Dataset for CDS MCL-1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

181 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------atgttt
A0A1L1RNM6_MCL1-02      --------------------------------------------atgttt
H9GEA6_MCL1-02          ------------------------------------------------at
H9GEA6_MCL1-01          atgtttaacaagaaatcgatggtgctggtttgcgggggcgccccgagcat
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          --------------------------------------------atgtta
F6ZMX1_MCL1-01          --------------------------------------------atgtta
F6ZMX1_MCL1-02          --------------------------------------------atgtta
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------atgttt
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------atgttt
Q9Z1P3_MCL1-01          --------------------------------------------atgttt
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------atgttt
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------atgttc
A0A287DCH9_MCL1-01      --------------------------------------------atgttc
G1T2Q0_MCL1-02          --------------------------------------------atgttt
G1T2Q0_MCL1-01          --------------------------------------atggcgatgttt
G3T756_MCL1-01          --------------------------------------------atgttc
A0A1S3F3I1_MCL1-01      --------------------------------------------atgttt
A0A2K6GI15_MCL1-01      --------------------------------------------atgttt
F7AVA6_MCL1-02          --------------------------------------------atgttt
F7AVA6_MCL1-01          --------------------------------------------atgttt
A0A337S3J9_MCL1-01      --------------------------------------------atgttt
Q7YRZ9_MCL1-01          --------------------------------------------atgttt
A0A337S3J9_MCL1-04      --------------------------------------------atgttt
A0A337S3J9_MCL1-03      --------------------------------------------atgttt
Q8HYS5_MCL1-01          --------------------------------------------atgttt
F1PAP1_MCL1-01          --------------------------------------------atgttc
F1PAP1_MCL1-02          --------------------------------------------atgttc
M3XZZ5_MCL1-01          --------------------------------------------atgttt
Q95KR3_MCL1-01          --------------------------------------------atgttt
A0A287BK44_MCL1-02      --------------------------------------------atgttt
A0A287BK44_MCL1-01      --------------------------------------------atgttt
A0A452RHX5_MCL1-01      --------------------------------------------atgttt
G1L3L7_MCL1-02          --------------------------------------------atgttt
G1L3L7_MCL1-01          --------------------------------------------atgttt
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------atgttc
A0A452GA25_MCL1-02      --------------------------------------------atgttc
A0A452GA25_MCL1-01      --------------------------------------------atgttc
G2HFR3_MCL1-01          --------------------------------------------atg---
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------atgttt
H0XFB7_MCL1-01          --------------------------------------------atgttt
A0A2K6GI15_MCL1-03      --------------------------------------------atgttt
A0A2K5I9I0_MCL1-02      --------------------------------------------atgttt
H2N5Y9_MCL1-01          --------------------------------------------atgttc
C8YZ26_MCL1-01          --------------------------------------------atgttt
A0A2I2YQH7_MCL1-01      --------------------------------------------atgttt
A0A2I2YQH7_MCL1-03      --------------------------------------------atgttt
B4E3L8_MCL1-01          --------------------------------------------atg---
B4DG83_MCL1-01          --------------------------------------------atg---
B4DU51_MCL1-01          --------------------------------------------atgttt
Q07820_MCL1-04          --------------------------------------------atgttt
B4DLY8_MCL1-01          --------------------------------------------atgttt
A0A2I3RTV4_MCL1-01      --------------------------------------------atgttt
A0A2R9BPJ5_MCL1-03      --------------------------------------------atgttt
A0A2I3RTV4_MCL1-03      --------------------------------------------atgttt
A0A2R9BPJ5_MCL1-01      --------------------------------------------atgttt
A0A2K5I9I0_MCL1-03      --------------------------------------------atgttt
A0A2I3GJZ3_MCL1-01      --------------------------------------------atgttt
A0A2I3GJZ3_MCL1-02      --------------------------------------------atgttt
A0A2K6KRW9_MCL1-02      --------------------------------------------atgttt
A0A2K6PPI3_MCL1-02      --------------------------------------------atgttt
A0A2K6KRW9_MCL1-01      --------------------------------------------atgttt
A0A2K6PPI3_MCL1-03      --------------------------------------------atgttt
A0A2I3LFM0_MCL1-01      --------------------------------------------atgttt
A0A2K5W0W9_MCL1-01      --------------------------------------------atgttt
A0A2K6ECR0_MCL1-02      --------------------------------------------atgttt
I7G687_MCL1-01          --------------------------------------------atgttt
A0A2K5LXU8_MCL1-01      --------------------------------------------atgttt
A0A2K5LXU8_MCL1-03      --------------------------------------------atgttt
A0A0D9RZP5_MCL1-01      --------------------------------------------atgttt
A0A2K5W0W9_MCL1-03      --------------------------------------------atgttt
A0A2K6ECR0_MCL1-03      --------------------------------------------atgttt
A0A2K5XSB2_MCL1-01      --------------------------------------------atgttt
A0A2K5XSB2_MCL1-03      --------------------------------------------atgttt
A0A2I3LFM0_MCL1-03      --------------------------------------------atgttt
A0A2K5R5E2_MCL1-03      --------------------------------------------atgttt
A0A2K6V5Y3_MCL1-01      --------------------------------------------atgttc
A0A2K6V5Y3_MCL1-03      --------------------------------------------atgttc
A0A2K5R5E2_MCL1-04      --------------------------------------------atgttt
F7GTF7_MCL1-01          --------------------------------------------atgttt
F7GTF7_MCL1-02          --------------------------------------------atgttt
A0A2K5CFH3_MCL1-01      --------------------------------------------atgttt
A0A2K5CFH3_MCL1-03      --------------------------------------------atgttt
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-02          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      ---------------------------atgaatccacaaagcttgaagag
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          ---------------------------atgatgcaccagtcagtaattgc
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          ---------------------------atggctctgagtttggattttag
Q9I9N3_MCL1-01          ---------------------------atggctctgagtttggattttag
J7H260_MCL1-01          ---------------------------atgggcggctctc----------
A0A3B3R4U0_MCL1-01      ---------------------------atgaatctgatcaatcgtaccac
A0A3Q2Y539_MCL1-01      ---------------------------atgccggagagtaaac-------
Q0KFR9_MCL1-01          ---------------------------atgagyctgtcgaactcgattac
A0A3P8Y1W8_MCL1-02      ---------------------------atgaacctgtcgaaatcgcttac
A0A3P8Y1W8_MCL1-01      ---------------------------atgaacctgtcgaaatcgcttac
A0A3B3CEX1_MCL1-01      ---------------------------atgcttcctttgcaaaaacacat
A0A3B3CEX1_MCL1-02      ---------------------------atgcttcctttgcaaaaacacat
A0A3P9ILF6_MCL1-01      ---------------------------atgtttcctttgcaaaaacagat
A0A3P9ILF6_MCL1-02      ---------------------------atgtttcctttgcaaaaacagat
A0A3B3IJ04_MCL1-01      ---------------------------atgtttcctttgcaaaaacagat
A0A3B3IJ04_MCL1-02      ---------------------------atgtttcctttgcaaaaacagat
A0A3P9L1F3_MCL1-02      ---------------------------atgtttcctttgcaaaaacagat
A0A3P9L1F3_MCL1-01      ---------------------------atgtttcctttgcaaaaacagat
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      ---------------------------atgagtatggtgc---agcccac
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      ---------------------------atgaatattatta---attctcc
A0A3B1IEV7_MCL1-01      ---------------------------atgaa---------------ccc
A0A3B4CGU9_MCL1-03      ---------------------------atgga-----------gagcgc-
A0A3B4CGU9_MCL1-02      ---------------------------atggaagctcacggtggagttca
W5MMB7_MCL1-01          ---------------------------atgagcctctcctcgctgaagcg
A0A3P8VKM5_MCL1-03      ---------------------------atgaatatta------taaagaa
A0A3P8VKM5_MCL1-05      ---------------------------atgaatatta------taaagaa
A0A3P8VKM5_MCL1-04      ---------------------------atgaatatta------taaagaa
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      -------------ggagggtggggga-cggagtc--------------ct
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gcag---tcaagcggaacgccgtcat-cggcttcaacctctactgcggcg
A0A1L1RNM6_MCL1-02      gcag---tcaagcggaacgccgtcat-cggcttcaacctctactgcggcg
H9GEA6_MCL1-02          ggcc---ccgaacacgccggcctcacctggagccggcggaggcgtcggag
H9GEA6_MCL1-01          ggcc---ccgaacacgccggcctcacctggagccggcggaggcgtcggag
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          ggccctttcaagaagaacgccgtcat-cggcctcaacctttactgtggcg
F6ZMX1_MCL1-01          ggccctttcaagaagaacgccgtcat-cggcctcaacctttactgtggcg
F6ZMX1_MCL1-02          ggccctttcaagaagaacgccgtcat-cggcctcaacctttactgtggcg
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ggcc---ccaaaagaaatgcattcat-cggactcaacctccactgcgggg
G1PZ39_MCL1-01          -----------------------------gccccgccctctcccattagc
P97287_MCL1-01          ggcc---tgcggagaaacgcggtcat-cggcttgaacctgtactgcggcg
Q9Z1P3_MCL1-01          ggcc---ttcggagaaacgcggtaat-cggcttgaacctgtactgcggcg
A0A2K6F6N9_MCL1-01      gatc---tgtggattaacctggggat-------------cagctgcgggc
A0A2K5DMS4_MCL1-01      ggct---tccaa------gtggtaat-cagactcaacctctactg-----
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      ggcc---ttaagaggaacgcggtcat-cggactcaacctctactgcggg-
A0A287DCH9_MCL1-01      ggcc---ttaagaggaacgcggtcat-cggactcaacctctactgcgggg
G1T2Q0_MCL1-02          agcc---tgagaagaaacgcggtaat-cggactcaacctctacttggggg
G1T2Q0_MCL1-01          agcc---tgagaagaaacgcggtaat-cggactcaacctctacttggggg
G3T756_MCL1-01          ggct---tcaagagaaacgcagtaat-cggactcaacctttactgtgggg
A0A1S3F3I1_MCL1-01      ggcc---tcagaagaaacgcggtaat-cggactcaacttctactgtgggg
A0A2K6GI15_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
F7AVA6_MCL1-02          ggcc---tgaaaagaaacgcagtaat-cggactcaacctctactgtgggg
F7AVA6_MCL1-01          ggcc---tgaaaagaaacgcagtaat-cggactcaacctctactgtgggg
A0A337S3J9_MCL1-01      ggcc---tcaagagaaacgctgtaat-cggactcaacctctactgtgggg
Q7YRZ9_MCL1-01          ggcc---tcaagagaaacgctgtaat-cggactcaacctctactgtgggg
A0A337S3J9_MCL1-04      ggcc---tcaagagaaacgctgtaat-cggactcaacctctactgtgggg
A0A337S3J9_MCL1-03      ggcc---tcaagagaaacgctgtaat-cggactcaacctctactgtgggg
Q8HYS5_MCL1-01          ggcc---tcaagagaaacgcagtaatccggactcaa-ctctactgtgggg
F1PAP1_MCL1-01          ggcc---tcaagagaaacgcagtaat-cggactcaacctctactgtgggg
F1PAP1_MCL1-02          ggcc---tcaagagaaacgcagtaat-cggactcaacctctactgtgggg
M3XZZ5_MCL1-01          ggcc---tcaaaagaaacgcagtaat-cggactcaacctctactgtgggg
Q95KR3_MCL1-01          ggcc---tccagagaaacgcagtaat-cggactcaacctctactgtgggg
A0A287BK44_MCL1-02      ggcc---tccagagaaacgcagtaat-cggactcaacctctactgtgggg
A0A287BK44_MCL1-01      ggcc---tccagagaaacgcagtaat-cggactcaacctctactgtgggg
A0A452RHX5_MCL1-01      ggcc---tgaagagaaacgcagtaat-cggactcaacctctactgtgggg
G1L3L7_MCL1-02          ggcc---tcaaaagaaacgcagtaat-cggactcaacctctactgtgggg
G1L3L7_MCL1-01          ggcc---tcaaaagaaacgcagtaat-cggactcaacctctactgtgggg
W5QI41_MCL1-01          ------------------------------------------------gg
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          ggcc---tcaagagaaacgcagtaat-cggactaaacctctattgtgggg
A0A452GA25_MCL1-02      ggcc---tcaagagaaacgcagtaat-cggactgaacctctactgtgggg
A0A452GA25_MCL1-01      ggcc---tcaagagaaacgcagtaat-cggactgaacctctactgtgggg
G2HFR3_MCL1-01          ----------------------------------gacatttgccg-----
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ggcc---tccaaagaaacgcgctaat-cggactcaacctctactgtgagt
H0XFB7_MCL1-01          ggcc---tcaagagaaacgcagtgat-cggactcaacctctactgtgggg
A0A2K6GI15_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5I9I0_MCL1-02      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
H2N5Y9_MCL1-01          ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
C8YZ26_MCL1-01          ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I2YQH7_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I2YQH7_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
Q07820_MCL1-04          ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
B4DLY8_MCL1-01          ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I3RTV4_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2R9BPJ5_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I3RTV4_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2R9BPJ5_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5I9I0_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I3GJZ3_MCL1-01      ggcc---tcagaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I3GJZ3_MCL1-02      ggcc---tcagaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K6KRW9_MCL1-02      ggct---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K6PPI3_MCL1-02      ggct---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K6KRW9_MCL1-01      ggct---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K6PPI3_MCL1-03      ggct---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I3LFM0_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5W0W9_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgcgggg
A0A2K6ECR0_MCL1-02      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
I7G687_MCL1-01          ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5LXU8_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5LXU8_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A0D9RZP5_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5W0W9_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgcgggg
