggcgacact
ggccctgttgatcagctgcagcagtgcaaatcgtctgttggggctgcacaaacatgccaacaaattttcagtggatcttg
cagcatcagtgaagcagtgcggcctggaaccccatagcttgcagaaacccttcagcaggtga
>gnl|bcl2dbcds|A0A8C9NTQ6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Serinus canaria GN=MCL-1 (length=561 residues).
atggaacaaactgcattttgcagagcccctggagtcccacatcgcccattttggctcttaccgtggcgcccaacgtgcgg
cacccttagtaggagcctgaatgagggatgtgggtgtccaggcctgcctgcagctggagctggcagctgtggtcccacat
tgctcattttggctcctgcccccgtgggttttgcagggatgctgaggaggctgcagatccagcaggaggaggacctgcag
agcgtggtggaggtggctgcccagatgttcagtgacggtgtcaccaactggggacgggtggtgaccctcatcaccttcgg
cgccttcgtggccaagcacctgaagagcatccagcaggagcagagcatcagcagcctggctggcatcatcaccgacgccc
tggtctcctccaagagggagtggctggagagccaggggggctgggagggctttgtggactttttccgcgtggaggacctg
gagggcagcatccggaacgttctgatggccttcgcgggggtggccggcctgggggccagcctggcctacatgatccggtg
a
>gnl|bcl2dbcds|A0A3B4T8L9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Seriola dumerili GN=MCL-1 (length=861 residues).
atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaactattgcatttgtcgtcaaaatggaggattgga
aacttggaccgacggctccggagactcctcgccggagattgccattggctctacaatatgttctcacaacgggaatgttg
tgccaaatgataattctaaacggcccaagagcctggaagtcacctcaacaaatgggtatgcaacaaaagcgagtcgggag
gacagcgacgtcgacgacggctctttgccgtgtactccggagattcagtcggacggagaaaccgatgtccctagttgtcc
agcaggggatgaagtgttggaggacgatacgaggcaacttattagccagtccatgaaaagctttaccggacgctcgatac
cgcggtggactgaacacagagcactacaaacaatgaagagggttgtggacggcgttttggaaaaacacagatacgcatac
aatggtatgatcaacaaactgtcactggacaacacaggggatgatgtgaggtttgtcggtgcagtagcgaagagcctgtt
cgcagatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggcggtggtgtgtcagcgcatgaaggaga
caggcagggagaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctgatcagcgagactggctggtg
aaaaacaactcctgggatggctttgtagcgttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggc
ctttgctggatttgcgggaatcggcgcaacactggccctgttgatcagcgccatgatgtga
>gnl|bcl2dbcds|A0A3B4T8L9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Seriola dumerili GN=MCL-1 (length=948 residues).
atgaatcttattcagtcgccgaaaccgaccgcttttacggccatgaactattgcatttgtcgtcaaaatggaggattgga
aacttggaccgacggctccggagactcctcgccggagattgccattggctctacaatatgttctcacaacgggaatgttg
tgccaaatgataattctaaacggcccaagagcctggaagtcacctcaacaaatgggtatgcaacaaaagcgagtcgggag
gacagcgacgtcgacgacggctctttgccgtgtactccggagattcagtcggacggagaaaccgatgtccctagttgtcc
agcaggggatgaagtgttggaggacgatacgaggcaacttattagccagtccatgaaaagctttaccggacgctcgatac
cgcggtggactgaacacagagcactacaaacaatgaagagggttgtggacggcgttttggaaaaacacagatacgcatac
aatggtatgatcaacaaactgtcactggacaacacaggggatgatgtgaggtttgtcggtgcagtagcgaagagcctgtt
cgcagatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggcggtggtgtgtcagcgcatgaaggaga
caggcagggagaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctgatcagcgagactggctggtg
aaaaacaactcctgggatggctttgtagcgttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggc
ctttgctggatttgcgggaatcggcgcaacactggccctgttgatcaggtgtttgtttgagcggtccaggccaaagcagg
aagggaaaattgcattttttccaatgtcatgcagtcgtgaagcccatttccatagagctcattcataa
>gnl|bcl2dbcds|A0A3B4XKA5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=MCL-1 (length=858 residues).
atgaatcttatccaggcaccgaaacaggccgctttaaccgccgtgaactattgcatttgtcgtcaaaatggaggattgga
gacttggagggacagctccggagactcctcgccggagattgccattggctctacattatgttgtgacaacgggaatgttg
tgccaaatgataattctaaacggcccaagagcctggaagtcacctcaacaaatgggtatgcaacaaaagcgagtcgggag
gacagcgacgtcgacgacggctctttgccgtgtactccggagatgcagtcggatggcgaaaccgacgtccctagttgtcc
agctggggaagtgttggagtccgatacgagtcaactcattagccagtccatgaaaagctttaccggacggtcgatacagc
ggcggactgaacacagagcactacaaacaatgaagagggttgtggaaggcgttttggaaaaacacagatacgcatacaat
ggtatgatcaacaaactgtcactggacaacagaggggatgatgtgaggtttgtcggtgcagtagcgaagagcctgttcgc
agatggcaccacaaactggggtcgcatcgccagcctggtggccttcggggtggtggtgtgtcagcacatgaaggacacag
gcagggagaactgtgtggaatctgtggggcaggagatctccaaatacctgctgtctgatcagcgagactggctggtgaaa
aacaactcctgggatggatttgtatcgttctttcgagtagcagacccagagtctaaagtgaggaacacactcatggcctt
tgctggatttgcgggaatcggcgcaacactggccctgttgatcagcgccatgatgtga
>gnl|bcl2dbcds|A0A671L9M9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=744 residues).
atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttagtcgcaagccacttgtaatgccagaactgaaagcccagaaccagttcacagggaacggtctccaag
gctcggtaccatcctcgcctgagacggactgcgaggaaatagatgattacacctccatctacgccgccctggaaatggac
acgcgagagattattgacgctttcttaaaaagctttacaggactctctcattataaaagtggaaaaaaacaggttctgtc
tacgatgaagggggttgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatctgg
agcagaaaggagaagatgtgaggtttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactgggggcgc
atttgcagcctgctgacttttggggcaatggtatgcaagcatcaaaatgatagaggacttggcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggatggctttgtgg
aattttttcatgtcccggatacagaggcagctatgagaagcacattgatggtcattggtggtgtggcaacattcggagct
gctcttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A671LAP7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=693 residues).
atgactctgagtttggggaatagaccgatggctgcgttgggtgtcctcgcggaggaagcggacgccgcgctgaagccgct
gaggcccgggaccaacggcctgaaaggcctgcagctggacggacggttcgtgtccgcgggagacggctctctaccggcca
ccccggacccgcaggagctcggttccgacacgcggcagcttctgttggatttctatcgcacgcacaccggaatgagtctc
ccggaccggaagcgtcatcacgcgttaccgacaatgaaacgcgtcgtcgcggacgtcgtcataaagcaccagatcactta
cagagggatgctgcagcatctgcagctggactctcagccggacgacttgagcttcatcggctgtatagcaaagacgatgt
tcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaaggag
ctgcagagagagcggtgcgtggagactgtggcccagcagatctcctcctatctgatctcagaacagcacgactggctgct
caacaacaagggctggcatgggttcgtggagttcttccgcgtggaggacgtggagtctgtggttcgcagcgctctgatgg
cggttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A671LEY4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=783 residues).