A0A2K6ECR0_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5XSB2_MCL1-01      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5XSB2_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2I3LFM0_MCL1-03      ggcc---tcaaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5R5E2_MCL1-03      ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K6V5Y3_MCL1-01      ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K6V5Y3_MCL1-03      ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5R5E2_MCL1-04      ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
F7GTF7_MCL1-01          ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
F7GTF7_MCL1-02          ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5CFH3_MCL1-01      ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
A0A2K5CFH3_MCL1-03      ggcc---tccaaagaaacgcggtaat-cggactcaacctctactgtgggg
D2ITA0_MCL1-03          ---------------------------atgc------------tgtcaca
D2ITA0_MCL1-04          ---------------------------atgc------------tgtcaca
A0A3P8V8T6_MCL1-01      ---------------------------ctggat-----------------
Q4SW32_MCL1-01          ---------------------------atgagcgttatcg---------c
A0A3B5PQ55_MCL1-01      ---------------------------atgacagctaattcgacaaacgc
A0A3B5PQ55_MCL1-02      ---------------------------atgacagctaattcgacaaacgc
A0A3P9Q4I8_MCL1-01      ---------------------------atgacggctaattcgacaaccgc
A0A3P9Q4I8_MCL1-02      ---------------------------atgacggctaattcgacaaccgc
A0A3B3VM25_MCL1-01      ---------------------------atgacggctaattcgacaaccgc
A0A087X830_MCL1-01      ---------------------------atgacggctaattcgacaaccgc
A0A3B3YCD0_MCL1-01      ---------------------------atgacggctaattcgacaaccgc
A0A3Q3VP02_MCL1-01      ---------------------------atgaacg----------------
G3PJT0_MCL1-01          ---------------------------atgaatataattc---agagacc
A0A2U9CJ81_MCL1-01      ---------------------------atgaatatcattc---cttccac
A0A3Q3B4P5_MCL1-01      ---------------------------atgttcc---------cgaagcc
A0A3Q3B4P5_MCL1-02      ---------------------------atgttcc---------cgaagcc
A0A3Q3IZW0_MCL1-01      ---------------------------atgaacatcatta---cctcgaa
A0A3Q3GP42_MCL1-01      ---------------------------atggatatcatta------atat
A0A3Q1GX28_MCL1-02      ---------------------------atgt------------taccgtc
A0A3Q1GX28_MCL1-01      ---------------------------atgt------------taccgtc
A0A3Q3M6G2_MCL1-01      ---------------------------atgagcttcattc---cgtcgac
A0A3Q3M6G2_MCL1-02      ---------------------------atgagcttcattc---cgtcgac
A0A3B4T8L9_MCL1-01      ---------------------------atgaatcttattc---agtcgcc
A0A3B4T8L9_MCL1-02      ---------------------------atgaatcttattc---agtcgcc
A0A3B4XKA5_MCL1-01      ---------------------------atgaatcttatcc---aggcacc
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      ---------------------------atgaacacgtgta---ctatgag
I3KXG5_MCL1-01          ---------------------------at---------------------
I3JHR5_MCL1-03          ---------------------------atgaccaactttt---tgatgtc
I3JHR5_MCL1-02          ---------------------------atgaccaactttt---tgatgtc
I3JHR5_MCL1-01          ---------------------------atgaccaactttt---tgatgtc
A0A3Q4HLQ8_MCL1-01      ---------------------------atgaccaactata---tgatgtc
A0A3P9BVM3_MCL1-01      ---------------------------atggccaactata---tgatgtt
A0A3P8NP63_MCL1-02      ---------------------------atggccaactata---tgatgtt
A0A3P8NP63_MCL1-01      ---------------------------atggccaactata---tgatgtt
A0A3Q2VNL8_MCL1-01      ---------------------------atggccaactata---tgatgtt
A0A3B4G4Z6_MCL1-01      ---------------------------atggccaactata---tgatgtt
A0A3B4ZKP6_MCL1-01      ---------------------------atgaacattattc---cgacgac
A0A3Q1EQB9_MCL1-01      ---------------------------atgaatatgattc------ctac
A0A3Q1EQB9_MCL1-02      ---------------------------atgaatatgattc------ctac
A0A3P8RQX7_MCL1-02      ---------------------------atgaatatgattccgacgacgac
A0A3P8RQX7_MCL1-01      ---------------------------atgaatatgattccgacgacgac
A0A3Q1BKL8_MCL1-01      ---------------------------atgaatatgattccgacgacgac
A0A3Q1BKL8_MCL1-02      ---------------------------atgaatatgattccgacgacgac
A0A3Q2EDX8_MCL1-01      ---------------------------atg--------------------
A0A3Q2P7X9_MCL1-02      ---------------------------atgtctaaggcaccgacaagcac
A0A3Q2P7X9_MCL1-01      ---------------------------atgtctaaggcaccgacaagcac
                                                                          

A0A3B3SG34_MCL1-01      ttacgcgccgattatggtgagcatgaactaccac----------------
A2BF68_MCL1-02          -------------at-----------------------------------
Q8UWD6_MCL1-01          -------------atgttcgctggaagaaacaac----------------
A2BF68_MCL1-01          -------------atgttcgctggaagaaacaac----------------
Q568W5_MCL1-01          -------------atgttcgctggaagaaacaac----------------
A0A3B1K5R1_MCL1-01      -------------atgatgagc----------------------------
A0A3B4C6H5_MCL1-01      -----------------ttatt----------------------------
A0A3B4C6H5_MCL1-03      ----------atgatgatgagt----------------------------
B6V6J0_MCL1-01          caagcag-------------------------------------------
Q568V1_MCL1-01          -------------atgagcttcctcgcgcagggcgttc------------
Q1L8X3_MCL1-01          gcgaacggccacgatgagcttcttcgcgcagggcgttc------------
Q9I9N3_MCL1-01          gcgaacggccacgatgagcttcttcgcgcagggcgttc------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      g-------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          acgagccacaactacg----------------------------------
A0A3P8Y1W8_MCL1-02      acgagccacaactacg----------------------------------
A0A3P8Y1W8_MCL1-01      acgagccacaactacg----------------------------------
A0A3B3CEX1_MCL1-01      gg------------------------------------------------
A0A3B3CEX1_MCL1-02      gg------------------------------------------------
A0A3P9ILF6_MCL1-01      gg------------------------------------------------
A0A3P9ILF6_MCL1-02      gg------------------------------------------------
A0A3B3IJ04_MCL1-01      gg------------------------------------------------
A0A3B3IJ04_MCL1-02      gg------------------------------------------------
A0A3P9L1F3_MCL1-02      gg------------------------------------------------
A0A3P9L1F3_MCL1-01      gg------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      aagccaagttctgaag----------------------------------
A0A3B4AFB7_MCL1-01      ------ga----------------cacc----------------------
A0A3B4AFB7_MCL1-02      gaagaggaccgcgttaaaactgtccaccatgggcttgt------------
A0A3B1IEV7_MCL1-01      a-------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      g-------------------------------------------------
W5MMB7_MCL1-01          cacctcggccagcgccgtgatacagctctattgcccca------------
A0A3P8VKM5_MCL1-03      caaccaagctaagttgaacgttgccaccggagtcctag------------
A0A3P8VKM5_MCL1-05      caaccaagctaagttgaacgttgccaccggagtcctag------------
A0A3P8VKM5_MCL1-04      caaccaagctaagttgaacgttgccaccggagtcctag------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ggagaaacacgagctggccttccaagggaccggcgag-------atctga
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      gaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccccg
A0A1L1RNM6_MCL1-02      gaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccccg
H9GEA6_MCL1-02          aaagtagcggcgggaa--------taataacgacggcg------------
H9GEA6_MCL1-01          aaagtagcggcgggaa--------taataacgacggcg------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          gggcagggatgggcgc--------cggcggcggcgcca----gcggtccc
F6ZMX1_MCL1-01          gggcagggatgggcgc--------cggcggcggcgcca----gcggtccc
F6ZMX1_MCL1-02          gggcagggatgggcgc--------cggcggcggcgcca----gcggtccc
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          gggcag--ttgggggc--------ctgtggcggcagcgaagcctacatct
G1PZ39_MCL1-01          g-------------------------------------------------
P97287_MCL1-01          gcgccagcctcggcgc--------gggcggcggttct-------------
Q9Z1P3_MCL1-01          gcgctagcctcggcgc--------gggcggcggctct-------------
A0A2K6F6N9_MCL1-01      gggcagatctagg-------------------------------------
A0A2K5DMS4_MCL1-01      ---------------------------------cggtg----ccatccct
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      gcgccgggctgggggc--------cagcggcggcgcca----ccccg---
G1T2Q0_MCL1-02          ggcccgggttgggagc--------cggtggcggcggcg----tcgcccct
G1T2Q0_MCL1-01          ggcccgggttgggagc--------cggtggcggcggcg----tcgcccct
G3T756_MCL1-01          gggccggcttgggggc--------cg---gcggctgcg----ccacccct
A0A1S3F3I1_MCL1-01      gcgccgggctgggcgc--------cggcagcggggccg----ccgccgcg
A0A2K6GI15_MCL1-01      gggccggattgggggc--------cggcagcagcggcg----ccaccccc
F7AVA6_MCL1-02          gggccgggttgggggc--------cggcggcggcggcg----cctcgtcg
F7AVA6_MCL1-01          gggccgggttgggggc--------cggcggcggcggcg----cctcgtcg
A0A337S3J9_MCL1-01      gggccgggttggcggc--------cgggagcggcggcg----cctcctct
Q7YRZ9_MCL1-01          gggccgggttggcggc--------cgggagcggcggcg----cctcctct
A0A337S3J9_MCL1-04      gggccgggttggcggc--------cgggagcggcggcg----cctcctct
A0A337S3J9_MCL1-03      gggccgggttggcggc--------cgggagcggcggcg----cctcctct
Q8HYS5_MCL1-01          gggccgggctgggggc--------cggcagcggcggcg----cctcctct
F1PAP1_MCL1-01          gggccgggctgggggc--------cggcagcggcggcg----cctcctct
F1PAP1_MCL1-02          gggccgggctgggggc--------cggcagcggcggcg----cctcctct
M3XZZ5_MCL1-01          gggccgggctgggggc--------cggcaccgggggcg----cctcctct
Q95KR3_MCL1-01          gggccggattggggcc--------tggaagcggcagca----gc------
A0A287BK44_MCL1-02      gggccggattggggcc--------tggaagcggcagca----gcgcctcc
A0A287BK44_MCL1-01      gggccggattggggcc--------tggaagcggcagca----gcgcctcc
A0A452RHX5_MCL1-01      gggccgggttgggggc--------cggcagcggcggcg----ccgcctca
G1L3L7_MCL1-02          gggccgggttgggggc--------cggcagcggcgggg----ggg---na
G1L3L7_MCL1-01          gggccgggttgggggc--------cggcagcggcgggg----ggg---na
W5QI41_MCL1-01          gagccgga------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          gagccggattaggaca--------gggcagcggcgcct----cctct---
A0A452GA25_MCL1-02      gagccgggttaggaca--------gggcagcggcgctt----cctct---
A0A452GA25_MCL1-01      gagccgggttaggaca--------gggcagcggcgctt----cctct---
G2HFR3_MCL1-01          --------------gc--------tctcagcagcaatg----c-------
A0A2K5EPX0_MCL1-02      ----------------------------------ag--------------
A0A2K5EPX0_MCL1-01      ----------------------------------aatg----cctcatgt
A0A2K5C7L5_MCL1-01      gggccggcttggggac--------tggcagtggcggca----ccacccct
H0XFB7_MCL1-01          gcgccgggctgggggc--------tggcagcggcggcg----ccacaccc
A0A2K6GI15_MCL1-03      gggccggattgggggc--------cggcagcagcggcg----ccaccccc
A0A2K5I9I0_MCL1-02      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
H2N5Y9_MCL1-01          gggccggcttgggtgc--------tggcagcggcggcg----ccacccct
C8YZ26_MCL1-01          gggccggcttgggggc--------cggcagcggcggcg----ccacccgc
A0A2I2YQH7_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2I2YQH7_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          gggccggcttgggggc--------cggcagcggcggcg----ccacccgc
Q07820_MCL1-04          gggccggcttgggggc--------cggcagcggcggcg----ccacccgc
B4DLY8_MCL1-01          gggccggcttgggggc--------cggcagcggcggcg----ccacccgc
A0A2I3RTV4_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2R9BPJ5_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2I3RTV4_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2R9BPJ5_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5I9I0_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2I3GJZ3_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2I3GJZ3_MCL1-02      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K6KRW9_MCL1-02      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K6PPI3_MCL1-02      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K6KRW9_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K6PPI3_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2I3LFM0_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5W0W9_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K6ECR0_MCL1-02      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
I7G687_MCL1-01          gggccggcttgggggc--------cggcagcagcggcg----ccacccct
A0A2K5LXU8_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5LXU8_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A0D9RZP5_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5W0W9_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K6ECR0_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5XSB2_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5XSB2_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2I3LFM0_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5R5E2_MCL1-03      gggccggcttgggggc--------tggcagcggcggcg----ccacccct
A0A2K6V5Y3_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccaccccc
A0A2K6V5Y3_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccaccccc
A0A2K5R5E2_MCL1-04      gggccggcttgggggc--------tggcagcggcggcg----ccacccct
F7GTF7_MCL1-01          gggccggcttgggggc--------cggcagcggcggcg----ccacccct
F7GTF7_MCL1-02          gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5CFH3_MCL1-01      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
A0A2K5CFH3_MCL1-03      gggccggcttgggggc--------cggcagcggcggcg----ccacccct
D2ITA0_MCL1-03          gaaactaacttcaaactacggaaccagcttagtccaga------------
D2ITA0_MCL1-04          gaaactaacttcaaactacggaaccagcttagtccaga------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          gaaccgcaccgcgatagacacca------------tga------------
A0A3B5PQ55_MCL1-01      gt---------------------------------taa------------
A0A3B5PQ55_MCL1-02      gt---------------------------------taa------------
A0A3P9Q4I8_MCL1-01      gt---------------------------------taa------------
A0A3P9Q4I8_MCL1-02      gt---------------------------------taa------------
A0A3B3VM25_MCL1-01      gt---------------------------------taa------------
A0A087X830_MCL1-01      at---------------------------------taa------------
A0A3B3YCD0_MCL1-01      gt---------------------------------taa------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          gaaactggccgcgttaaac---atgaccggagtcatga------------
A0A2U9CJ81_MCL1-01      aaagcgggccgccttcaacgttacgaccggagtcatgg------------
A0A3Q3B4P5_MCL1-01      gaaac------------------------------cga------------
A0A3Q3B4P5_MCL1-02      gaaac------------------------------cga------------
A0A3Q3IZW0_MCL1-01      gaagtgggcagacgttaacgttacaaccgaaatcatga------------
A0A3Q3GP42_MCL1-01      gaagcgggcggcggtcagcgtatctgccggagtcatga------------
A0A3Q1GX28_MCL1-02      gggcagaacagctatgaaactagccacgggaggaatga------------
A0A3Q1GX28_MCL1-01      gggcagaacagctatgaaactagccacgggaggaatga------------
A0A3Q3M6G2_MCL1-01      gagacgagccgc------cctcatacccggagtcatga------------
A0A3Q3M6G2_MCL1-02      gagacgagccgc------cctcatacccggagtcatga------------
A0A3B4T8L9_MCL1-01      gaaaccgaccgc------ttttacggcca------tga------------
A0A3B4T8L9_MCL1-02      gaaaccgaccgc------ttttacggcca------tga------------
A0A3B4XKA5_MCL1-01      gaaacaggccgc------tttaaccgccg------tga------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      gaattgtcgaat------gggctcgtataaaaatgtca------------
I3KXG5_MCL1-01          ------------------gttctcct---------taa------------
I3JHR5_MCL1-03          gaaaaggaacca------gtgtacct---------tca------------
I3JHR5_MCL1-02          gaaaaggaacca------gtgtacct---------tca------------
I3JHR5_MCL1-01          gaaaaggaacca------gtgtacct---------tca------------
A0A3Q4HLQ8_MCL1-01      gaaaaggaacca------gtgcacct---------tca------------
A0A3P9BVM3_MCL1-01      gaaaaggaacca------gtgtaccc---------taa------------
A0A3P8NP63_MCL1-02      gaaaaggaacca------gtgcacct---------taa------------
A0A3P8NP63_MCL1-01      gaaaaggaacca------gtgcacct---------taa------------
A0A3Q2VNL8_MCL1-01      gaaaaggaacca------gtgcacct---------taa------------
A0A3B4G4Z6_MCL1-01      gaaaaggaacca------gtgcacct---------taa------------
A0A3B4ZKP6_MCL1-01      gaaacggacggc------gctca------------tga------------
A0A3Q1EQB9_MCL1-01      gaagaggacgac------gctga------------tga------------
A0A3Q1EQB9_MCL1-02      gaagaggacgac------gctga------------tga------------
A0A3P8RQX7_MCL1-02      gaagaggacggc------gttca------------tga------------
A0A3P8RQX7_MCL1-01      gaagaggacggc------gttca------------tga------------
A0A3Q1BKL8_MCL1-01      gaagaggacggc------gttca------------tga------------
A0A3Q1BKL8_MCL1-02      gaagaggacggc------gttca------------tga------------
A0A3Q2EDX8_MCL1-01      -------------------------------------a------------
A0A3Q2P7X9_MCL1-02      acaactgg---------------------------taa------------
A0A3Q2P7X9_MCL1-01      acaactgg---------------------------taa------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ccatttggggtcagttttgtggaaatcggaggcgagctctcagggaccag
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ccgcccgccgccgccgctccggccgccgccgccg----------------
A0A1L1RNM6_MCL1-02      ccgcccgccgccgccgctccggccgccgccgccg----------------
H9GEA6_MCL1-02          -----------gcggcgtctcggttc------------------------
H9GEA6_MCL1-01          -----------gcggcgtctcggttc------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          ccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagag
F6ZMX1_MCL1-01          ccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagag
F6ZMX1_MCL1-02          ccgtccggcgggcgcctgctagcttctggcaaaggccctacggttgagag
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ccttcaggaaggaggtccctgcc---------------------------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          ---ccggcaggggcgcgcctggtggccg---aggaggccaagg-------
Q9Z1P3_MCL1-01          ---ccggccgggacgcgcctggcggccg---aggaggccaagg-------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      ---ccaggaccgcggctttt------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      ---ccgggagcgcagctcttagccgccgagaaggaggccgcgg-------
G1T2Q0_MCL1-02          ---ccggcagagcggctttt------------------------------
G1T2Q0_MCL1-01          ---ccggcagagcggcttttggctgcggagaaggaggccgcgg-------
G3T756_MCL1-01          ---ccgggagggcgacttccagctcctggaaaggaggccacgg-------
A0A1S3F3I1_MCL1-01      ---ccgggagggcggctcttg---acggcggaggaggccagtg-------
A0A2K6GI15_MCL1-01      ---ccgggagggcggcttttggctgccgagaaggaggccacgg-------
F7AVA6_MCL1-02          ---ccgggagggcggctttt------------------------------
F7AVA6_MCL1-01          ---ccgggagggcggcttttggctgcggggaaggaggccacgg-------
A0A337S3J9_MCL1-01      ---tcgggagggcggcttgtggctgtggggaaggaggccacgg-------
Q7YRZ9_MCL1-01          ---tcgggagggcggcttgtggctgtggggaaggaggccacgg-------
A0A337S3J9_MCL1-04      ---tcgggagggcggcttgt------------------------------
A0A337S3J9_MCL1-03      ---tcgggagggcggcttgtggctgtggggaaggaggccacgg-------
Q8HYS5_MCL1-01          ---tcgggagggcggcttttggcttcggggagggaggccacga-------
F1PAP1_MCL1-01          ---tcgggagggcggcttttggcttcggggaaggaggccacga-------
F1PAP1_MCL1-02          ---tcgggagggcggctttt------------------------------
M3XZZ5_MCL1-01          ---tcgggagggcggcttttggcttcggggaaggaggccacgg-------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gctccgggaggccgtctcttggctacgggaaaagaggccacgg-------
A0A287BK44_MCL1-01      gctccgggaggccgtctcttggctacgggaaaagaggccacgg-------
A0A452RHX5_MCL1-01      ---tcgggagggcggcttttggcttcggggaaggaggccacgg-------
G1L3L7_MCL1-02          ---tcgggagggcggcttttggcttcggggaaggaggccacgg-------
G1L3L7_MCL1-01          ---tcgggagggcggcttttggcttcggggaaggaggccacgg-------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          ---ccgggggggcggcttttggctgcggggaaggaggccacgg-------
A0A452GA25_MCL1-02      ---ccgggggggcggcttttggctgcggggaaggaggccacgg-------
A0A452GA25_MCL1-01      ---ccgggggggcggcttttggctgcggggaaggaggccacgg-------
G2HFR3_MCL1-01          -----------gtgaatttta-----------------------------
A0A2K5EPX0_MCL1-02      ----ccagag----------------------------------------
A0A2K5EPX0_MCL1-01      ---tccagac----------------------------------------
A0A2K5C7L5_MCL1-01      ---ccgggagggcggcttttggccacggagaaggaggcctcgg-------
H0XFB7_MCL1-01          ---ccgggagggcggcttttggctgcggagaaggaggccgcgg-------
A0A2K6GI15_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A2K5I9I0_MCL1-02      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
H2N5Y9_MCL1-01          ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
C8YZ26_MCL1-01          ---ccgggagggcgactttt------------------------------
A0A2I2YQH7_MCL1-01      ---ccgggagggcgacttttagctacggagaaggaggcctcgg-------
A0A2I2YQH7_MCL1-03      ---ccgggagggcgactttta-----------------------------
B4E3L8_MCL1-01          ---------------------------------gaagccccgg-------
B4DG83_MCL1-01          ---------------------------------gaagccccgg-------
B4DU51_MCL1-01          ---ccgggagggcgacttttggctacggagatggaagccccgg-------
Q07820_MCL1-04          ---ccgggagggcgactttt------------------------------
B4DLY8_MCL1-01          ---ccgggagggcgacttttggctacggagaaggaggcctcgg-------
A0A2I3RTV4_MCL1-01      ---ccgggagggcgacttttggctacggagaaggaggcctcgg-------
A0A2R9BPJ5_MCL1-03      ---ccgggagggcgactttt------------------------------
A0A2I3RTV4_MCL1-03      ---ccgggagggcgactttt------------------------------
A0A2R9BPJ5_MCL1-01      ---ccgggagggcgacttttggctacggagaaggaggcctcgg-------
A0A2K5I9I0_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A2I3GJZ3_MCL1-01      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2I3GJZ3_MCL1-02      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K6KRW9_MCL1-02      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K6PPI3_MCL1-02      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K6KRW9_MCL1-01      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K6PPI3_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A2I3LFM0_MCL1-01      ---ccgggagggcggcttttagctacggagaaggaggcctcgg-------
A0A2K5W0W9_MCL1-01      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K6ECR0_MCL1-02      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
I7G687_MCL1-01          ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K5LXU8_MCL1-01      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K5LXU8_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A0D9RZP5_MCL1-01      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K5W0W9_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A2K6ECR0_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A2K5XSB2_MCL1-01      ---ccgggagggcggcttttggctacggagaaggaggcctcgg-------
A0A2K5XSB2_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A2I3LFM0_MCL1-03      ---ccgggagggcggctttt------------------------------
A0A2K5R5E2_MCL1-03      ---ccgggagggcggcttttggccacggagaaggaggcctcgg-------
A0A2K6V5Y3_MCL1-01      ---ccgggagggcggcttctggccgcggagaaggaggcctcgg-------
A0A2K6V5Y3_MCL1-03      ---ccgggagggcggcttct------------------------------
A0A2K5R5E2_MCL1-04      ---ccgggagggcggctttt------------------------------
F7GTF7_MCL1-01          ---ccgggagggcggcttttggccacagagaaggaggcctcgg-------
F7GTF7_MCL1-02          ---ccgggagggcggctttt------------------------------
A0A2K5CFH3_MCL1-01      ---ccgggagggcggcttttggccacggagaaggaggcctcgg-------
A0A2K5CFH3_MCL1-03      ---ccgggagggcggcttttggccacggagaaggaggcctcgg-------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-02          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      caagaattgaccattttgggtcagttccatggaattcagaggcgagtccc
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ----------ccaccgtcgctgaggtaccgcggccgctgatt---ggctc
A0A1L1RNM6_MCL1-02      ----------ccaccgtcgctgaggtaccgcggccgctgatt---ggctc
H9GEA6_MCL1-02          --------------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          tactccgccgcagcgcgatggaggggaagtggaaacagggacggcggggg
F6ZMX1_MCL1-01          tactccgccgcagcgcgatggaggggaagtggaaacagggacggcggggg
F6ZMX1_MCL1-02          tactccgccgcagcgcgatggaggggaagtggaaacagggacggcggggg
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------cccaagagtcaggggcggggagggaaacgggcacgg------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------cgcggcgcgaggggggaggggagg------------------
Q9Z1P3_MCL1-01          --------cgcggcgcgaggggggaggggagg------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      --------cccggcgagaggcagggggaggggaagccg------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------cccggctagaggtagggggaggggaggccggcgcgg------
G3T756_MCL1-01          --------cccggcaagaggtagggggagggga-----------------
A0A1S3F3I1_MCL1-01      --------cccggcgggaggcggggggaggggaagccggcgcgg------
A0A2K6GI15_MCL1-01      --------cccggcgagaggtagggggaggggaagacggcacgg------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------cccggcgagagggagggggaggggaggccggcgcgg------
A0A337S3J9_MCL1-01      --------ccaggcgagaggtagggggaggggaagccggtgcgg------
Q7YRZ9_MCL1-01          --------ccaggcgagaggtagggggaggggaagccggtgcgg------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      --------ccaggcgagaggtagggggaggggaagccggtgcgg------
Q8HYS5_MCL1-01          --------ccagacgggagggagggggaggggaagccggtgcgg------
F1PAP1_MCL1-01          --------ccagacgggagggagggggaggggaagccggtgcgg------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------cccggcgggaggtagggggaggggaagccggtgcgg------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------cccggcaagaggtagggggaggggaagccggcatgg------
A0A287BK44_MCL1-01      --------cccggcaagaggtagggggaggggaagccggcatgg------
A0A452RHX5_MCL1-01      --------cccggcgggaggtagggggaggggaagccggtgcgg------
G1L3L7_MCL1-02          --------cccggagggagatagggggaggggaagccggtgcgg------
G1L3L7_MCL1-01          --------cccggagggagatagggggaggggaagccggtgcgg------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------cgcggcgagaggtagggggaggggaagccggcacgg------
A0A452GA25_MCL1-02      --------cgc---------------------------------------
A0A452GA25_MCL1-01      --------cgcggcgagaggtagggggaggggaagccggcacgg------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------cccagcgagaggtagggggaggggaggccggcgtgg------
H0XFB7_MCL1-01          --------cccggcgagaggcagggggaggggaagccggcgagg------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------cccggcgagagatagggggaggggaggccggcacgg------
H2N5Y9_MCL1-01          --------cccggcgagagatagggggaggggaggccggcgcgg------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------cccggcgagagatagggggaggggaggccggcgcgg------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------cc----------------------------------------
B4DG83_MCL1-01          --------cc----------------------------------------
B4DU51_MCL1-01          --------cc----------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------cccggcgagagatagggggaggggaggccggcgcgg------
A0A2I3RTV4_MCL1-01      --------cccggcgagagatagggggaggggaggccggcgcgg------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------cccggcgagagatagggggaggggaggccggcgcgg------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------cccggcgagagatagggggaggggaggccggcgcgg------
A0A2I3GJZ3_MCL1-02      --------cccggcgagagatagggggaggggaggccggcgcgg------
A0A2K6KRW9_MCL1-02      --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K6PPI3_MCL1-02      --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K6KRW9_MCL1-01      --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K5W0W9_MCL1-01      --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K6ECR0_MCL1-02      --------cccggcgagagatagggggaggggaggccggcacgg------
I7G687_MCL1-01          --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K5LXU8_MCL1-01      --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------ctcggcgagagatagggggaggggaggccggcacgg------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------cccggcgagagatagggggaggggaggccggcacgg------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------cccagcgagaggtagggggaggggaggccggcgcgg------
A0A2K6V5Y3_MCL1-01      --------cccagcgagaggtagggggaggggaggccggcgcgg------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          --------cccagcgagaggtagggggaggggaggccggcgcgg------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------cccagcgagaggtagggggaggggaggccggcgcgg------