atgactctgagtttagtcagaagaacggctgcggtgagtctgctcggcgcgcacacggcgctcgtgcccgcggccgcact
caaagcgcggagcgaggacgagctcgacgggtgcgcggatgaaccggacgccgcggggaagccggtaagaccgggagcga
acggcctgagaggactacagctggacggacgcttcgtttccgcggcggacggatctctaccgagcacaccggacccgcag
gagctcggttccgccgaactggaccgcgacacgagacagcttttgttggatttctaccgcacgcacaccggaatgtgtcc
acaggaccggaagcagcaccacgcgttaccgacaatgactcaagttgtcgcggacattctcctaaagcacgagatcgcat
acaaaggaatgttgcagcgtctgcagctggaatctcaagcggacgacatgagcttcatcagctgtatagcagagacgatg
ttcaacgacaacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaagga
gctgcagagagagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctcagaacagcacgactggctgc
tcaacaacaagggctggcatggattcgtggagtttttctgcgttgaggatgtggagtctgtgattcgtaatgctttgatg
gctgtggtgggatgcgctgggatcggcgccggtcttctctttaaaaataattgtgaagtctga
>gnl|bcl2dbcds|A0A671RQ00_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=MCL-1 (length=747 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaacgtcaacagcag
ctcgggcgggcttggtcgcaagccactggtaatgccagaacggaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctaaaccggattgcgaggaagtacaagatgaatacacgtccatctacgacgccctggaaatg
gacacacgagagattattgacattttcttaaagaactttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacgaactggtttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacggaactcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttacttttggggcaatggtatctaagcatcagaatgataaaggacttagcaagtgtgtgagtct
ggtggggaaagagatctcttcctatcttctcacaacccagcgggactggctgctcaaaaacaaagcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggtagtgtggctacattcgga
gctgcacttgcttatttgacacggtga
>gnl|bcl2dbcds|A0A672K136_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=366 residues).
atgctgcagcgtctgcagctggaatctcaagcggacgacatgagcttcatcggctgtatagcagagactatgttcaacga
caacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaaagagctgcaga
gggagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctccgatcagcacgactggctgctcaacaac
aagggctggcatggattcgtggagtttttccgcgtggaggatgtggagtctgtgattcgtaatgctttgatggctgtggt
gggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A672KAT0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=426 residues).
cctgatgatccgacgatagctgctcgcatctcagcttgtctatatatattttctgcagggatgctgcagcgtctgcagct
ggactctcagccggacgacttgagcttcatcggctgtatagcaaagacgatgttcagagatgacaccactaactggggcc
gggtcgtgagtctggtggccttcggagctgtggtgtgctcacagctgaaggagctgcagagggagcggtgcgtggagacg
gtggcccagctgatctcctcttatctgatctcagaacagcacgactggctgctcaataacaagggctggcatgggttcgt
ggcgttcttccgcgtggaggacatggagtctgtggttcgcagcgctctgatggctgttgtgggatgtgctgggatcggcg
ccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A672KMK1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=744 residues).
atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccacttgtaatgccagaactgaaagcccagaaccagttcacagggaacggtctccagg
gctcggtaccatcctcgcctgagacggactgcgaggaaatagatgattacacctccatctacgccgccctggaaatggac
acgcgagagattattgacgctttcttaaaaagctttacaggactccctcattctaaaagtgaaaaaacccaggttctgtc
tacgatgaagcgggttgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatctgg
agcagaaaggagaagatgtgagttttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactgggggcgc
atttgcagcctgctgacttttggggcaatggtatgcaagcatcaaaatgatagaggacttggcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggatggctttgtgg
aattttttcatgtcccggatacagaggcaactatgagaaacacattgatggccattggtggtgtggcaacattcggagct
gctcttgcttatatgatacggtga
>gnl|bcl2dbcds|A0A672PT04_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=747 residues).
atgtcactgagccccgcattaccccgtgagtcagagggtgaagcttcagtgctttcacacacgactaatctgagctcagc
gctcgctctcacagcttgcacgcagcacgcagcacgcagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnntcgtttccgcggcggacggatctctaccgagcacaccggacccgcaggagctcggttccgccgaactggaccgc
gacacgagacagctcttgctggacttctaccgcacgcgcaccggaatgtgtccgcgggaccggaagctgcatcacgcgct
accgacggtgactcgcgttgtcgcggacgttctcgtgaagcacgagatcgcgtacaaaggaatgctgcagcgtctgcagc
tggaatctcaagcggacgacatgagcttcatcggctgtatagcagagactatgttcaacgacaacaccaccaactggggc
cggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtctgaaagagctgcagagggagcggtgcgtggagac
ggtggcccagcagatctcctcctatctgatctccgatcagcacgactggctgctcaacaacaagggctggcatggattcg
tggagtttttccgcgtggaggatgtggagtctgtgattcgtaatgctttgatggctgtggtgggatgcgctgggatcggc
gccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A672PT04_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=621 residues).
gtccagaagccggcccgtgtgaggggaggagtttcggggaaatccgtgacgcagcacgcagcacgcagcaccacaccgga
cccgcaggagctcggttccgccgaactggaccgcgacacgagacagctcttgctggacttctaccgcacgcgcaccggaa
tgtgtccgcgggaccggaagctgcatcacgcgctaccgacggtgactcgcgttgtcgcggacgttctcgtgaagcacgag
atcgcgtacaaaggaatgctgcagcgtctgcagctggaatctcaagcggacgacatgagcttcatcggctgtatagcaga
gactatgttcaacgacaacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcgtc
tgaaagagctgcagagggagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctccgatcagcacgac
tggctgctcaacaacaagggctggcatggattcgtggagtttttccgcgtggaggatgtggagtctgtgattcgtaatgc
tttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A672RP45_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=747 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaatgtcaacagcag
ctcgggcgggctgggtcgcaagccactggtaatgccagaactgaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaatacacgtccatctacgacgccctggaaatg
gacacacgagagattattgacattttcttaaaaaacgttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacagaagtcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttgcttttggggcagtggtatgcaagcatcagaatgataaaggacttagcaagtgtgtgagtct
ggtggggaaagagatctcttcctatcttctcacaacccagcgggactggctgctcaaaaacaatgcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggcagtgtggctacatttgga
gctgcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A672RP45_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=702 residues).