A0A2K5CFH3_MCL1-03      --------cccagcgagaggtagggggaggggaggccggcgcgg------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-02          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          ----------------------------------------cgcccctcga
Q568V1_MCL1-01          ---------------------------------------aaactccgacg
Q1L8X3_MCL1-01          ---------------------------------------aaactccgacg
Q9I9N3_MCL1-01          ---------------------------------------aaactccgacg
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------gccaccggcttgttctgccccggc
A0A3Q2Y539_MCL1-01      --------------------------gctttcccctgtataacttcaagg
Q0KFR9_MCL1-01          ----------------------------------atgttgcattttcaaa
A0A3P8Y1W8_MCL1-02      ----------------------------------atgctcaacgttcaaa
A0A3P8Y1W8_MCL1-01      ----------------------------------atgctcaacgttcaaa
A0A3B3CEX1_MCL1-01      --------------------------ttaacagctacattacgccgagct
A0A3B3CEX1_MCL1-02      --------------------------ttaacagctacattacgccgagct
A0A3P9ILF6_MCL1-01      --------------------------ttaacagctacatcacgtctaact
A0A3P9ILF6_MCL1-02      --------------------------ttaacagctacatcacgtctaact
A0A3B3IJ04_MCL1-01      --------------------------ttaacagctacatcacgtctaact
A0A3B3IJ04_MCL1-02      --------------------------ttaacagctacatcacgtctaact
A0A3P9L1F3_MCL1-02      --------------------------ttaacagctacatcacgtctaact
A0A3P9L1F3_MCL1-01      --------------------------ttaacagctacatcacgtctaact
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      ----------------------ccccaaggccgccccatgcgcccacaaa
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------ttctgcctcaaa
A0A3B1IEV7_MCL1-01      --------------------------accgcgat--cagcctcctgtgtg
A0A3B4CGU9_MCL1-03      ----------------------------cgccat--cagcctgttctgta
A0A3B4CGU9_MCL1-02      --------------------------atcaacatggcagctcatcctgga
W5MMB7_MCL1-01          ------------------acgccaccaccattcaccccggcctcgccagc
A0A3P8VKM5_MCL1-03      -----------------------------gctgtttcatcgtccctcaaa
A0A3P8VKM5_MCL1-05      -----------------------------gctgtttcatcgtccctcaaa
A0A3P8VKM5_MCL1-04      -----------------------------gctgtttcatcgtccctcaaa
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      cggggagtggtgggaactgcccattttgggtcagttttgtggaactcgga
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgcggggctgtggg--ccgcc--------gccggccgcgccgaagccccc
A0A1L1RNM6_MCL1-02      cgcggggctgtggg--ccgcc--------gccggccgcgccgaagccccc
H9GEA6_MCL1-02          -------------cgaaggcctcaggtcttttctcagagaggccgcgccc
H9GEA6_MCL1-01          -------------cgaaggcctcaggtcttttctcagagaggccgcgccc
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          cagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtctcg
F6ZMX1_MCL1-01          cagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtctcg
F6ZMX1_MCL1-02          cagggttgattggcggaggaatccgtgcgagtcctccgaatcctgtctcg
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ------tgattggctggagcgctggcgcgagcccccaagccactctcgcg
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          ---------------------------------------ccgccctgctg
Q9Z1P3_MCL1-01          ---------------------------------------ccgctctgctg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      ------------------------------------------cccagccg
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          ------tgattggcggaagcccgggcgctagccccccggccgcgctggcg
G3T756_MCL1-01          -------------------cgccggcgcgagccccccggccgctgtcgct
A0A1S3F3I1_MCL1-01      ------ggattggcggaagcgccggcgcgagcccctcgaccaccctggcg
A0A2K6GI15_MCL1-01      ------tgattggcggaagccccggcgcaagccccccggcctccctcacg
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ------tgattggcggaagcgccggcgggagcccccagaccaccctcgcg
A0A337S3J9_MCL1-01      ------tgattggcggaagcgccggcgcgagccccccagccactctcgcg
Q7YRZ9_MCL1-01          ------tgattggcggaagcgccggcgcgagccccccagccactctcgcg
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ------tgattggcggaagcgccggcgcgagccccccagccactctcgcg
Q8HYS5_MCL1-01          ------tgattggcggaagcgccggcgcaagtcccccgaccactctggcg
F1PAP1_MCL1-01          ------tgattggcggaagcgccggcgcaagtcccccgaccactctggcg
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          ------tgattggcggaagcgccggcgcgagtaccccggccactctcgcg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ------tgattggcggaagcgccggcgcgagccccccgtccactcctgcg
A0A287BK44_MCL1-01      ------tgattggcggaagcgccggcgcgagccccccgtccactcctgcg
A0A452RHX5_MCL1-01      ------tgattggcggaagcgccggcgctagtcccccggccactctcgcg
G1L3L7_MCL1-02          ------tgattggcggaagcgccggcgctagtcccccggc------cnnn
G1L3L7_MCL1-01          ------tgattggcggaagcgccggcgctagtcccccggn----------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          ------tgattggcggaagcgccggcccgagccccccggccactcttgcg
A0A452GA25_MCL1-02      ------------------gcgccggcccgagccccccggccactcttgcg
A0A452GA25_MCL1-01      ------tgattggcggaagcgccggcccgagccccccggccactcttgcg
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ------tgattggcggaagcgccggcgctagcccctcggccgccctcacg
H0XFB7_MCL1-01          ------tgattggcggaagccccggcgcgagttccccggcctccctcacg
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ------tgattggcggaagcgccggcgcaagccccccggccgccctcacg
H2N5Y9_MCL1-01          ------tgattggcggaagcgccggcgcaagccccccgtctaccctcacg
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      ------tgattggcggaagcgccggcgcaagccccccgtccaccctcacg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          ------tgattggcggaagcgccggcgcaagccccccgtccaccctcacg
A0A2I3RTV4_MCL1-01      ------tgattggcggaagcgctggcgcaagccccccgtccaccctcacg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ------tgattggcggaagcgccggcgcaagccccccgtccaccctcacg
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      ------tgattggcggaagcgccggcgcaagccccccgtcagtcctcaca
A0A2I3GJZ3_MCL1-02      ------tgattggcggaagcgccggcgcaagccccccgtcagtcctcaca
A0A2K6KRW9_MCL1-02      ------tgattggcgaaagcgccggcgcaagccccccggccgccctcacg
A0A2K6PPI3_MCL1-02      ------tgattggcgaaagcgccggcgcaagccccccggccgccctcacg
A0A2K6KRW9_MCL1-01      ------tgattggcgaaagcgccggcgcaagccccccggccgccctcacg
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      ------tgattggcggaaccgccggcgcaagccccccggccgccctcacg
A0A2K5W0W9_MCL1-01      ------tgattggcggaagcgccggcgcaagccccccggccgccctcacg
A0A2K6ECR0_MCL1-02      ------tgattggcggaagcgccggcgcaagccccccggccgccctcacg
I7G687_MCL1-01          ------tgattggcggaagcgccggcgcaagccccccggccgccctcacg
A0A2K5LXU8_MCL1-01      ------tgattggcggaagcgccggcgcaagccccccggccgccctcacg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ------tgattggcggaagcgctggcgcaagccccccggccgccctcacg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ------tgattggcggaagcgccggcgcaagccccccggccgccctcacg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      ------tgattggcggaagcgtcggcgctagccccccggccgccctcacg
A0A2K6V5Y3_MCL1-01      ------tgattggcggaagcgccggcgctagccctccggccgccctgacg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          ------tgactggcggaagcgccggcgctagccccccggccgccctcacg
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      ------tgattggcggaagcgccggcgctagccccccggccgccctcgtg
A0A2K5CFH3_MCL1-03      ------tgattggcggaagcgccggcgctagccccccggccgccctcgtg
D2ITA0_MCL1-03          --------------------------cctgctggtttaacagccctcaaa
D2ITA0_MCL1-04          --------------------------cctgctggtttaacagccctcaaa
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------a---------tgttatgtttcaaa
A0A3B5PQ55_MCL1-01      --------------------------actat---ctcattttttctcaaa
A0A3B5PQ55_MCL1-02      --------------------------actat---ctcattttttctcaaa
A0A3P9Q4I8_MCL1-01      --------------------------actat---ctcattttttcacaaa
A0A3P9Q4I8_MCL1-02      --------------------------actat---ctcattttttcacaaa
A0A3B3VM25_MCL1-01      --------------------------actat---ctaattttttctcaaa
A0A087X830_MCL1-01      --------------------------actat---ctaattttttctcaaa
A0A3B3YCD0_MCL1-01      --------------------------actat---ctaattttttctcaaa
A0A3Q3VP02_MCL1-01      --------------------------------------tgttgtttcaaa
G3PJT0_MCL1-01          --------------------------gctgc---attattctccctcaaa
A0A2U9CJ81_MCL1-01      --------------------------gctgc---ctcattcttcctcaaa
A0A3Q3B4P5_MCL1-01      --------------------------gctat---attttttttcttcaaa
A0A3Q3B4P5_MCL1-02      --------------------------gctat---attttttttcttcaaa
A0A3Q3IZW0_MCL1-01      -----------------------------gc---cttattcttcctcaaa
A0A3Q3GP42_MCL1-01      -----------------------------gc---tttatgatgccacaaa
A0A3Q1GX28_MCL1-02      --------------------------gctgc---ttgatgcttcctcaaa
A0A3Q1GX28_MCL1-01      --------------------------gctgc---ttgatgcttcctcaaa
A0A3Q3M6G2_MCL1-01      --------------------------tcg---------tccttccccaag
A0A3Q3M6G2_MCL1-02      --------------------------tcg---------tccttccccaag
A0A3B4T8L9_MCL1-01      --------------------------actat---tgcatttgtcgtcaaa
A0A3B4T8L9_MCL1-02      --------------------------actat---tgcatttgtcgtcaaa
A0A3B4XKA5_MCL1-01      --------------------------actat---tgcatttgtcgtcaaa
A0A3Q0R633_MCL1-01      -------------------------------------tctcttcctt---
A0A3Q0R633_MCL1-03      --------------------------tggac---ctttttcttcctcaaa
I3KXG5_MCL1-01          --------------------------attgc---tgtctg-----tctga
I3JHR5_MCL1-03          --------------------------tagac---tatcttcttcctcaaa
I3JHR5_MCL1-02          --------------------------tagac---tatcttcttcctcaaa
I3JHR5_MCL1-01          --------------------------tagac---tatcttcttcctcaaa
A0A3Q4HLQ8_MCL1-01      --------------------------tagac---tatcttattcctcaaa
A0A3P9BVM3_MCL1-01      --------------------------tggaa---tatcttattcctcaaa
A0A3P8NP63_MCL1-02      --------------------------tggaa---tatcttattcctcaaa
A0A3P8NP63_MCL1-01      --------------------------tggaa---tatcttattcctcaaa
A0A3Q2VNL8_MCL1-01      --------------------------tggaa---tatcttattcctcaaa
A0A3B4G4Z6_MCL1-01      --------------------------tggaa---tatcttattcctcaaa
A0A3B4ZKP6_MCL1-01      --------------------------gctgc---tttattcttcctcaaa
A0A3Q1EQB9_MCL1-01      --------------------------actgc---ttaatctttccgcaaa
A0A3Q1EQB9_MCL1-02      --------------------------actgc---ttaatctttccgcaaa
A0A3P8RQX7_MCL1-02      --------------------------actac---ttaatttttcctcaaa
A0A3P8RQX7_MCL1-01      --------------------------actac---ttaatttttcctcaaa
A0A3Q1BKL8_MCL1-01      --------------------------actac---ttaatttttcctcaaa
A0A3Q1BKL8_MCL1-02      --------------------------actac---ttaatttttcctcaaa
A0A3Q2EDX8_MCL1-01      --------------------------gttac---cttattcttccacaaa
A0A3Q2P7X9_MCL1-02      --------------------------actgt---ctaatttct---caaa
A0A3Q2P7X9_MCL1-01      --------------------------actgt---ctaatttct---caaa
                                                                          

A0A3B3SG34_MCL1-01      -----------------------------------------agacccctg
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          -----------------------------------------g--------
A2BF68_MCL1-01          -----------------------------------------g--------
Q568W5_MCL1-01          -----------------------------------------g--------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          ctagtttcctc------------------------------attccctgc
Q568V1_MCL1-01          ctgaagacgtgcgtcga---------------------------------
Q1L8X3_MCL1-01          ctaaagacgtgcgtcga---------------------------------
Q9I9N3_MCL1-01          ctaaagacgtgcgtcga---------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      attaaaaatggcgtgaag--------------------------------
A0A3Q2Y539_MCL1-01      ttggactcgtggacgctt--------------------------------
Q0KFR9_MCL1-01          atgga------ggatcttcgtacctagctgatgatgctaggccgttgtac
A0A3P8Y1W8_MCL1-02      atggagtcgtgggatctttgtattc------tggtgcc---cctttgtgc
A0A3P8Y1W8_MCL1-01      atggagtcgtgggatctttgtattc------tggtgcc---cctttgtgc
A0A3B3CEX1_MCL1-01      gtggatgtacgg------------------------------cac---tc
A0A3B3CEX1_MCL1-02      gtggatgtacgg------------------------------cac---tc
A0A3P9ILF6_MCL1-01      gtggatttacgg------------------------------gacacatc
A0A3P9ILF6_MCL1-02      gtggatttacgg------------------------------gacacatc
A0A3B3IJ04_MCL1-01      gtggatttacgg------------------------------gacacatc
A0A3B3IJ04_MCL1-02      gtggatttacgg------------------------------gacacatc
A0A3P9L1F3_MCL1-02      gtggatttacgg------------------------------gacacatc
A0A3P9L1F3_MCL1-01      gtggatttacgg------------------------------gacacatc
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      atggagtcgcggaaggct-----------------------tatt-----
A0A3B4AFB7_MCL1-01      -----------------------------------------acat-----
A0A3B4AFB7_MCL1-02      atggactcgcggaggggg-----------------------acat-----
A0A3B1IEV7_MCL1-01      acggaacaag-----ccc-----------------------ggttctc--
A0A3B4CGU9_MCL1-03      acggagcggggaggatcc-----------------------cgttcaa--
A0A3B4CGU9_MCL1-02      g-gcagtatctgtgctcc-----------------------ggttctc--
W5MMB7_MCL1-01          ctggggccctgtccgggc-----------------------gggtccgcc
A0A3P8VKM5_MCL1-03      atggagtcgttaatggaa-----------------------ccat-----
A0A3P8VKM5_MCL1-05      atggagtcgttaatggaa-----------------------ccat-----
A0A3P8VKM5_MCL1-04      atggagtcgttaatggaa-----------------------ccat-----
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      agcgagcccctggggatg-----------------------gggcggaac
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgcgctcccattggctcc-----------------------ggggcggcc
A0A1L1RNM6_MCL1-02      cgcgctcccattggctcc-----------------------ggggcggcc
H9GEA6_MCL1-02          tctgattggcggggggcc-----------------------tcgcgccgg
H9GEA6_MCL1-01          tctgattggcggggggcc-----------------------tcgcgccgg
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          ccgggcgcccggggggtc-----------------------gcgcggccc
F6ZMX1_MCL1-01          ccgggcgcccggggggtc-----------------------gcgcggccc