atgtggagcgcattttacgtgcggaacctgatcagctcgggcgggctgggtcgcaagccactggtaatgccagaactgaa
accccagaaccagtttacagggaacggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagtacaag
atgaatacacgtccatctacgacgccctggaaatggacacacgagagattattgacattttcttaaaaaacgttactgga
ttccctcattctaaaagtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacga
actggcttacaaaggtatgattgcacgtctgaatctggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaa
cagaagtcttcagcgatggcatcacaaactggggtcgcattgccagcctgcttgcttttggggcagtggtatgcaagcat
cagaatgataaaggacttagcaagtgtgtgagtctggtggggaaagagatctcttcctatcttctcacaacccagcggga
ctggctgctcaaaaacaatgcatgggatggctttgtggaattttttcatgtcccaaatacagaagcggctgtgagaaaca
cattgatggccattggcagtgtggctacatttggagctgcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A672RP45_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=MCL-1 (length=933 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaatgtcaacagcag
ctcgggcgggctgggtcgcaagccactggtaatgccagaactgaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaatacacgtccatctacgacgccctggaaatg
gacacacgagagattattgacattttcttaaaaaacgttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtgatgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacagaagtcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttgcttttggggcagtggtatgcaagcatcagaatgataaaggacttagcaagtgtgtgagtct
ggtggggaaagagatctcttcctatcttctcacaacccagcgggactggctgctcaaaaacaatgcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggcagtgtggctacatttgga
gctgcacttgcttatttgatacggtcatccgtggggtctaatgaggactatggtaatgacacacacagggcctcacctga
tcctccagctcactgctgcaacacctgctgtggttacctgagccaggcggcacatggctgttatactcagtggaatacaa
gtaaagccatgcgacagtacatgtcaagtcaagtcaagtcaccttttatatag
>gnl|bcl2dbcds|A0A673GSK0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=837 residues).
atgctgaaaatacagctgcgcatcacagaaataaattacagtttaacagatattcacatagaaaacagttattttaaata
tttagtcagaagaacggctgcggtcagtctgctcggcgcgcacacggcgctcgtgcccgcgcccgcactcaaaccgcgga
gcgaggacgagctcgacgggtgcgcggatgaaccggacgccgcggtgaagccggtaagaccgggaaccaacggcctgaag
ggactgcaactggacggacgcttcgtttgcgcggcggacggatctctaccgaacacaccggacccgcaggagttcggttc
cgccgaactggatcgcgacacgagacagctcttgttggatttctaccgcacgcacaccggaatgtgtccgcaggaccgga
agcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaagcacgagactacattcaaaggaatg
ttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatcagctttatagcagagacgatgttcagagacga
caccaccaactggggccggatcgtgagtctggtggccttcggggctgtggtgtgctcgcgtctgaaagagctgcagaggg
agcggtgcgtggagacggtgacccagcagatctcctcctatctgatctcagaacagcacgactggctgctcaacaacaag
catggattcgtggagtttttccacgtggaggatgtggagtctgtgattcgtaatgctttgatggctgtggtgggatgcgc
tgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673GSK0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=621 residues).
ataccgggaaccaacggcctgaagggactgcaactggacggacgcttcgtttgcgcggcggacggatctctaccgaacac
accggacccgcaggagttcggttccgccgaactggatcgcgacacgagacagctcttgttggatttctaccgcacgcaca
ccggaatgtgtccgcaggaccggaagcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttctcttaaag
cacgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatcagctttat
agcagagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggctgtggtgtgct
cgcgtctgaaagagctgcagagggagcggtgcgtggagacggtgacccagcagatctcctcctatctgatctcagaacag
cacgactggctgctcaacaacaagcatggattcgtggagtttttccacgtggaggatgtggagtctgtgattcgtaatgc
tttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673GSK0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=708 residues).
ctaagctttaaccttcgacgttcagaccgactcgaagacgagctcgacgggtgcgcggatgaaccggacgccgcggtgaa
gccggtaagaccgggaaccaacggcctgaagggactgcaactggacggacgcttcgtttgcgcggcggacggatctctac
cgaacacaccggacccgcaggagttcggttccgccgaactggatcgcgacacgagacagctcttgttggatttctaccgc
acgcacaccggaatgtgtccgcaggaccggaagcagcatcacgcgctaccgacaatgactcgcgttgtcgcggacgttct
cttaaagcacgagactacattcaaaggaatgttgcagcgtctacagctggaatctcaagcagacgacatgagcttcatca
gctttatagcagagacgatgttcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggctgtg
gtgtgctcgcgtctgaaagagctgcagagggagcggtgcgtggagacggtgacccagcagatctcctcctatctgatctc
agaacagcacgactggctgctcaacaacaagcatggattcgtggagtttttccacgtggaggatgtggagtctgtgattc
gtaatgctttgatggctgtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A673HSI2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=693 residues).
atgactctgagtttggggaatagaccgatggctgcgttgggtgtcctcgcggatgagacggacgccgcgctgaagccgct
gaggcccgggacgaacggcctgaaaggactgcagctggacggacggttcgtgtccgcgggagacggctctctaccggcca
ccccggacccgcaggagctcggttccgacacgcagcagcttctgttggacttctatcgcacgcacaccggaatgagtctc
ccggatcggaagcgtcatcacgcgttaccgacaatgaagcgcgtcgtcgcggacgtcctcataaagcaccagatcactta
cacagggatgctgcagcgtctgcagctggactctcagccggacgacttgagcgtcatcgactgtatagcaaagacgatgt
tcagagacgacaccaccaactggggccggatcgtgagtctggtggccttcggggccgtggtgtgctcgcagctgaaggag
ctgcagagggagcggtgcgtggagacggtggcccagcagatctcctcctatctgatctcagaacagcacgactggctgct
caacaacaagggctggcatgggttcgaggagttcttccgcgtggaggacgtggagtctgtggtccgcagcgctctgatgg
ctgttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatga
>gnl|bcl2dbcds|A0A673IXK8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=747 residues).
atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcattggaataacagctcttaacgtcaacagcag
ctcgggcgggcttggtcgcaagccactggtaatgccagaactgaaaccccagaaccagtttacagggaacggactccagg
gctcggtaccatcctcgcctgagccggattgcgaggaagtacaagatgaatacacgtccatctatgacgctctggaaatg
gacacacgagagattattgacattttcttaaaaaactttactggattccctcattctaaaagtgggaataaacaggttct
ggcaacgatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
tggagcagaaaggagaagatgtgagtttcgtcaagactgttgcaacagaactcttcagcgatggcatcacaaactggggt
cgcattgccagcctgcttactcttggggcaatggtatgcaagcatcagaatgataaaggacttagcaagtgtgcgagtct
ggtggggaaagagatctcttcctatcttctcataacccagcgggactggctgctcaaaaacaatgcatgggatggctttg
tggaattttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggccattggtagtgtggctacattcgga
gctgcacttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A673MXF5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=MCL-1 (length=744 residues).
atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcattggaatagcagctcttaacgtcaacaacag
ctcgagcgggtttggtcgcaagccacttgtaatgccagaactgaaagcccagaaccagttcacagggaacggtctccagg
gctcggtaccatcctcgcctgagacggactgcgaggaaatagatgattacacctccatctacgccgccctggaaatggac
acgcgagagattattgacgctttcttaaaaagctttacaggactccctcattctaaaagtggaaaaaaccaggttctgtc
tacgatgaagcgggttgtggacagtctcgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatctgg
agcagaaaggagaagatgtgagttttgtcaagactgtggcaacagaactcttcagcgatggcatcacaaactgggggcgc
atttgcagcctgctgacttttggggcactggtatgcaagcatcaaaatgatagaggacttagcaagtgtgtgagtctggt
gggggaagagatctcttcctatcttctcacagaccaacgggactggctgctcaaaaacaaagcatgggatggctttgtgg
cattttttcatgtcccggatacagaggcagctatgagaaacacattgatggccattggtggtgtggcaacattcggagct
gctcttgcttatttgatacggtga
>gnl|bcl2dbcds|A0A671VEU3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata GN=MCL-1 (length=870 residues).
atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttcaaaatggagtcgtaggtggaacgatgcacta
cgactcaagagattccgctccggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcgggtctaacgaca
cgccgaaacggccgattaaccttggagtgaacacggcgaaggcgtataatgtaccgaaaaacctccgggaggacagcgag
gacctcgaggacggctctttaccgtgtactccagagctacagtccgaaaacgacatggatatctccagttgtccagcagg
ggacgagcttctggatcaagacacaaggcaattgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgttttggaaaagcacagatacgcgtacaatggt
atggtcaaaaaattgacactggatgagagggaggatgcaagttttgtcagctcagtagccaagagcctttttgcagacgg
gaccacaaactggggccgggtcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaaggagaaaggcaggg
gccactgtgtggagcaggtgggacaggagatctcgacctacctgctgacggagcagagagactggctggtcaagaacaac
tcttgggatggctttgttgagttcttcagagtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
atttgctggtattggagcaacgcttgccctgttgatcaggtgtgatcttcgactctcacgaccggagtga
>gnl|bcl2dbcds|A0A671VEU3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata GN=MCL-1 (length=894 residues).
atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttcaaaatggagtcgtaggtggaacgatgcacta
cgactcaagagattccgctccggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcgggtctaacgaca
cgccgaaacggccgattaaccttggagtgaacacggcgaaggcgtataatgtaccgaaaaacctccgggaggacagcgag
gacctcgaggacggctctttaccgtgtactccagagctacagtccgaaaacgacatggatatctccagttgtccagcagg
ggacgagcttctggatcaagacacaaggcaattgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgttttggaaaagcacagatacgcgtacaatggt
atggtcaaaaaattgacactggatgagagggaggatgcaagttttgtcagctcagtagccaagagcctttttgcagacgg
gaccacaaactggggccgggtcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaaggagaaaggcaggg
gccactgtgtggagcaggtgggacaggagatctcgacctacctgctgacggagcagagagactggctggtcaagaacaac
tcttgggatggctttgttgagttcttcagagtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
atttgctggtattggagcaacgcttgccctgttgatcagcccgagggtgagtcgaggagaagttcatgagatgacctcat
cgtcggcagaataa
>gnl|bcl2dbcds|A0A671VEU3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sparus aurata GN=MCL-1 (length=843 residues).
atgtttccgaaaaaggctgcaatcacgacgggagtcatgagctactttcaaaatggagtcgtaggtggaacgatgcacta
cgactcaagagattccgctccggagatcgcgatgagctcgtctctggactctcaaaacgggaacgtcgggtctaacgaca
cgccgaaacggccgattaaccttggagtgaacacggcgaaggcgtataatgtaccgaaaaacctccgggaggacagcgag
gacctcgaggacggctctttaccgtgtactccagagctacagtccgaaaacgacatggatatctccagttgtccagcagg
ggacgagcttctggatcaagacacaaggcaattgatcagccggttcctggcagtgtatacaggactttctaaacttcggt
ggaaggaaaacaaagaactatcaacaatgatgagagttgtggaaggcgttttggaaaagcacagatacgcgtacaatggt
atggtcaaaaaattgacactggatgagagggaggatgcaagttttgtcagctcagtagccaagagcctttttgcagacgg
gaccacaaactggggccgggtcgtcagcctgatggccttcggggcggtggtgtctcagtacctgaaggagaaaggcaggg
gccactgtgtggagcaggtgggacaggagatctcgacctacctgctgacggagcagagagactggctggtcaagaacaac
tcttgggatggctttgttgagttcttcagagtagcagatccagagtccacagtgaggaacactctcatggcatttgctgg
atttgctggtattggagcaacgcttgccctgttgatcaggtga
>gnl|bcl2dbcds|A0A8C9QEN4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Spermophilus dauricus GN=MCL-1 (length=441 residues).
atgttcggccttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcggcat
gcttcggaagctggacatcaaaaacgaggatgatgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacggag
taacaaactggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagagcataaaccaagaa
agctgcattgaacccttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggctggtcaaacaaagagg
ctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggctttcgcaggtg
ttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D0G5J1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sphenodon punctatus GN=MCL-1 (length=1140 residues).
atgttagcgatgaagcgaagcgcggtgatcggactcaatctctactgcgggggcggcccggccttggctccggcttcgcc
cgcgtctccggggggcggcggcggcgcccctcccgcctcggcctcccccaacggcccggctgaggcggggggcgcgcggc
cgccgctgattggcggagccccctgggcccctcgcgacccctcggccgagccgcgcgctctgattggcggggcgctgccg
cgcgagggtcccccggctgaggagccccgcgctctgattggcaggggggccccggccgaggcgccccgcgtcctgattgg
cggcggcggcagcggcgggccccggccggcctcgctctggcacccggaggacgagctggacggctgcgacccggagctgc
ggcgcggggccccggacggctccagcgacgccgagtccccgccgggcaccccgatgccggaggggggccccggccagggc
tcggcctcgggcccggacctgctcgcccaggagtcgctggagctgatcgggcgctacctgcgcgaggcggccggggccag
cccgcccggcggctccaagctgctcaaggggctgctggggcggccgcgcggcgagacccagcgggcgctggagaccctgc
ggcgcgtcggggacagcgtcctccagaaccaccggctcgccttccaggggatgcttaggaagctgaatatcaagaatgaa
gatgatctgaagtctgtgtcagaagttgcaacccatgttttcagtgatggggtaacaaactggggtagaattgtgactct
catctcttttggtgcctttgttgcaaaacacctgaaaagcctaaaccaggagaactgcattgataggctagcagagatca
tcacagatgtgctcataacagacaagcgggaatggctggtcaaccaacgagcttgggagggatttgttgaattcttccac
gtagaggacctagaaagcagcatcagaagtgttctgatggcttttgcgggtgtggctggattgggcgcaagcttggcata
catgatgcggtgtttaagtggagaaactgcattctgcttccttgaggagcatcatgaaaggaagcagaggacaacttcaa
agagaagttcttttccctaa
>gnl|bcl2dbcds|A0A3B4ZKP6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Stegastes partitus GN=MCL-1 (length=855 residues).