F6ZMX1_MCL1-02          ccgggcgcccggggggtc-----------------------gcgcggccc
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          agggatcctgggagggtc-----------------------gctcgcccc
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          cccggcgcgcgggtggtc-----------------------gcccggccg
Q9Z1P3_MCL1-01          cccggcgcgcgggtggtc-----------------------gcccggccg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      cccagcgcccgcagggtc-----------------------gcgcggccg
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          ccggacgcccggagggtc-----------------------gcgcggccg
G3T756_MCL1-01          ccggacggccggagggtc-----------------------gtgcggccg
A0A1S3F3I1_MCL1-01      ccggacgcccggagggtc-----------------------gcgcgtccc
A0A2K6GI15_MCL1-01      ccagaagcccggagggtc-----------------------gcgcggccg
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ccggactccctgagggtc-----------------------gcgcggccc
A0A337S3J9_MCL1-01      cccgacgcccggagggtc-----------------------gcgcggccc
Q7YRZ9_MCL1-01          cccgacgcccggagggtc-----------------------gcgcggccc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      cccgacgcccggagggtc-----------------------gcgcggccc
Q8HYS5_MCL1-01          ccggacgcccggagggtc-----------------------gcgcggccc
F1PAP1_MCL1-01          ccggacgcccggagggtc-----------------------gcgcggccc
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          ccggacgcccggagggtc-----------------------gcgcggccc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ccagacgcccggagggtc-----------------------gcgcggccc
A0A287BK44_MCL1-01      ccagacgcccggagggtc-----------------------gcgcggccc
A0A452RHX5_MCL1-01      ccggacgcccggagggtc-----------------------gcgcggccc
G1L3L7_MCL1-02          nnnnnnnnnnnnnnnnnn-----------------------nnnnnnnnn
G1L3L7_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          ----------------------------------------------aacc
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          cccgacgcccggagggtc-----------------------gcgcggccc
A0A452GA25_MCL1-02      cccgacgcccggagggtc-----------------------gcgcggccc
A0A452GA25_MCL1-01      cccgacgcccggagggtc-----------------------gcgcggccc
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      cctgacgcccgg-gggtc-----------------------gtgcggccg
H0XFB7_MCL1-01          ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ccagacgcccggagggtc-----------------------gcgcggccg
H2N5Y9_MCL1-01          ccagactcccggagggtc-----------------------gcgcggccg
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      ccagactcccggagggtc-----------------------gcgcggccg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          ccagactcccggagggtc-----------------------gcgc-----
A0A2I3RTV4_MCL1-01      ccagactcccggagggtc-----------------------gcgcggccg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ccagactcccggagggtc-----------------------gcgcggccg
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      ccagactcccggagggtc-----------------------gcgcggccg
A0A2I3GJZ3_MCL1-02      ccagactcccggagggtc-----------------------gcgcggccg
A0A2K6KRW9_MCL1-02      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K6PPI3_MCL1-02      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K6KRW9_MCL1-01      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K5W0W9_MCL1-01      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K6ECR0_MCL1-02      ccagacgcccggagggtc-----------------------gcgcggccg
I7G687_MCL1-01          ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K5LXU8_MCL1-01      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ccagacgcccggagggtc-----------------------gcgcggccg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      cctgacgcccggagggtc-----------------------gtgcggccg
A0A2K6V5Y3_MCL1-01      cctgacgcccggagggtc-----------------------gtgcggccg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          cctgacgcccgaagggtc-----------------------gtgcggccg
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      cctgacgcccggagggtc-----------------------gtgcggccg
A0A2K5CFH3_MCL1-03      cctgacgcccggagggtc-----------------------gtgcggccg
D2ITA0_MCL1-03          atggaggcgaagagcgaa-----------------------acat-----
D2ITA0_MCL1-04          atggaggcgaagagcgaa-----------------------acat-----
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          atggagtcgggga-------------------------------------
A0A3B5PQ55_MCL1-01      atggagtcgggaatggac-----------------------aaac----a
A0A3B5PQ55_MCL1-02      atggagtcgggaatggac-----------------------aaac----a
A0A3P9Q4I8_MCL1-01      atggagtcgggaatggac-----------------------aaac----a
A0A3P9Q4I8_MCL1-02      atggagtcgggaatggac-----------------------aaac----a
A0A3B3VM25_MCL1-01      atggagtcggggatggac-----------------------aaac----a
A0A087X830_MCL1-01      atggagtcggggatggac-----------------------aaac----a
A0A3B3YCD0_MCL1-01      atggagtcggggatggac-----------------------aaac----a
A0A3Q3VP02_MCL1-01      atggagtcgtgtcgggac-----------------------cgac----g
G3PJT0_MCL1-01          atggagtcgcg---------------------------------------
A0A2U9CJ81_MCL1-01      atggagtcgtggagggag-----------------------cgat----g
A0A3Q3B4P5_MCL1-01      atggagtcgtggacggat-----------------------t--------
A0A3Q3B4P5_MCL1-02      atggagtcgtggacggat-----------------------t--------
A0A3Q3IZW0_MCL1-01      atggagtcgtggagggat-----------------------ccat----g
A0A3Q3GP42_MCL1-01      atggagtcgggaagggac-----------------------agat----g
A0A3Q1GX28_MCL1-02      atggagtcgtagag------------------------------------
A0A3Q1GX28_MCL1-01      atggagtcgtagag------------------------------------
A0A3Q3M6G2_MCL1-01      atggagtcctggagggac-----------------------ccgt----g
A0A3Q3M6G2_MCL1-02      atggagtcctggagggac-----------------------ccgt----g
A0A3B4T8L9_MCL1-01      atggaggattggaaactt-----------------------ggac-----
A0A3B4T8L9_MCL1-02      atggaggattggaaactt-----------------------ggac-----
A0A3B4XKA5_MCL1-01      atggaggattggagactt-----------------------ggag-----
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      atggagtcgtggacggaa-----------------------caat----g
I3KXG5_MCL1-01          gtggtgtcc---aaacaa-----------------------cgatgtggg
I3JHR5_MCL1-03          atggagtcctggagggac-----------------------caat----g
I3JHR5_MCL1-02          atggagtcctggagggac-----------------------caat----g
I3JHR5_MCL1-01          atggagtcctggagggac-----------------------caat----g
A0A3Q4HLQ8_MCL1-01      atggagtcctagagggac-----------------------caat----g
A0A3P9BVM3_MCL1-01      atggagtcttggagggac-----------------------caat----g
A0A3P8NP63_MCL1-02      atggagtcttggagggac-----------------------caat----g
A0A3P8NP63_MCL1-01      atggagtcttggagggac-----------------------caat----g
A0A3Q2VNL8_MCL1-01      atggagtcttggagggac-----------------------caat----g
A0A3B4G4Z6_MCL1-01      atggagtcttggagggac-----------------------caat----g
A0A3B4ZKP6_MCL1-01      atggagtcgttgagggac-----------------------agat----g
A0A3Q1EQB9_MCL1-01      atggagtcgtggagggac-----------------------cgat----g
A0A3Q1EQB9_MCL1-02      atggagtcgtggagggac-----------------------cgat----g
A0A3P8RQX7_MCL1-02      atggagtcgtggagggac-----------------------cgat----g
A0A3P8RQX7_MCL1-01      atggagtcgtggagggac-----------------------cgat----g
A0A3Q1BKL8_MCL1-01      atggagtcgtggagggac-----------------------cgat----g
A0A3Q1BKL8_MCL1-02      atggagtcgtggagggac-----------------------cgat----g
A0A3Q2EDX8_MCL1-01      atggagtcgtggacggac-----------------------aaac----g
A0A3Q2P7X9_MCL1-02      atggagtcggggacggac-----------------------aacc----g
A0A3Q2P7X9_MCL1-01      atggagtcggggacggac-----------------------aacc----g
                                                                          

A0A3B3SG34_MCL1-01      caccatggcgtcctggggaaaagcattttgcagtgtctcgattcgtctgc
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ----acaacggcttttggccatgcactg----------------------
A2BF68_MCL1-01          ----acaacggcttttggccatgcactg----------------------
Q568W5_MCL1-01          ----acaacggcttttggccatgcactg----------------------
A0A3B1K5R1_MCL1-01      -----------ccacaggatatgtgttc----------------------
A0A3B4C6H5_MCL1-01      -----------ttc----------attt----------------------
A0A3B4C6H5_MCL1-03      -----------cccaaggagatgtattt----------------------
B6V6J0_MCL1-01          cagttttactgctcgggcggcggctcctcagaga----------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      -----------------------------------cagaacggcttctac
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          tatttccagggggctggggccatatgtgctggggcgtcaccgaagtctaa
A0A3P8Y1W8_MCL1-02      tattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaa
A0A3P8Y1W8_MCL1-01      tattttagcccgacagggcccttatgtcctgcggcctcttcgaagtccaa
A0A3B3CEX1_MCL1-01      ttcg---gcggagcgggagagagatccgcgcgcgtgcctctgacctccgc
A0A3B3CEX1_MCL1-02      ttcg---gcggagcgggagagagatccgcgcgcgtgcctctgacctccgc
A0A3P9ILF6_MCL1-01      ctcg---gcagagcgggagagatgtccgcgcgcgtgcctctgccgtccac
A0A3P9ILF6_MCL1-02      ctcg---gcagagcgggagagatgtccgcgcgcgtgcctctgccgtccac
A0A3B3IJ04_MCL1-01      ctcggcagcagagcgggagagatgtccgcgcgcgtgcctctgccgtccac
A0A3B3IJ04_MCL1-02      ctcggcagcagagcgggagagatgtccgcgcgcgtgcctctgccgtccac
A0A3P9L1F3_MCL1-02      ctcggcagcagagcgggagagatgtccgcgcgcgtccctctgccgtccac
A0A3P9L1F3_MCL1-01      ctcggcagcagagcgggagagatgtccgcgcgcgtccctctgccgtccac
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      -----------gcaatgcaactctccccccgtcgccgccgcgtccacatc
A0A3B4AFB7_MCL1-01      --gcctacagggtgtgctaactccaccgcttgg-----------------
A0A3B4AFB7_MCL1-02      --gcactgtggggctgcagattcttccgcgcagatgcctaggcctgcaac
A0A3B1IEV7_MCL1-01      -----------tacaga------accgagaaaga----------------
A0A3B4CGU9_MCL1-03      -----------caaggg------ctcg-----ga----------------
A0A3B4CGU9_MCL1-02      -----------catggaagttcttttg-----ga----------------
W5MMB7_MCL1-01          gcccgcacggctgtcctggaccccatgctcaaggc---------------
A0A3P8VKM5_MCL1-03      --gcactatggcactggaaactccacgcctatagccttagcgtcttcgct
A0A3P8VKM5_MCL1-05      --gcactatggcactggaaactccacgcctatagccttagcgtcttcgct
A0A3P8VKM5_MCL1-04      --gcactatggcactggaaactccacgcctatagccttagcgtcttcgct
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      cgaccattttggggctgttttccc--------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ccccacgctccgatcggttccgcc--------------------------
A0A1L1RNM6_MCL1-02      ccccacgctccgatcggttccgcc--------------------------
H9GEA6_MCL1-02          acccctgagggcgctgattggcccctgggaggggtctcagcgggcgctga
H9GEA6_MCL1-01          acccctgagggcgctgattggcccctgggaggggtctcagcgggcgctga
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          ---------ggagcccagggcccc------agcgtcaccgcgacccctgc
G3WBC5_MCL1-01          ------------------------------gacgtcaccg---ccccgcc
F6ZMX1_MCL1-03          gcacccattggcgcggaggccccc------gacgtcacca---ccgatcc
F6ZMX1_MCL1-01          gcacccattggcgcggaggccccc------gacgtcacca---ccgatcc
F6ZMX1_MCL1-02          gcacccattggcgcggaggccccc------gacgtcacca---ccgatcc
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          tcgcccatgggcacggagggtccc------gatggcaccgcggcccctgc
G1PZ39_MCL1-01          ------------gccgagggcccc------gacgtcatcgggacccttc-
P97287_MCL1-01          ccgcccgtgggcgccgaggacccc------gacgtcaccgcgtcggccga
Q9Z1P3_MCL1-01          cctccggtgggcgccgaggacccc------gacgtcaccgcgtcggcaga
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      ---------ggcgccgaggtcccc------gacgtcaccgcgaccccggc
A0A287DCH9_MCL1-01      gtgcccattggcgccgaggtcccc------gacgtcaccgcgaccccggc
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          gcgcccattggcgccgagctcccc------gacgtcagcgcgacccccgc
G3T756_MCL1-01          gcgcccattggcgccgagggcccc------gacgtcactgcgattcccgc
A0A1S3F3I1_MCL1-01      gcgcccattggcgccgaggtcccc------gacgtcaccgggaccccaac
A0A2K6GI15_MCL1-01      gctcccattggtgccgaagtcccc------gacgtcaccgcgaccccgga
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          tcccccattggcgccgagggcccc------gacgtcaccgcgccctcctc
A0A337S3J9_MCL1-01      tcgcccattggtgccgagggcccc------gacgtcaccgcgaccccccc
Q7YRZ9_MCL1-01          tcgcccattggtgccgagggcccc------gacgtcaccgcgaccccccc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      tcgcccattggtgccgagggcccc------gacgtcaccgcgaccccccc
Q8HYS5_MCL1-01          tcacccattggcgctgagggcccc------aacgtcagcgcgaccccccc
F1PAP1_MCL1-01          tcacccattggcgctgagggcccc------aacgtcagcgcgaccccccc
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          tcgcccattggcgccgagggcccc------aacgtcaccgcgaccccccc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      tcgcccattggcgccgagggcccc------gacgtcaccgcgacccccgc
A0A287BK44_MCL1-01      tcgcccattggcgccgagggcccc------gacgtcaccgcgacccccgc
A0A452RHX5_MCL1-01      tcgcccattggcgccgagggtccc------gacgtcacggcgaccccccc
G1L3L7_MCL1-02          nnnnnnnntggcgccgagggtccc------gacgtcacggcgaccccccc
G1L3L7_MCL1-01          --------tggcgccgagggtccc------gacgtcacggcgaccccccc
W5QI41_MCL1-01          ccgccc-----tgccccaggcccc------gcccctgccttgaccccgc-
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          tcgcccattggcgccgagggcccc------gacgtcaccgcgacccccac
A0A452GA25_MCL1-02      tcgcccattggcgccgagggcccc------gacgtcaccgcgacccccac
A0A452GA25_MCL1-01      tcgcccattggcgccgagggcccc------gacgtcaccgcgacccccac
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ctgc----------------------------------------------
H0XFB7_MCL1-01          ccgcccattggtgccgaagtcccc------gacgtcaccgcgacccccac
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ccgcccattggcgccgaggtcccc------gacgtcaccgcgacccccgc
H2N5Y9_MCL1-01          ccgcccattggcgccgaggtcccc------gacgtcaccgcgacccccgc
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      ccgcccattggcgccgaggtcccc------gacgtcaccgcgacccccgc
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      ccgcccattggcgccgaggtcccc------gacgtcaccgcgacccccgc
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ccgcccattggcgccgaggtcccc------gacgtcaccgcgacccccgc
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      ccgcccattggcgccgaggtctcc------gacgtcactgcgacccccgc