atgaacattattccgacgacgaaacggacggcgctcatgagctgctttattcttcctcaaaatggagtcgttgagggaca
gatgcactacggatcaggagatccctccgcacagatccccatggcctcccctttggactcacacaacgggaatgtcggct
ccggcgccaccccgaagaggcccaagaacctgggagtgtccacgacgaacgggtttgcgggaaagggcctccgacaggtc
agcgacagcctggaggacagctcgctaccgtgcactccggagctacagtcggacagtgaaaccgacgtgtcgagttgccc
ggcgggggacgaggtgctggagaatgacacgaggcaactgattagcagcttcctaaaagactttactggactttcaaagc
ctcggtggaacgagggcaaagcattatctacaatgaaaagagttgtggaggacgttttggaaaagcacagatacgcgtac
aacggtatgatcaacaaactgtcgctggatgacagaggggacgatgtgtcgtttgtcagtgccgtagccaagagcctctt
cgcagacaggaccaccaactggggtcgcatcaccagcctggtggccttcggggcagtggtgtgccagtacctgaaggaga
ggggcagggagaactgcgtcgacctggtgagcgaggagatttccacatacctgctctgcgatcagcgagactggctggtg
aagaacaactcatgggatggctttgtagagtttttccgagtggcagaccctgaactgacggtcaggaacacactcatggc
ctttgctggatttgccggtattggggcgacactggccctgctgatcaggtcatga
>gnl|bcl2dbcds|A0A672UZL1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Strigops habroptila GN=MCL-1 (length=894 residues).
atgttcgcgctcaagcggaacgcggtcatcggcctcaacctctactgcggcggcagccccgcgctggcccccgctcccgc
cgcaccgggagggggcccggccccgccgccgccctccgcggcccccgcgggggcttgggccgccgggcgcgctgaggcgc
tgctgggctgcggcgcggccccgctgcccgccccggccccgctgcccgccccggcgcggccggtgccgctctggagcccc
gaggaggagctggatggctgcgagcccgagcccgagcgcggccccgcgggggactcgctgcccgcgccgccgcccgacgc
gctgcgccaggcctcgctggagctcatcggccgctacctgcgggaggcggcgggcgaggccgagcccggagccaagaagc
tgttcccggggctgctgggcgggcccggccggcccggaggggcggcggatgcggtgatggggaaggcgctggagacgctg
cggagggtcggcgacggcgtcatggcgaagcacgaactcgccttccagggaatgcttcggaagctggaaatccagaagga
ggaggacctgcagtcggtgcgagaggtggctgcgcacttgttcagtgacggagtgaccaactggggccgggtggtgacgc
tcatctccttcggggccttcgtcgcgaagcacctgaagagcatccagcaggagaagtgcatcagctccctggcagggatc
atcacggacgcgctcgtctcctcccggcgcgagtggctgctgagccagggaggttgggagggctttgtggacttctttcg
agtcgaggacctggaaggcagcatcagaaacgtgctgatggcgtttgcaggcgtggctggactgggagcgagcttggcct
acatgatccggtga
>gnl|bcl2dbcds|A0A8D0FVP8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Strix occidentalis caurina GN=MCL-1 (length=402 residues).
atgtgtgtgcttgcctctaaaccagcatctcttgcaggaatgcttcggaagctggaaatccagaaagaggaagatctgca
atcagtgtgtgaagtggctgcccacgtgttcagtgatggagtaacaaactggggtagagtggtgacgctcatctcgtttg
gtgcctttgttgcgaaacacctgaagagcataaaccaggagaagtgcatcagctcgctggcagggatcatcacggacgca
ctcgtctcatcgaagcgcgagtggctaatgagccaaggaggctgggagggctttgtcgacttctttcgagtcgaggacct
ggaaggcagcatcagaaatgtactgatggcgtttgcaggtgtggctggactgggagcgagcttggcctacatgatccggt
ga
>gnl|bcl2dbcds|A0A673TBH1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1482 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggcacagggacccctggaagtctgg
cttctggaagtggagacctggactcagacctcagaattgccggggtcagataaaggggtcccaggctgcaggctcgcatg
tcaggggggcggcctcccggcgcacaggtctgctcacttgtacctactctggcttcctcctggctcaacccatgggcctc
cccactcccaaggcagactacggaccgtcgctggattcctgtcccacactcagcagagcactgttgaggaagtgatggcg
aactcgccgactcctctggccgcgcccacaccgcacggagcactgagggtaggagagcctcccagagcctggattcgcag
gcatcctcccgctcctccagttccagggcctttgacccaggacctgcctcagtccctgcctggccaattacgtgactctg
tgtgctggagggcaggctgggcatgtggctctgggccccaacccctggctcagtgtcttatctgctttatggatgggggc
tgcacaagagatctcattcatgaaaaagcttctgctgattaa
>gnl|bcl2dbcds|A0A673TBH1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1029 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggcacagggacccctggaagtctgg
cttctggaagtggagacctggactcagacctcagaattgccggggtcagataaaggttccctgctttag
>gnl|bcl2dbcds|A0A673TBH1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1086 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggcacagggacccctggaagtctggcttctgg
aagtggagacctggactcagacctcagaattgccggggtcagataa
>gnl|bcl2dbcds|A0A673TBH1_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=1053 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagccgtagggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcgagccccccggccacttttgcgcccgacgcccggagggtcgcgcggccctcg
cccattggcgccgagggccccgacgtcacggctacctccccgaagctgctgttctatgcggccacccgctgtgcgtcgcc
gcctgaagagatggaaggccccgcggccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaaccct
tggggaagcggccggccgtcctgcctttgctggagctggtcggggaggccagcggtggccccggcacggacggctcactg
ccctcgacgccacccccggtggaggaggaggaggacgagttgttccggcagtcgttagagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagccgaaaggcgttagagaccctgc
gccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A673TBH1_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Suricata suricatta GN=MCL-1 (length=594 residues).