A0A2I3GJZ3_MCL1-02      ccgcccattggcgccgaggtctcc------gacgtcactgcgacccccgc
A0A2K6KRW9_MCL1-02      ccgcccattggcgccgaggtcccc------gacgtcaccgggacccccgc
A0A2K6PPI3_MCL1-02      ccgcccattggcgccgaggtcccc------gacgtcaccgggacccccgc
A0A2K6KRW9_MCL1-01      ccgcccattggcgccgaggtcccc------gacgtcaccgggacccccgc
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      ccgcccattggcgcggaggtcccc------gacgtcaccgcgacccccgc
A0A2K5W0W9_MCL1-01      ccgcccattggcgcggaggtcccc------gacgtcaccgcgagccccgc
A0A2K6ECR0_MCL1-02      ccgcccattggcgcggaggtcccc------gacgtcaccgcgagccccgc
I7G687_MCL1-01          ccgcccattggcgcggaggtcccc------gacgtcaccgcgagccccgc
A0A2K5LXU8_MCL1-01      ccgcccattggcgcggaggtcccc------gacgtcaccgcgacccccgc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ccgcccattggcgcggaggtcccc------gacgtcaccgcgacccccgc
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ccgcccattggcgcggaggtcccc------gacgtcaccgcgacccccgc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      ccgcccattggcgccgaggtcccc------gacgtcaccgcgaccccctc
A0A2K6V5Y3_MCL1-01      ccgcccattggcgccgaggtcccc------gacgtcaccgcgaccccctc
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          ccgcccattggcgccgaggtcccc------gacgtcaccgcgaccccctc
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      ccgcccattggcgccgaggtcccc------gacgtcaccgcgaccccctc
A0A2K5CFH3_MCL1-03      ccgcccattggcgccgaggtcccc------gacgtcaccgcgaccccctc
D2ITA0_MCL1-03          ----------------ggacttccactccgaaggttcacac---------
D2ITA0_MCL1-04          ----------------ggacttccactccgaaggttcacac---------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          -----------cgcggatctttcttcctcgcagatcccgatgggctctcc
A0A3B5PQ55_MCL1-01      cactacga---ccagggactcggtgtgcctgaggtcgcaatgggctccac
A0A3B5PQ55_MCL1-02      cactacga---ccagggactcggtgtgcctgaggtcgcaatgggctccac
A0A3P9Q4I8_MCL1-01      cactacga---ccaggggctcgttgtgcctgaagtcgcaatgggctcccg
A0A3P9Q4I8_MCL1-02      cactacga---ccaggggctcgttgtgcctgaagtcgcaatgggctcccg
A0A3B3VM25_MCL1-01      cactacga---ccaggggctcgttgtgcctgaagtcgcaatgggagccac
A0A087X830_MCL1-01      cactacga---ccaggggctcgttgtgcctgaagtcgcaatgggagccac
A0A3B3YCD0_MCL1-01      cactacga---ccaggggctcgttgtgcctgaagtcgcaatgggagccac
A0A3Q3VP02_MCL1-01      cg---------------------ttcctcgcaaatcgggatgggctcctg
G3PJT0_MCL1-01          ---------------------cccatgcgacagctcgcaatgggctcggc
A0A2U9CJ81_MCL1-01      cactacgg---ctcaggaaattccttgccgcagatcgccgtgggctccgt
A0A3Q3B4P5_MCL1-01      -----------acacagagacacctctccccaggtctccattggcgcctc
A0A3Q3B4P5_MCL1-02      -----------acacagagacacctctccccaggtctccattggcgcctc
A0A3Q3IZW0_MCL1-01      cactgcgg---ctc---aaatacctcaccacagtttgccgtaggatcttc
A0A3Q3GP42_MCL1-01      cactacgg---cccggaagcgtcctctccacaaatagcgatgggatcctc
A0A3Q1GX28_MCL1-02      ---tacag---ctcgggagtcaactcgccacagatcaccatgagctcctc
A0A3Q1GX28_MCL1-01      ---tacag---ctcgggagtcaactcgccacagatcaccatgagctcctc
A0A3Q3M6G2_MCL1-01      cactacga---ctccagagatccctccacacagtttacc-----------
A0A3Q3M6G2_MCL1-02      cactacga---ctccagagatccctccacacagtttacc-----------
A0A3B4T8L9_MCL1-01      --cgacgg---ctccggagactcctcgccggagattgccattggctctac
A0A3B4T8L9_MCL1-02      --cgacgg---ctccggagactcctcgccggagattgccattggctctac
A0A3B4XKA5_MCL1-01      --ggacag---ctccggagactcctcgccggagattgccattggctctac
A0A3Q0R633_MCL1-01      -------------------------------------------ttacatc
A0A3Q0R633_MCL1-03      cactatgg---atcggggaattcctctccgcaagatgccacaggtacacc
I3KXG5_MCL1-01          ctttatagataattgggaaa---ccctctgtaggaaacc---tggtcttg
I3JHR5_MCL1-03          cactatgg---atcggggaaatcctctccgcagaatgccacaggctcctc
I3JHR5_MCL1-02          cactatgg---atcggggaaatcctctccgcagaatgccacaggctcctc
I3JHR5_MCL1-01          cactatgg---atcggggaaatcctctccgcagaatgccacaggctcctc
A0A3Q4HLQ8_MCL1-01      cactatgg---atcgggaaattcctcaccgcagaacgccacaggctcctc
A0A3P9BVM3_MCL1-01      cactacgg---atctggaaattcctctccgcagaacgccacaggctcctc
A0A3P8NP63_MCL1-02      cactacgg---atcgggaaattcctctccgcagaacgccacaggctcctc
A0A3P8NP63_MCL1-01      cactacgg---atcgggaaattcctctccgcagaacgccacaggctcctc
A0A3Q2VNL8_MCL1-01      cactacgg---atcgggaaattcctctccgcagaacgccacaggctcctc
A0A3B4G4Z6_MCL1-01      cactacgg---atcgggaaattcctctccgcagaacgccacaggctcctc
A0A3B4ZKP6_MCL1-01      cactacgg---atcaggagatccctccgcacagatccccatggcctcccc
A0A3Q1EQB9_MCL1-01      cactatgg---atccggagattcctccccgcagatttccgtggcctcctc
A0A3Q1EQB9_MCL1-02      cactatgg---atccggagattcctccccgcagatttccgtggcctcctc
A0A3P8RQX7_MCL1-02      cactatgg---atccggagattcctccccgcagattgccgtggcctcctc
A0A3P8RQX7_MCL1-01      cactatgg---atccggagattcctccccgcagattgccgtggcctcctc
A0A3Q1BKL8_MCL1-01      cactatgg---atccggagattcctccccgcagattgccgtggcctcctc
A0A3Q1BKL8_MCL1-02      cactatgg---atccggagattcctccccgcagattgccgtggcctcctc
A0A3Q2EDX8_MCL1-01      cactacag---cccggagattgcagcaccagaaataccaatgaactcccc
A0A3Q2P7X9_MCL1-02      cactacag---gccggggcttcaactgcccgaggttgaaatgagctcctc
A0A3Q2P7X9_MCL1-01      cactacag---gccggggcttcaactgcccgaggttgaaatgagctcctc
                                                                          

A0A3B3SG34_MCL1-01      aagagccgcaaacacaccctgtctggagtcctccgggttatgggacgacg
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          -------------------------------------gattacaaag---
A2BF68_MCL1-01          -------------------------------------gattacaaag---
Q568W5_MCL1-01          -------------------------------------gattacaaag---
A0A3B1K5R1_MCL1-01      -------------------------------------gtataacaag---
A0A3B4C6H5_MCL1-01      -------------------------------------gtgtgggaa----
A0A3B4C6H5_MCL1-03      -------------------------------------tgataagaagact
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      agctttgtat----------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          agt-----------------------------------------------
A0A3P8Y1W8_MCL1-02      aat-----------------------------------------------
A0A3P8Y1W8_MCL1-01      aat-----------------------------------------------
A0A3B3CEX1_MCL1-01      cac-----------------------------------------------
A0A3B3CEX1_MCL1-02      cac-----------------------------------------------
A0A3P9ILF6_MCL1-01      att-----------------------------------------------
A0A3P9ILF6_MCL1-02      att-----------------------------------------------
A0A3B3IJ04_MCL1-01      att-----------------------------------------------
A0A3B3IJ04_MCL1-02      att-----------------------------------------------
A0A3P9L1F3_MCL1-02      att-----------------------------------------------
A0A3P9L1F3_MCL1-01      att-----------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      gccgccacagcttcatc---------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      tat-----------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      gtc-----------------------------------------------
A0A3P8VKM5_MCL1-05      gtc-----------------------------------------------
A0A3P8VKM5_MCL1-04      gtc-----------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ----------------agaacccagcagcgggattttttccagaccagca
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ----------------gcggcccgccgggcg------ccgccggactcca
A0A1L1RNM6_MCL1-02      ----------------gcggcccgccgggcg------ccgccggactcca
H9GEA6_MCL1-02          ttggctg-------------------------cgacgctgagggagaagg
H9GEA6_MCL1-01          ttggctg-------------------------cgacgctgagggagaagg
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          gaggcccatgctctttgcatccatcccctgcacgtcgccgcctgaggagg
G3WBC5_MCL1-01          gagaccgttctttttcgcgccgggcggccgctgctcgccccccgccgagg
F6ZMX1_MCL1-03          gatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgagg
F6ZMX1_MCL1-01          gatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgagg
F6ZMX1_MCL1-02          gatgccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgagg
H0XHA5_MCL1-01          -------------------------------------ctaccagaccaga
G1QAV8_MCL1-01          caggtggctgttct---cgcccatcagccg---gaattgccctgaagagc
G1PZ39_MCL1-01          -gcgcggcggctgtttgcgccccttggctgtgcggggctgcccgcggaga
P97287_MCL1-01          aaggcggctgcataagtcgcccggcctcctcgccgtgccgcccgaggaga
Q9Z1P3_MCL1-01          gaggcggctgctcaagtcgcccggcctcctcgccgtgccgcctgaggaga
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      gaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaaga
A0A287DCH9_MCL1-01      gaggcgactctttttcgcgcccacctactgcgtgtcgccgcctgagaaga
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          gaggctgctgtacttggcgcccacccgccgcgcgtcgccgctcgaggaga
G3T756_MCL1-01          gaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtggaga
A0A1S3F3I1_MCL1-01      taagcgggtgttcttcgcgcccacccaccgtgcgccgacgccggacgaga
A0A2K6GI15_MCL1-01      gaggctgctgttcttcgcgcccacccgccgcgcattgccgtccgaggaga
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          caggctgctgttcttcgcgcccacccgctgcgcgtcgccgcctgagggga
A0A337S3J9_MCL1-01      gaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaaaga
Q7YRZ9_MCL1-01          gaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaagaga
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      gaagctgctgttcttcgcggccacccgctgtgcgtcgccgcctgaaaaga
Q8HYS5_MCL1-01          gaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaagaga
F1PAP1_MCL1-01          gaggctgctgctgctcgcgcccccctgccgcgcgtcgccgcctgaagaga
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          gaggctgctgttcttcgagcctacccaccgcgcgtcgccgcctgaagaga
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagaga
A0A287BK44_MCL1-01      cagactgctgttcttcgcgcccacccgcctcgcgtcgccgcctgaagaga
A0A452RHX5_MCL1-01      gaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaagaga
G1L3L7_MCL1-02          gaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaagaga
G1L3L7_MCL1-01          gaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaagaga
W5QI41_MCL1-01          -----------------cggttaggtgccgtgcgcaaccgcc--------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          cagactgctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagaga
A0A452GA25_MCL1-02      cagactgctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagaga
A0A452GA25_MCL1-01      cagactgctgttcttcgcgcccacacgcctcgcgtcgccgcctgaagaga
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      -------tggttcttcgcgcccacccgccgcgcggcgccgcttgaggaga
H0XFB7_MCL1-01          gaggctgctgttcttcgcgcccaccctccgtgcggcgccgcgggaggaga
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      gaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggaga
H2N5Y9_MCL1-01          gaggctgtttttcttcgcgcccacccgccgcgcggcgccgcttgaggaga
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      gaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      gaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      gaggctgcttttcttcgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      gaggctgcttttcttcgctcccacccgccgcgcggcgccgcttgaggaga
A0A2I3GJZ3_MCL1-02      gaggctgcttttcttcgctcccacccgccgcgcggcgccgcttgaggaga
A0A2K6KRW9_MCL1-02      gaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgaggaga
A0A2K6PPI3_MCL1-02      gaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgaggaga
A0A2K6KRW9_MCL1-01      gaggctgcttttctttgcgcccacccgccgcgcggcgcctcttgaggaga
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      gaggccgcttttctttgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K5W0W9_MCL1-01      gaggctgcttttctttgcgcccacccgccgcgcggggccgcttgaggaga
A0A2K6ECR0_MCL1-02      gaggctgcttttctttgcgcccacccgccgcgcggggccgcttgaggaga
I7G687_MCL1-01          gaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K5LXU8_MCL1-01      gaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      gaggctgcttttctttgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      gaggctgtttttctttgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      gaggctgctgttcttcgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K6V5Y3_MCL1-01      gaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggaggaga
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          gaggctgctgttcttcgcgcccacccgccgcgcggcgccgctggaggaga
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      gaggctgctgttcttcgcgcccacccgccgcgcggcgccgcttgaggaga
A0A2K5CFH3_MCL1-03      gaggctgctgttcttcgcgcccacccgccgcgcggcgccgcttgaggaga
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          cag-----------------------------------------------
A0A3B5PQ55_MCL1-01      tgt-----------------------------------------------
A0A3B5PQ55_MCL1-02      tgt-----------------------------------------------
A0A3P9Q4I8_MCL1-01      tgt-----------------------------------------------
A0A3P9Q4I8_MCL1-02      tgt-----------------------------------------------
A0A3B3VM25_MCL1-01      tgt-----------------------------------------------
A0A087X830_MCL1-01      tgt-----------------------------------------------
A0A3B3YCD0_MCL1-01      tgt-----------------------------------------------
A0A3Q3VP02_MCL1-01      tct-----------------------------------------------
G3PJT0_MCL1-01          gaa-----------------------------------------------
A0A2U9CJ81_MCL1-01      gat-----------------------------------------------
A0A3Q3B4P5_MCL1-01      gct-----------------------------------------------
A0A3Q3B4P5_MCL1-02      gct-----------------------------------------------
A0A3Q3IZW0_MCL1-01      aat-----------------------------------------------
A0A3Q3GP42_MCL1-01      ttt-----------------------------------------------
A0A3Q1GX28_MCL1-02      gat-----------------------------------------------
A0A3Q1GX28_MCL1-01      gat-----------------------------------------------
A0A3Q3M6G2_MCL1-01      -tt-----------------------------------------------
A0A3Q3M6G2_MCL1-02      -tt-----------------------------------------------
A0A3B4T8L9_MCL1-01      aat-----------------------------------------------
A0A3B4T8L9_MCL1-02      aat-----------------------------------------------
A0A3B4XKA5_MCL1-01      att-----------------------------------------------
A0A3Q0R633_MCL1-01      ccc-----------------------------------------------