atgtttggcctcaagaggaacgccgtaatcggactcaacctctactgtgggggggccgggttgggggccgggagtggcgg
cgcctcctcttcgggaggggggcttttagcgaccggcgccaaggacgggaagccactgggcgggtccggggcggccagcc
gaaaggcgttagagaccctgcgccgggtcggcgacggcgtacagcgaaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggccaaacatttgaagagtataaaccaagaaagctgca
tcgaaccattagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4X1SEU3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1032 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggccnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngccggagcccctggggaagcggccggccgtcc
tgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcgctcccctcgacgccgcccccggca
gaggaggaggaggacgagttataccggcagtccctggagattatctctcggtaccttcgggagcaggcaaccggcgccaa
ggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccctgcgacgggtcggggacggggtgc
agcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtct
cgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgt
ggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaagga
caaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggc
atcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4X1SEU3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4X1SEZ6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A4X1SEZ6_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1044 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcagagaaaagcaagtggcaagaggattatga
ctga
>gnl|bcl2dbcds|A0A4X1SEZ6_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A4X1SFB1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A4X1SFB1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D1FTD4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A8D1FTD4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1074 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcagccacaaaatcctacgtctgtgaaatcaa
atgtatttatgaagttggacttcagactgtctag
>gnl|bcl2dbcds|A0A8D1FTD4_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1011 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagatctaataagatagccttttaa
>gnl|bcl2dbcds|A0A8D1FTD4_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=954 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggtaagtttcatttaa
>gnl|bcl2dbcds|A0A8D1FTD4_MCL1-05 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D1G1G8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D1G1G8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A8D1G1G8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=465 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtga
tggtccacgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaa
cacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacg
agactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaa
atgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D1G1G8_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1011 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagatctaataagatagccttttaa
>gnl|bcl2dbcds|A0A8D1RYD1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1056 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
atatctaataagatag
>gnl|bcl2dbcds|A0A8D1RYD1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=1074 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggctacgggaaaagaggccacggcccggcaagaggtagggggaggggaag
ccggcatggtgattggcggaagcgccggcgcgagccccccgtccactcctgcgccagacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacccgcctcgcgtc
gccgcctgaagagatggaatccccggcctccgacgccatcatgtctcccgaagaggagctggacgggtacgagccggagc
ccctcgggaagcggccggccgtcctgcccttgctggggttagtcgaggaggccagtagtggccccggcacggacggctcg
ctcccctcgacgccgcccccggcagaggaggaggaggacgagttataccggcagtccctggagattatctctcggtacct
tcgggagcaggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgccagccggaaggcgttagagaccc
tgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaacaaactggggcaggattgtgac
tcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccgttagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcagccacaaaatcctacgtctgtgaaatcaa
atgtatttatgaagttggacttcagactgtctag
>gnl|bcl2dbcds|A0A8D1RYD1_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=597 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgcctccgctccgggaggccgtctcttggcaaccggcgccaaggacgcgaagccaatgggcgggtctggggccgcca
gccggaaggcgttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgctt
cggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccacgttttcagtgacggagtaac
aaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagct
gcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgg
gatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
tggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|Q95KR3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Sus scrofa GN=MCL-1 (length=459 residues).
atgtttggcctccagagaaacgcagtaatcggactcaacctctactgtgggggggccggattggggcctggaagcggcag
cagcgccttccaaggcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
acgttttaagtgacggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttg
aagagtataaatcaagaaagctgcatcgaaccgttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactg
gctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgc
tgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A674HQK4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Taeniopygia guttata GN=MCL-1 (length=507 residues).
atcgctaagaagctttttccgggtcttctcggtgggcccgggcggcccggggcggcgggggatgcggtgatggagaaggc
gctggagacgctgcggagggtcggggacggtgtgatgaggaaacacgagctggcttttcaaggaatgctgcggaagctgc
ggatccagcgagaagaagacctgcaggcggtggtggaggtggctgcccacctcttcagcgacggggtgaccaactggggc
cgggtggtgacgctcatctccttcggagccttcgtggccaagcacctgaagagcatccagcaggagcagggcatcggctg
cctggctgccatcatcaccgaggcgctggtctcctccaagagggagtggctggagagccaggggggctgggggggcttcg
tggacttcttccgcctggaggacctggagggcagcgtccggaacgttctgatggccttcgcgggggtggccggcctgggg
gccagcctggcctacctgatccggtga
>gnl|bcl2dbcds|A0A674HQK4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Taeniopygia guttata GN=MCL-1 (length=1068 residues).
atgggagtcaggggacgaagtgggtggtccgttttccgccgaaaaaacggaagcggaggtggaaaaaaaaaaaaaaaaca
aacccaaaaatcaaaaaaaagctctcgctgtcccgccctcgccccgcctctccggcgtcaccggttatataacgcggccg
cgccggtcccgcccgcaccccgccggccgctcgcaccgggcgccatgttcgccgtgaagccgaaagctttcatcggcttc
aacctctactgcggcggctccccggggctgagccccgcggggccggaaccgcggccggagcctcaccgggaccctcaccg
ggaccctcaccgggaccccgcggagcctcaccgggaacaccgcggggccaccggcggcagcgccgaccccccccgcgcgc
tgattggtcgaggcgcggcgccgcgctcgctgattggctgcggcgcgactctctggcgccccgaggaggaactggacgga
tgcgaccccgaacccgaacgcggctccgccgccgccgcttcgctgcccgggaccccccccgggaccccgcccggagctcc
ggatgggctccggcaggactcgctggagctcatcagccgctacctgcgggaggtggctggggaggagcagcccagcaagg
cgctggagacgctgcggagggtcggggacggtgtgatgaggaaacacgagctggcttttcaaggaatgctgcggaagctg
cggatccagcgagaagaagacctgcaggcggtggtggaggtggctgcccacctcttcagcgacggggtgaccaactgggg
ccgggtggtgacgctcatctccttcggagccttcgtggccaagcacctgaagagcatccagcaggagcagggcatcggct
gcctggctgccatcatcaccgaggcgctggtctcctccaagagggagtggctggagagccaggggggctgggggggcttc
gtggacttcttccgcctggaggacctggagggcagcgtccggaacgttctgatggccttcgcgggggtggccggcctggg
ggccagcctggcctacctgatccggtga
>gnl|bcl2dbcds|A0A674PI93_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Takifugu rubripes GN=MCL-1 (length=819 residues).
atgaatattattgcgaatcacaccgcgttgagaatcatgaatgtggtgttccaaaatggagtcgtggacggagcggggca
ttcctccccgctgatcccgatggcttccagaggctccctcagcggcaacgacagcccgaagcggcccagcaagctctccg
tgatcgcacccaaggtttgcgtggcgaaggccatccaggaggacagccaggacaccgaccaccggtcggcgccgtgtacg
ccggagatgaactcggtgaacgggttggacgtgtccgggcgcccagcggaggacgaggcggcgttagacaacgacacgag
gcagctcctcagccgcttcatggcggacttttgcggcatcggttcacatcagtggagggagagcggagcgctgtcgacca
tgaagcgagtggtggcgaacctgatggaaaagcaccgatacgtgtacaatgggatgaccaaacagttgaccctggacgac
agaggagacgatgtgagcttcgtcagctcggtagccaaaagcatattcgcagacggggtcaccaactgggggcgcatcgc
cagcctagtggcctttggagccgtggtggcccagcacatgaaggacaatggtcggagggactgcgtggagccggtggcgc
aggagatctccacgtacctgttgacggaccggcgggactggctgatcaaaaacaacggctgggaaggatttgtggagttt
ttccaagtatcggacccagagtcgtcagtcaggaacatgctgatggctgtcgcgggggttgccgggctcggggccacgct
ggccctgttgatccggtga
>gnl|bcl2dbcds|A0A674IPL6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=MCL-1 (length=960 residues).
atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccctccccgcc
gggctccccgagcggcgcggggaccccccccgcccccggcgcgcgggaccccggccctccggcgacgctgattggcggag
cctcttggggtgccaacggtcattctgagggggcccgggcgctgattggctcccccgccaccccccctgcgcggggggcc
ggggggccccggccggccccgctgtggcggccggaagaggaactggacggctgcgaccccgacgccgagaggacgggccc
gccggcggccgccgcccacgccgacggctccttgcccagcaccccgcccgcggaggacgacgacgagctggacgggctgt
tccaggactcgctggagctcatcagccgctacctgcgggaggccgcggagctgggcgcgcccggcggcaagacgctcttc
aagcggctgctgagcgggccgcggggggcgggccccgccgccctggagaaggcgctggagacgctgcggagggtcggcga
cggcgtcatggagaagcaccagatcgccttccaagggatgcttcggaagctagacatcaagaatgaggaggatctgaagt
cagtgactgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaattgtgacactcatctcttttggt
gcctttgttgcaaaacacctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgct
tgtcacaggcaaacgagattggctagttaaccaaagaggctgggagggatttgttgaattcttccgtgtagaggatctag
aaggtagcatcaggaatgttctggtggcttttgcaggctttgctggactgggagcaagcttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A674JQC4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=MCL-1 (length=456 residues).
atggagaaggtgctgaagacgctgcggagggtcggcgatggcgtcattgagaagcagcagatcgccttccaagggatgct
tcggaagctagacatcaagcatgaggaggatctgaagtcagtaactgctgttgcaacccatattttcaatgatggggtaa
caaactggggtagaattctttcgtgggtaaaaacctcacttgcatcactcatctcttttggtgcctttgttgtaaaacac
ctgaagagcataaaccaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgaca
ttggttagttaaccaaagaggctgggagggatttgttgaattcttctgtgtagaggatctagaaggtagcagcatcagga
atgttctggtggcttttgctggactgggagaatccttggcctacatgatgcaatga
>gnl|bcl2dbcds|A0A8D2F160_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Theropithecus gelada GN=MCL-1 (length=1053 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggctacggagaaggaggcctcggcccggcgagagatagggggaggggaggccg
gcacggtgattggcggaaccgccggcgcaagccccccggccgccctcacgccagacgcccggagggtcgcgcggccgccg
cccattggcgcggaggtccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccttgctggagttggtcggggaatctggtaatagccccagtacggatgggtcacta
ccctcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagcaggaaggctctggagaccttac
gacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcaggattgtgactct
catttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgcatcgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8D2F160_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Theropithecus gelada GN=MCL-1 (length=594 residues).
atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccaccggcgccaaggacacaaagccaatgggcaggtctggggccaccagca
ggaaggctctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggcaggattgtgactctcatttcttttggtgcctttgtggctaaacacttgaagaccataaaccaagaaagctgca
tcgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A8D2KCB0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Urocitellus parryii GN=MCL-1 (length=1032 residues).
atgttcggctttaagaggaacgcggtcatcggactcaacctctactgcgggggcgccgggctgggggccagcggcagcgc
caccccgccgggagcgcagctcttggccgccgagaaggaggccgcggcccggcgagaggcagggggaggggaagccggcg
cgctctcgggcggaagctccccagccgcccaggcgcaggacgcccgcagggtcgcgcggccggtgcccattggcgccgag
gtccccgacgtcaccgcgaccccgccgaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaagatgga
agcccccgcggccgccatgtcgcccgaagaggagctggacggctacgagcccgagcccctcgggaagcggccggcggtcc
tgcccttgctggagctcgttggggaggccgccaagagtcccggcgcggacgggtcgctgccgtcgacgccgccgcccgcg
gaggaggaggaggacgagctgtaccggcagtcgctggagatcatttcgcggtacctccgcgagcaggcgaccggctccaa
ggacgcgaagccgctgcgcgggtcgggggccgccagcaggaaggcgctggagaccctgcggcgggtcggcgacggagtgc
agcgcaaccacgagacggccttccaaggcatgcttcggaagctggacatcaaaaacgaggatgatgtcaaaagtctgtct
cgcgtgattgtccttgttttcagtgacagagtaacaaactggggcaggattgtgactctcatttcttttggtgcctttgt
ggccaaacacttgaagagcataaaccaagaangctgcattgaacccttagcagaaagtatcacagacgtgctcgtaagga
caaaacgggactggctggtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggcggc
atcagaaatgtgctgctggctttcgcaggtgttgctggcgtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A452RHX5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ursus americanus GN=MCL-1 (length=1053 residues).
atgtttggcctgaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
cgccgcctcatcgggagggcggcttttggcttcggggaaggaggccacggcccggcgggaggtagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgctagtcccccggccactctcgcgccggacgcccggagggtcgcgcggccctcg
cccattggcgccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgcc
gcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctt
tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactg
ccctcgacgccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctcc
gacgggtcggggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=972 residues).
acgggcctgagcggaactcgccgcgcgcgccgccgccgccgccggggggagcgggacgggacgggccaccctgcgcgctc
gcgcgtccgcggccaatccgcgcgccggcgctgccaggctggcggccccgcgggggccctggccctgctcgggcccctgg
agggggcgccgcgcctgccggagcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggac
ggctgcgagccggacgccgagggcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggaggg
cgagcccgagccggcggcggcggacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgc
tggaggtggtgggccggtacctgcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctg
caggggctggtgggccgcttcggggccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccg
ccgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaagagg
atgacctgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctc
atcgcctttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcat
tacggacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatg
tagaggacatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatac
atgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=1110 residues).
atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgccccggcgtcgccgccggtgggggcggcggg
cggcggcggggagggagccggccccgcgctgagccggctccccgagggcctcggcgcgcgcgcgggccggctccccnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccctggagggggcgccgcgcctgccgga
gcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgccgagg
gcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggagggcgagcccgagccggcggcggcg
gacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctggaggtggtgggccggtacct
gcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctgcaggggctggtgggccgcttcg
gggccccccagggcggcgccggcgcggcgtgcgcggatcaggcgctggagacgctccgccgggtgggcggcggcatcctc
gacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaagaggatgacctgaagtctgtgtcaga
aattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctcatcgcctttggtgcctttgttg
ccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcattacggacgtgctggtgacagat
aagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatgtagaggacatagaaggcagcat
cagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatacatgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=1056 residues).
atggccgccatgttgaacacgaaggcgatggtgctgtactgcggaagcgccccggcgtcgccgccggtgggggcggcggg
cggcggcggggagggagccggccccgcgctgagccggctccccgagggcctcggcgcgcgcgcgggccggctccccnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnncgcggatcggcggaggggccctggccctgctcgggcccctggagggggcgccgcgcctgccgga
gcccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccgagggcgagctggacggctgcgagccggacgccgagg
gcagcggcggcggcctcgtcccctcgcccaccccctcggtcgcgtcctcgcaggagggcgagcccgagccggcggcggcg
gacgacggcggcggcgcgctcgggctgcgctgccacgacgacctgcgcaaagtgacgctggaggtggtgggccggtacct
gcgcgaggcggccagccagggccccgcggagggcggcggcggcgccggcaagttcctgcaggggctggcgctggagacgc
tccgccgggtgggcggcggcatcctcgacaagcaccagctggctttccaaggaatgcttaaaaagatggaaatcaagaaa
gaggatgacctgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgac
tctcatcgcctttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaa
tcattacggacgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttc
catgtagaggacatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggc
atacatgatccggtga
>gnl|bcl2dbcds|A0A8D2IVC0_MCL1-04 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Varanus komodoensis GN=MCL-1 (length=486 residues).