A0A3Q0R633_MCL1-03      taa-----------------------------------------------
I3KXG5_MCL1-01          tta-----------------------------------------------
I3JHR5_MCL1-03          taa-----------------------------------------------
I3JHR5_MCL1-02          taa-----------------------------------------------
I3JHR5_MCL1-01          taa-----------------------------------------------
A0A3Q4HLQ8_MCL1-01      taa-----------------------------------------------
A0A3P9BVM3_MCL1-01      taa-----------------------------------------------
A0A3P8NP63_MCL1-02      taa-----------------------------------------------
A0A3P8NP63_MCL1-01      taa-----------------------------------------------
A0A3Q2VNL8_MCL1-01      taa-----------------------------------------------
A0A3B4G4Z6_MCL1-01      taa-----------------------------------------------
A0A3B4ZKP6_MCL1-01      ttt-----------------------------------------------
A0A3Q1EQB9_MCL1-01      tat-----------------------------------------------
A0A3Q1EQB9_MCL1-02      tat-----------------------------------------------
A0A3P8RQX7_MCL1-02      cat-----------------------------------------------
A0A3P8RQX7_MCL1-01      cat-----------------------------------------------
A0A3Q1BKL8_MCL1-01      cat-----------------------------------------------
A0A3Q1BKL8_MCL1-02      cat-----------------------------------------------
A0A3Q2EDX8_MCL1-01      aat-----------------------------------------------
A0A3Q2P7X9_MCL1-02      atc-----------------------------------------------
A0A3Q2P7X9_MCL1-01      atc-----------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      agctggacaactgtacggacgaggtggac-----gtgtgtccctgctcga
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------caaaccact-----ggttattccag---aa
A2BF68_MCL1-01          --------------------caaaccact-----ggttattccag---aa
Q568W5_MCL1-01          --------------------caaaccact-----ggttattccag---aa
A0A3B1K5R1_MCL1-01      --------------------aagacggcc-gacattgttccccgg---gt
A0A3B4C6H5_MCL1-01      -----------ttttctag-gaaatggccatggaattttctttgg---ga
A0A3B4C6H5_MCL1-03      gtttttccttctttgctggcgaagcgacc-----ttttactctgg---gt
B6V6J0_MCL1-01          ----agacattgagcgcgcgtggggcttctccgtgggaccccgat-----
Q568V1_MCL1-01          ----agacgaactggacgggtacattgaggaggaggaggcgcctc----t
Q1L8X3_MCL1-01          ----agacgaactggacggatacattgaggaggaggaggcgcctc----t
Q9I9N3_MCL1-01          ----agacgaactggacggatacactgaggaggaggaggcgcctc----t
J7H260_MCL1-01          ----------------------------------tgccctccccgcagtc
A0A3B3R4U0_MCL1-01      ----cggcgtctctgcccgtagccccgctcaaagcgaaaagcgaa---ga
A0A3Q2Y539_MCL1-01      -------------------------------taatgttgcctcca-----
Q0KFR9_MCL1-01          ----ggac------ttgggaaatgggactggcgatactccaccac-----
A0A3P8Y1W8_MCL1-02      ----ggacgttgatttaggaaatgggactgctgatactcctgtcc-----
A0A3P8Y1W8_MCL1-01      ----ggacgttgatttaggaaatgggactgctgatactcctgtcc-----
A0A3B3CEX1_MCL1-01      ----ggcctcgcgcggcgctaatcccgacccgtccgaacagatga-----
A0A3B3CEX1_MCL1-02      ----ggcctcgcgcggcgctaatcccgacccgtccgaacagatga-----
A0A3P9ILF6_MCL1-01      ----ggcctctcgcgtggcaaatcccgacccgtccgatcagttca-----
A0A3P9ILF6_MCL1-02      ----ggcctctcgcgtggcaaatcccgacccgtccgatcagttca-----
A0A3B3IJ04_MCL1-01      ----agcctctcacgtggcaaaccccgacccgtccgatcagctca-----
A0A3B3IJ04_MCL1-02      ----agcctctcacgtggcaaaccccgacccgtccgatcagctca-----
A0A3P9L1F3_MCL1-02      ----agcctctcgcgtggcaaaccccgacccgtccgatcagctca-----
A0A3P9L1F3_MCL1-01      ----agcctctcgcgtggcaaaccccgacccgtccgatcagctca-----
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      ----gggccgtggcgaccttgggcgcc--------gttaactgcaacagc
A0A3B4AFB7_MCL1-01      ----------------------------------cacagcccacatttgc
A0A3B4AFB7_MCL1-02      ----ggacactcgtaaaggga------------atacggcctcca---gc
A0A3B1IEV7_MCL1-01      ----ggagaagctgccccg------------gacgga-------------
A0A3B4CGU9_MCL1-03      ----gagccagctggaccg------------cccgga-------------
A0A3B4CGU9_MCL1-02      ----ggtccagtcacactgatatacctcatacacggaggtcaggg---ag
W5MMB7_MCL1-01          ----ggactacg----------------------------ccgag---ga
A0A3P8VKM5_MCL1-03      ----aacccacaacgactcaatgagttctgtcaccgaaacccaaa---gg
A0A3P8VKM5_MCL1-05      ----aacccacaacgactcaatgagttctgtcaccgaaacccaaa---gg
A0A3P8VKM5_MCL1-04      ----aacccacaacgactcaatgagttctgtcaccgaaacccaaa---gg
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      cgtaccaaccctttgggatcagctcca------cggggacggggg---gg
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgtcgcggcccgtc-------gctctg------tggagccccgag---ga
A0A1L1RNM6_MCL1-02      cgtcgcggcccgtc-------gctctg------tggagccccgag---ga
H9GEA6_MCL1-02          agagcaaccaaaatggcgcccggcctccctg--ccgctgcctgaa---gg
H9GEA6_MCL1-01          agagcaaccaaaatggcgcccggcctccctg--ccgctgcctgaa---gg
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          cga-atgcctcagttgcggaggccatc------atgtcagctgaa---ga
G3WBC5_MCL1-01          tgg-ccgatggagccgcggacgccatc------ctatcccccgag---ga
F6ZMX1_MCL1-03          tgg-ccgatggggctgcggacgtccca------atgtgccctgag---ga
F6ZMX1_MCL1-01          tgg-ccgatggggctgcggacgtccca------atgtgccctgag---ga
F6ZMX1_MCL1-02          tgg-ccgatggggctgcggacgtccca------atgtgccctgag---ga
H0XHA5_MCL1-01          tgg-aagcccaagttgccgatgccgtc------aagtcgcccgaa---gg
G1QAV8_MCL1-01          tgg-gagctctggcagccgacgccatc------atgtcgcccgga---ga
G1PZ39_MCL1-01          tggaaagccgcggccgccgacgccatc------atgtcgccggaa---ga
P97287_MCL1-01          tgg-ccgcgtcggccgccgccgccatc------gtgtctccggag---ga
Q9Z1P3_MCL1-01          tgg-ccgcgtcg---gccgccgccatc------atgtctcccgag---ga
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ---------------------------------atgtcgcctgag---ga
A0A287DCH9_MCL1-02      tgg-aagcccccgccgccgcc------------atgtcgcccgaa---ga
A0A287DCH9_MCL1-01      tgg-aagcccccgccgccgcc------------atgtcgcccgaa---ga
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          tgg-aagccccggctgcggacgccatc------atgtcgcccgaa---ga
G3T756_MCL1-01          tgg-aggctctagccgccgacgccatc------atgtcgcccgaa---ga
A0A1S3F3I1_MCL1-01      tgg-aagccgcggccgccggcgccatc------atgtcgcccgaa---ga
A0A2K6GI15_MCL1-01      tgg-aagcccctgccgccgacgccatc------atgtcgcccgaa---ga
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          tgg-aagccccggccgccgacgccatc------atgtcgcccgag---ga
A0A337S3J9_MCL1-01      tgg-aaggcccagccgccgacgccatc------atgtcgcccgaa---ga
Q7YRZ9_MCL1-01          tgg-aaggcccagccgccgacgccatc------atgtcgcccgaa---ga
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      tgg-aaggcccagccgccgacgccatc------atgtcgcccgaa---ga
Q8HYS5_MCL1-01          tgg-aaggcccggccgccgacgccatc------atgtcgcccgaa---ga
F1PAP1_MCL1-01          tgg-aaggcccggccgccgacgccatc------atgtcgcccgaa---ga
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          tgg-aaggcccagctgccgacgccatc------atgtcgcccgaa---ga
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      tgg-aatccccggcctccgacgccatc------atgtctcccgaa---ga
A0A287BK44_MCL1-01      tgg-aatccccggcctccgacgccatc------atgtctcccgaa---ga
A0A452RHX5_MCL1-01      tgg-aaggcccagccgccgacgccatc------atgtcgcccgaa---ga
G1L3L7_MCL1-02          tgg-aaggcccagccgccgacgccatc------atgtcgcccgaa---ga
G1L3L7_MCL1-01          tgg-aaggcccagccgccgacgccatc------atgtcgcccgaa---ga
W5QI41_MCL1-01          -gg-aagctttcgctgccttccccatttacgggatgcagataaag---ag
F1MQX4_MCL1-01          -gg-aat-----------gttgccaat------attt-------------
A5PJR2_MCL1-01          tgg-aatccccgatctccgacgccatc------atgtcgcccgaa---ga
A0A452GA25_MCL1-02      tgg-aatccccgatctccgacgccatc------atgtcgcccgaa---ga
A0A452GA25_MCL1-01      tgg-aatccccgatctccgacgccatc------atgtcgcccgaa---ga
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
H0XFB7_MCL1-01          tgg-aagcccctgccgccgacgccatc------atgtcgccggaa---ga
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
H2N5Y9_MCL1-01          tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          ---------------gctgacgccatc------atgtcgcccgaa---ga
B4DG83_MCL1-01          ---------------gctgacgccatc------atgtcgcccgaa---ga
B4DU51_MCL1-01          ---------------gctgacgccatc------atgtcgcccgaa---ga
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2I3GJZ3_MCL1-02      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K6KRW9_MCL1-02      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K6PPI3_MCL1-02      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K6KRW9_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      tgg-aagccccggctgccgacgccatc------atgtcgcccgaa---ga
A0A2K5W0W9_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K6ECR0_MCL1-02      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
I7G687_MCL1-01          tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K5LXU8_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      tgg-aagccccggccgccgacgccatc------atgtctcccgaa---ga
A0A2K6V5Y3_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcccgaa---ga
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          tgg-aagccccggccgccgacgccatc------atgtcgccggaa---ga
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      tgg-aagccccggccgccgacgccatc------atgtcgcctgaa---ga
A0A2K5CFH3_MCL1-03      tgg-aagccccggccgccgacgccatc------atgtcgcctgaa---ga
D2ITA0_MCL1-03          ------accacgacagagggggccttgcctctaatggcgacgttc----a
D2ITA0_MCL1-04          ------accacgacagagggggccttgcctctaatggcgacgttc----a
A0A3P8V8T6_MCL1-01      ---------------------------------atggtgctcata-----
Q4SW32_MCL1-01          ----ggacgctttcaacgggaacgtcg------gcgacagcccga-----
A0A3B5PQ55_MCL1-01      ----agaatctcttca---------ttcgcctaaggatcccttca----t
A0A3B5PQ55_MCL1-02      ----agaatctcttca---------ttcgcctaaggatcccttca----t
A0A3P9Q4I8_MCL1-01      ----agaatctcttca---------ttcgcctatggatcccttca----a
A0A3P9Q4I8_MCL1-02      ----agaatctcttca---------ttcgcctatggatcccttca----a
A0A3B3VM25_MCL1-01      ----agattctcttca---------ttcgcctaaggatccctaca----a
A0A087X830_MCL1-01      ----agattctcttca---------ttcgcctaaggatccctaca----a
A0A3B3YCD0_MCL1-01      ----agattctcttca---------ttcgcctaaggatccctaca----a
A0A3Q3VP02_MCL1-01      ----agactctcacaacggtaatgtcgctttaaacgatacctcca-----
G3PJT0_MCL1-01          ----ggactcccacaacggcaacgcggggacaaacgacaccccga-----
A0A2U9CJ81_MCL1-01      ----cgactcccgcggcgggaacgtcggcgccggggacgccccga-----
A0A3Q3B4P5_MCL1-01      ----aggctccgagaacggcagcgtggcgtcgtgcaattcctcca-----
A0A3Q3B4P5_MCL1-02      ----aggctccgagaacggcagcgtggcgtcgtgcaattcctcca-----
A0A3Q3IZW0_MCL1-01      ----agactcttgtaaaggcaatgttgggcccaataatactctga-----
A0A3Q3GP42_MCL1-01      ----agcctcacaaaatgggaatgtcgggtcgaatgaaaccacca-----
A0A3Q1GX28_MCL1-02      ----agacgcttgcaacggga------------atgctgctctga-----
A0A3Q1GX28_MCL1-01      ----agacgcttgcaacggga------------atgctgctctga-----
A0A3Q3M6G2_MCL1-01      ----ggactctcgcaacgggaacggcgggacg---gctaatccga-----
A0A3Q3M6G2_MCL1-02      ----ggactctcgcaacgggaacggcgggacg---gctaatccga-----
A0A3B4T8L9_MCL1-01      ----atgttctcacaacgggaatgttgtgccaaatgataattcta-----
A0A3B4T8L9_MCL1-02      ----atgttctcacaacgggaatgttgtgccaaatgataattcta-----
A0A3B4XKA5_MCL1-01      ----atgttgtgacaacgggaatgttgtgccaaatgataattcta-----
A0A3Q0R633_MCL1-01      ----agac---------------------tccaatggtaccccaa-----
A0A3Q0R633_MCL1-03      ----agac---------------------tccaatggtaccccaa-----
I3KXG5_MCL1-01          ----gga----------gaga---cggcatcc------atcccac-----
I3JHR5_MCL1-03          ----agactctagcaacggga---ttgtgtctaatggtaccccca-----
I3JHR5_MCL1-02          ----agactctagcaacggga---ttgtgtctaatggtaccccca-----
I3JHR5_MCL1-01          ----agactctagcaacggga---ttgtgtctaatggtaccccca-----
A0A3Q4HLQ8_MCL1-01      ----agactctagcaacggga---ttgtgtccaatggtaccccca-----
A0A3P9BVM3_MCL1-01      ----agactctagcaatggga---ttgtgtccaatggtaccccca-----
A0A3P8NP63_MCL1-02      ----agactctagcaatggga---ttgtgtccaatggtaccccca-----
A0A3P8NP63_MCL1-01      ----agactctagcaatggga---ttgtgtccaatggtaccccca-----
A0A3Q2VNL8_MCL1-01      ----agactctagcaacggga---ttgtgtccaatggtaccccca-----
A0A3B4G4Z6_MCL1-01      ----agactctagcaacggga---ttgtgtccaatggtaccccca-----
A0A3B4ZKP6_MCL1-01      ----ggactcacacaacgggaatgtcggctccggcgccaccccga-----
A0A3Q1EQB9_MCL1-01      ----agatcctcaaaacgggaatcttggctccagtgataccccaa-----
A0A3Q1EQB9_MCL1-02      ----agatcctcaaaacgggaatcttggctccagtgataccccaa-----
A0A3P8RQX7_MCL1-02      ----agactctcacaacgggaatgttggctccagtgaaaccccaa-----
A0A3P8RQX7_MCL1-01      ----agactctcacaacgggaatgttggctccagtgaaaccccaa-----
A0A3Q1BKL8_MCL1-01      ----agactctcacaacgggaatgttggctccaatgaaaccccaa-----
A0A3Q1BKL8_MCL1-02      ----agactctcacaacgggaatgttggctccaatgaaaccccaa-----
A0A3Q2EDX8_MCL1-01      ----gggatctcttcaccgaaactta---------------atga-----
A0A3Q2P7X9_MCL1-02      ----ggaagatctccgctgggactgt---------------tcga-----
A0A3Q2P7X9_MCL1-01      ----ggaagatctccgctgggactgt---------------tcga-----
                                                                          

A0A3B3SG34_MCL1-01      caagactcgccaaaagggattctgaaaaagagc-----------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ctgaaagcgcataaccagt-------------------------------
A2BF68_MCL1-01          ctgaaagcgcataaccagt-------------------------------
Q568W5_MCL1-01          ctgaaagcgcataaccagt-------------------------------
A0A3B1K5R1_MCL1-01      cgctgttcgcggaggagggggaggagcggggct-----------------
A0A3B4C6H5_MCL1-01      a---------aaact-----------------------------------
A0A3B4C6H5_MCL1-03      atatcctctcaaacccggg-------------------------------
B6V6J0_MCL1-01          --atggacacgcacaggccgcagctgaatggcttgggctttaacaa----
Q568V1_MCL1-01          gaagcggcttagacctg----gtacaaacggcctgaaggggctgcagctg
Q1L8X3_MCL1-01          gaagcggcttagaccgg----gtacaaacggcctgaaggggctgcagctg
Q9I9N3_MCL1-01          gaagcggcttagaccgg----gtacaaacggcctgaaggggctgcagctg
J7H260_MCL1-01          cgagctggacgaggacg-------aggattacatggacgtacagtcggac
A0A3B3R4U0_MCL1-01      ggagctggacagtctggatgaaggcgaacgttttcatggagcgccgaaaa
A0A3Q2Y539_MCL1-01      -aaggctgtcgttcaag----gatccatggcctcgcagctgcaggaggtg
Q0KFR9_MCL1-01          ---------------------gacccacgacgttaggagtgaatgtcgt-