aacttcctgttagggacaaatgcaatttataagttgagtttaagtggtggcgtggcattgttcttttccatggtatttct
gaaatgcaagtttaatgccaactccatcctttcccacccaggaatgcttaaaaagatggaaatcaagaaagaggatgacc
tgaagtctgtgtcagaaattgcctcacacgttttcagtgacggtgtgacaaactgggggcgaattgtgactctcatcgcc
tttggtgcctttgttgccaagcatctgaagaatataaaccaggagagtggcatcagtactttgacagaaatcattacgga
cgtgctggtgacagataagcgggaatggctggtcaaccataatgcttgggaggggtttgttaaattcttccatgtagagg
acatagaaggcagcatcagaaacgttctgatgacttttgcaggcgttgctggattaggagcaagtttggcatacatgatc
cggtga
>gnl|bcl2dbcds|B6V6J0_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xenopus laevis GN=MCL-1 (length=828 residues).
atgatgcaccagtcagtaattgccaagcagcgcccctcgactagtttcctcattccctgccagttttactgctcgggcgg
cggctcctcagagaagacattgagcgcgcgtggggcttctccgtgggaccccgatatggacacgcacaggccgcagctga
atggcttgggctttaacaacggggggtcgctgccttgttcccaggaggatgaattagatgaggatatggataacggatcc
cagggttccacgtctcccccggacagccccgtgtgccctaaggatggattatatatggacacccagcagctcattctcgc
tttctaccgcgtgtacagcggcgaggagagcggcgaattagaggcttcctgtctcctccaacatggcgtccaccacaaag
ccctggaaaccctgctgagggtcgggggagagattatagagaagcaccacatggccttcacgggcatgctacaaaggttg
tctatacatagcagagaagacttgcagaaactttctgaggttcccgctttggtctttaatgacggagttacaaattgggg
ccgcattgttacggtcataagctttggcgcgtttgttgcaaagcatctaaagagcttaaaccttgaagactgcatcggag
ttttggcagagcacttcacgcagttcctaatgatgagcaaaaaagactggataatacaggaaaagggatgggatggcttt
gtggacttttttcacatagaagattatgaaagtggactgaaaactgttttgatggctttctcaagtgttgctgttcttgg
ggccggtttggcgtacatgatccgatga
>gnl|bcl2dbcds|A0A3B5PQ55_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=MCL-1 (length=843 residues).
atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaatggagtcgggaatggacaaacacactacga
ccagggactcggtgtgcctgaggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatcccttcatgaaac
gcccgacgaatctcggagtgaatggatatgttgcgaaaagccttccgacgagcagcgacgacagcgacgaaggctctctg
ccatgcaccccggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagcaaccaagtgctggataacga
cacaacggagcttattagcagttttctgagagactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat
ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgcatacaatggtatggtcaataggcttgctctg
gataacgagccggacgacatggagtttgttacggaaatagcagagagtctcttttcagacgggatcaccaactggggtcg
gatcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggagaggggcagagagcactgcgtggagctgg
tgagccggaaaatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtg
gagttctttagagtatcggacccggagtctacagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc
caccttagcctttcttatcaggagatgcaaagagaagtattga
>gnl|bcl2dbcds|A0A3B5PQ55_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=MCL-1 (length=828 residues).
atgacagctaattcgacaaacgcgttaaactatctcattttttctcaaaatggagtcgggaatggacaaacacactacga
ccagggactcggtgtgcctgaggtcgcaatgggctccactgtagaatctcttcattcgcctaaggatcccttcatgaaac
gcccgacgaatctcggagtgaatggatatgttgcgaaaagccttccgacgagcagcgacgacagcgacgaaggctctctg
ccatgcaccccggcgcagcacccagacagtgaaaaagacgcgacggccgtaggtgcgagcaaccaagtgctggataacga
cacaacggagcttattagcagttttctgagagactttacgggactttcaaagtgtcggtggggtcaaaataaagctctat
ctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagtatgcatacaatggtatggtcaataggcttgctctg
gataacgagccggacgacatggagtttgttacggaaatagcagagagtctcttttcagacgggatcaccaactggggtcg
gatcgccagcctggtgacgttcggggctgcggtgtgtcagcgcctgaaggagaggggcagagagcactgcgtggagctgg
tgagccggaaaatatccacgtatctcctggcaaaccagcgggactggctagcaaaaaacaactcatgggagggctttgtg
gagttctttagagtatcggacccggagtctacagtgaggaacacgctgatggctgttgtgggggtcgctggtattggggc
caccttagcctttcttatcagcttctga
>gnl|bcl2dbcds|A0A8D2MBY7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Zonotrichia albicollis GN=MCL-1 (length=396 residues).
atgcattctgcctgtgctcctgcacccctccctgaagctgttggttttgcagggatgctgaggaagctgcagatccagca
ggaggaggacctgcagtgcgtggtggaggtggcagcccagatgttcagcgacggcgtcaccaactggggccgggtggtga
ccctcatcgccttcggggccttcgtggccaagcacctcaagagcatccagcaggagcagagcgtcagcagcctggctggg
atcatcaccgacgccctggtgaactccaagagggagtggctggagagccaggggggctgggtgagtcaccattcctggga
ttccggaggcagcagccctgggagggctggggtggctggaatggggctgggggagcacaggggatgtgcaggatga
>gnl|bcl2dbcds|A0A8D2NMF1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Zosterops lateralis melanops GN=MCL-1 (length=411 residues).
tcccggacgtccatggatttttatcctgttcctgagaatcttccaggaatgctgcggaagctggaaatccaacaagagga
ggacctgcagtcggtgatggaggtggctgcccacgtcttcagcgacggggtgaccaactggggccgtgtggtgactctca
tctcctttggagccttcgtggccaagcacctgaagagcatcaagcaggagcagagcatcagctccctggccgggatcatc
accgacgccctggtctcctccaagcgggagtggcttgagagccaggggggctgggagggctttgtggacttcttccgagt
ggaggacctggagggcagcatccggaacgtgctgatggcctttgcaggggtggctggcctgggggccagcttggcctaca
tgatccggtga
>gnl|bcl2dbcds|A0A8D2NMF1_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Zosterops lateralis melanops GN=MCL-1 (length=465 residues).
agcaggaatctctctccatccctgacacttgggctcctgcagctttggggagcccagtggggtgtgggaggggggtcaca
ccctctccctaatcttccaggaatgctgcggaagctggaaatccaacaagaggaggacctgcagtcggtgatggaggtgg
ctgcccacgtcttcagcgacggggtgaccaactggggccgtgtggtgactctcatctcctttggagccttcgtggccaag
cacctgaagagcatcaagcaggagcagagcatcagctccctggccgggatcatcaccgacgccctggtctcctccaagcg
ggagtggcttgagagccaggggggctgggagggctttgtggacttcttccgagtggaggacctggagggcagcatccgga
acgtgctgatggcctttgcaggggtggctggcctgggggccagcttggcctacatgatccggtga
© 1998-2023Legal notice