A0A3P8Y1W8_MCL1-02      ---------------------gacctacgaagttagaagtaaatatgac-
A0A3P8Y1W8_MCL1-01      ---------------------gacctacgaagttagaagtaaatatgac-
A0A3B3CEX1_MCL1-01      --------------aaa----gaccgcaggacctcgacatgttagggaat
A0A3B3CEX1_MCL1-02      --------------aaa----gaccgcaggacctcgacatgttagggaat
A0A3P9ILF6_MCL1-01      --------------aaa----gaccgcaggacctcga-------------
A0A3P9ILF6_MCL1-02      --------------aaa----gaccgcaggacctcga-------------
A0A3B3IJ04_MCL1-01      --------------aaa----gaccgcaggacctcga-------------
A0A3B3IJ04_MCL1-02      --------------aaa----gaccgcaggacctcga-------------
A0A3P9L1F3_MCL1-02      --------------aaa----gaccgcaggacctcga-------------
A0A3P9L1F3_MCL1-01      --------------aaa----gaccgcaggacctcga-------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      ggggccgccaagccccg----a-cctagcgccttggaaattctctgcaag
A0A3B4AFB7_MCL1-01      ggctctcctcatccacg----acccacagctcttgtaa-------tgaaa
A0A3B4AFB7_MCL1-02      ggctctcctcatccacg----acccacagctcttgtaa-------tgaaa
A0A3B1IEV7_MCL1-01      ---gcggccggaacgcg----gcctgga-ggggctgcagtccgct-----
A0A3B4CGU9_MCL1-03      ---ccggcccgaccgcg----gcctgga-gggactacaggcagcgcccgg
A0A3B4CGU9_MCL1-02      gttccagttccagctca----gctcagacgggttctcctgctgctcctga
W5MMB7_MCL1-01          cgaactggacaactact----cggcggagcccgtggcgaccagcgcc-tg
A0A3P8VKM5_MCL1-03      cga--------------------cccaaggacctccaggttaacacggca
A0A3P8VKM5_MCL1-05      cga--------------------cccaaggacctccaggttaacacggca
A0A3P8VKM5_MCL1-04      cga--------------------cccaaggacctccaggttaacacggca
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      agatttgaccattttgg----gctggtttcacccaactcagaagcga---
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ggagttggacggctgcg----a--------gcccgagtccgaacgcg---
A0A1L1RNM6_MCL1-02      ggagttggacggctgcg----a--------gcccgagtccgaacgcg---
H9GEA6_MCL1-02          ggagctcgacggctgcg----ag--gaagccgaggaggaggaggccgcga
H9GEA6_MCL1-01          ggagctcgacggctgcg----ag--gaagccgaggaggaggaggccgcga
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          ggagctgggcaggtaca----agctggagacgctggggaagcggcca---
G3WBC5_MCL1-01          cgagctggacggttacg----agcccgagctccccgggaagcggccc---
F6ZMX1_MCL1-03          ggaactggacggttacg----agcccgagcctcccgggaagcggccc---
F6ZMX1_MCL1-01          ggaactggacggttacg----agcccgagcctcccgggaagcggccc---
F6ZMX1_MCL1-02          ggaactggacggttacg----agcccgagcctcccgggaagcggccc---
H0XHA5_MCL1-01          tgaggtggcctcgtgcg----agccggagcctctcaagaagcaaccg---
G1QAV8_MCL1-01          ggagctgggcaggtatg----agccggagcc------gaagcagccg---
G1PZ39_MCL1-01          ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
P97287_MCL1-01          ggaactggacggctgcg----agccggaggccatcggcaagcgcccg---
Q9Z1P3_MCL1-01          ggagctggacggctgtg----agccggaggtgctcagcaaacgcccg---
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ggagctggacgggtacg----agccggagcccctcgggaagcggccg---
A0A287DCH9_MCL1-02      ggagctggacggctacg----agcccgagcccctcgggaagcggccg---
A0A287DCH9_MCL1-01      ggagctggacggctacg----agcccgagcccctcgggaagcggccg---
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          ggagctggacggctacg----agccggagccccttgcgaagcggccg---
G3T756_MCL1-01          ggagctggacgggtacg----agccggagccgctcgggaagcggccg---
A0A1S3F3I1_MCL1-01      ggagctggacggctacg----aacccgagcccctggggaagaggccg---
A0A2K6GI15_MCL1-01      tgagctggacgggtacg----agccggagcctctcgggaagcggccg---
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A337S3J9_MCL1-01      ggagctagacgggtacg----agccagaacctctggggaagcggccg---
Q7YRZ9_MCL1-01          ggagctagacgggtacg----agccagaacctctggggaagcggccg---
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ggagctagacgggtacg----agccagaacctctggggaagcggccg---
Q8HYS5_MCL1-01          ggagctagacgggtacg----agccggaacctttggggaagcggccg---
F1PAP1_MCL1-01          ggagctagacgggtacg----agccggaacctttggggaagcggccg---
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          ggagctggatgggtacg----agccggaacctttggggaagaggcct---
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ggagctggacgggtacg----agccggagcccctcgggaagcggccg---
A0A287BK44_MCL1-01      ggagctggacgggtacg----agccggagcccctcgggaagcggccg---
A0A452RHX5_MCL1-01      ggagctggacgggtacg----agccggaacctttggggaagcggccg---
G1L3L7_MCL1-02          ggagctggacgggtacg----agccggaacctttggggaagcggccg---
G1L3L7_MCL1-01          ggagctggacgggtacg----agccggaacctttggggaagcggccg---
W5QI41_MCL1-01          gcagcagcagtggttca----agatgtttggcttcaagaggcgccct---
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          ggagctggacgggtgcg----agccagaccctctcgggaagcggcct---
A0A452GA25_MCL1-02      ggagctggacgggtgcg----agccagaccctctcgggaagcggcct---
A0A452GA25_MCL1-01      ggagctggacgggtgcg----agccagaccctctcgggaagcggcct---
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      agagctggacaggtacg----agccggagcctctcgggaagcggccg---
H0XFB7_MCL1-01          tgagctggacgggtacg----agccggagcctttggggaagcggccg---
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
H2N5Y9_MCL1-01          ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
B4DG83_MCL1-01          ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
B4DU51_MCL1-01          ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2I3GJZ3_MCL1-02      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K6KRW9_MCL1-02      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K6PPI3_MCL1-02      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K6KRW9_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K5W0W9_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K6ECR0_MCL1-02      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
I7G687_MCL1-01          ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K5LXU8_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ggagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      agagctggacgggtacg----agccagagcctctcgggaagcggccg---
A0A2K6V5Y3_MCL1-01      cgagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          agagctggacgggtacg----agccggagcctctcgggaagcggccg---
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      agagctggacgggtacg----agccggagcctctcgggaagcggccg---
A0A2K5CFH3_MCL1-03      agagctggacgggtacg----agccggagcctctcgggaagcggccg---
D2ITA0_MCL1-03          aaagcggagacgaacgt----aaaccaagacccacggaa------ctagg
D2ITA0_MCL1-04          aaagcggagacgaacgt----aaaccaagacccacggaa------ctagg
A0A3P8V8T6_MCL1-01      --agcag----------------t--------------------------
Q4SW32_MCL1-01          --agcgg----------------cccagcaagctgacggtggtcaaaccc
A0A3B5PQ55_MCL1-01      gaaacgc----------------ccgacgaatctcggagt---------g
A0A3B5PQ55_MCL1-02      gaaacgc----------------ccgacgaatctcggagt---------g
A0A3P9Q4I8_MCL1-01      gaaacgc----------------ccgacgaatcttgcagtgactgcatcg
A0A3P9Q4I8_MCL1-02      gaaacgc----------------ccgacgaatcttgcagtgactgcatcg
A0A3B3VM25_MCL1-01      gcaacgc----------------ccgacgaatctcgcagtgaccgcatcg
A0A087X830_MCL1-01      gaaacgc----------------ccgacgaatctcgcagtgtccgcatcg
A0A3B3YCD0_MCL1-01      gcaacgc----------------ccgacgaatctcgcagtgaccgcatcg
A0A3Q3VP02_MCL1-01      --aacgg----------------cctaatttactagtagtgaacccaacg
G3PJT0_MCL1-01          --agcgg----------------cccagcgccctcggggtgaactccgcg
A0A2U9CJ81_MCL1-01      --agcgg----------------cccaagaacctccaggtctccgcaacg
A0A3Q3B4P5_MCL1-01      --aacga----------------ccgaaggacctggtgatgcctccgctg
A0A3Q3B4P5_MCL1-02      --aacga----------------ccgaaggacctggtgatgcctccgctg
A0A3Q3IZW0_MCL1-01      --aacgg----------------cccaagatcctggatgtcagctcaaca
A0A3Q3GP42_MCL1-01      --agcgg----------------cccaaggctctggttgttaactcggga
A0A3Q1GX28_MCL1-02      --aacga----------------cccaagaacctggacgtgagctcatcg
A0A3Q1GX28_MCL1-01      --aacga----------------cccaagaacctggacgtgagctcatcg
A0A3Q3M6G2_MCL1-01      --aaaga----------------cccaagaacctggaagtcagctccaca
A0A3Q3M6G2_MCL1-02      --aaaga----------------cccaagaacctggaagtcagctccaca
A0A3B4T8L9_MCL1-01      --aacgg----------------cccaagagcctggaagtcacctcaaca
A0A3B4T8L9_MCL1-02      --aacgg----------------cccaagagcctggaagtcacctcaaca
A0A3B4XKA5_MCL1-01      --aacgg----------------cccaagagcctggaagtcacctcaaca
A0A3Q0R633_MCL1-01      --aacgg----------------ccgaacaacctgggggtggtatcaaca
A0A3Q0R633_MCL1-03      --aacgg----------------ccgaacaacctgggggtggtatcaaca
I3KXG5_MCL1-01          --tttgg----------------atggagcagctc----tcatttcta--
I3JHR5_MCL1-03          --aacgg----------------ccgaacaacctcggggtaacctcaaca
I3JHR5_MCL1-02          --aacgg----------------ccgaacaacctcggggtaacctcaaca
I3JHR5_MCL1-01          --aacgg----------------ccgaacaacctcggggtaacctcaaca
A0A3Q4HLQ8_MCL1-01      --aacgg----------------ccggacaacctcgaggtaacctcaaca
A0A3P9BVM3_MCL1-01      --aacgg----------------ccggacaacctcgaggtaacctcaaca
A0A3P8NP63_MCL1-02      --aacgg----------------ccggacaacctcgaggtaacctcaaca
A0A3P8NP63_MCL1-01      --aacgg----------------ccggacaacctcgaggtaacctcaaca
A0A3Q2VNL8_MCL1-01      --aacgg----------------ccggacaacctcgaggtaacgtcaaca
A0A3B4G4Z6_MCL1-01      --aacgg----------------ccggacaacctcgaggtaacctcaaca
A0A3B4ZKP6_MCL1-01      --agagg----------------cccaagaacctgggagtgtccacgacg
A0A3Q1EQB9_MCL1-01      --aacgg----------------ccgaagaacctgggagt---------g
A0A3Q1EQB9_MCL1-02      --aacgg----------------ccgaagaacctgggagt---------g
A0A3P8RQX7_MCL1-02      --aacgg----------------ccgaagaacctgggagt---------g
A0A3P8RQX7_MCL1-01      --aacgg----------------ccgaagaacctgggagt---------g
A0A3Q1BKL8_MCL1-01      --aacgg----------------ccgaagaacctgggagt---------g
A0A3Q1BKL8_MCL1-02      --aacgg----------------ccgaagaacctgggagt---------g
A0A3Q2EDX8_MCL1-01      --aacgt----------------ccgaaggatctgcaag---tagcaacg
A0A3Q2P7X9_MCL1-02      --aacgg----------------ccgaagaacctgcgagtgatggcgagg
A0A3Q2P7X9_MCL1-01      --aacgg----------------ccgaagaacctgcgagtgatggcgagg
                                                                          

A0A3B3SG34_MCL1-01      -------------------------------cgtgtcggggaagccggtt
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ------------------------------------------ttgcggtg
A2BF68_MCL1-01          ------------------------------------------ttgcggtg
Q568W5_MCL1-01          ------------------------------------------ttgcggtg
A0A3B1K5R1_MCL1-01      -------------------------------ctcgctcggtctcgcggcc
A0A3B4C6H5_MCL1-01      ----------------------------------------gatcgcagct
A0A3B4C6H5_MCL1-03      ---------------------------------cgcccaggatcgcagct
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          gacggtcgatttgtttctacgac---------------------------
Q1L8X3_MCL1-01          gacggtcgatttgtttctgcgac---------------------------
Q9I9N3_MCL1-01          gacggtcgatttgtttctgcgac---------------------------
J7H260_MCL1-01          tcccggggctccac------------------------------------
A0A3B3R4U0_MCL1-01      caga---------------------------gaggcgtgattgcgaacac
A0A3Q2Y539_MCL1-01      gaacgtcgttctga------------------------------------
Q0KFR9_MCL1-01          -------------------------------gaaaagcaacggccttgat
A0A3P8Y1W8_MCL1-02      -------------------------------gaaacccaacgtattggat
A0A3P8Y1W8_MCL1-01      -------------------------------gaaacccaacgtattggat
A0A3B3CEX1_MCL1-01      aaatctc------------------------cgtatgcggcgaggaggtt
A0A3B3CEX1_MCL1-02      aaatctc------------------------cgtatgcggcgaggaggtt
A0A3P9ILF6_MCL1-01      --------------------------------gtattccgcgaggaggtt
A0A3P9ILF6_MCL1-02      --------------------------------gtattccgcgaggaggtt
A0A3B3IJ04_MCL1-01      --------------------------------gtattccgcgaggaggtt
A0A3B3IJ04_MCL1-02      --------------------------------gtattccgcgaggaggtt
A0A3P9L1F3_MCL1-02      --------------------------------gtactccgcgaggaggtt
A0A3P9L1F3_MCL1-01      --------------------------------gtactccgcgaggaggtt
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      ggcggactagccac-----------------catgaaccaccgcaacaac
A0A3B4AFB7_MCL1-01      aacgaacttttaaa-----------------taagaacacgcgagaaga-
A0A3B4AFB7_MCL1-02      aacgaacttttaaa-----------------taagaacacgcgagaaga-
A0A3B1IEV7_MCL1-01      ------------------------------------------aaaggag-
A0A3B4CGU9_MCL1-03      acccgct---------------------------------agcaagg---
A0A3B4CGU9_MCL1-02      actcactcacgtccaggtcaacagcattagcattagcagcaccaaggagc
W5MMB7_MCL1-01          gatccccaagtcgccgcggtcgctgcccgcggggctgaagctgggcggcc
A0A3P8VKM5_MCL1-03      aacggacatgccag-----------------aaagagccactgtgaggt-
A0A3P8VKM5_MCL1-05      aacggacatgccag-----------------aaagagccactgtgaggt-
A0A3P8VKM5_MCL1-04      aacggacatgccag-----------------aaagagccactgtgaggt-
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
H9GEA6_MCL1-02          cggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
H9GEA6_MCL1-01          cggtgccgtcttccaccccctcgccggacaaagagatggcggaggaggaa
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          ----gctgcccttcccctgct----------ggtgcttgtgggggaagcc
G3WBC5_MCL1-01          ----gctcgcctggccatgct----------gcccttggccagagagggt
F6ZMX1_MCL1-03          ----tcccgcctggctgtgct----------ggaaatagcccgggaaggt
F6ZMX1_MCL1-01          ----tcccgcctggctgtgct----------ggaaatagcccgggaaggt
F6ZMX1_MCL1-02          ----tcccgcctggctgtgct----------ggaaatagcccgggaaggt
H0XHA5_MCL1-01          ----gagggcctgcctttgct----------ggagtttgttggtgaggcc
G1QAV8_MCL1-01          ----gctgtcctgcccttgct----------ccagctggtcggggaggcc
G1PZ39_MCL1-01          ----gccgtcctgcccttggt----------gcagctggtcggggaggcc
P97287_MCL1-01          ----gccgtgctgcccctcct----------ggagcgcgtgagcgaggcg
Q9Z1P3_MCL1-01          ----gcggtgctgcccctact----------ggagcgcgtgagcgaggcg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ----gccgtgctgcccttgct----------ggggctggtgggggaggcc
A0A287DCH9_MCL1-02      ----gcggtcctgcccttgct----------ggagctcgttggagaggcc
A0A287DCH9_MCL1-01      ----gcggtcctgcccttgct----------ggagctcgttggagaggcc
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          ----gccgtcctgcccctgct----------ggacttggtgggggaggcc
G3T756_MCL1-01          ----gctgtttttccccggct----------ggggctggtcggggaggcc
A0A1S3F3I1_MCL1-01      ----gccgtcctgcccctgct----------ggagctggtcggggaagcc
A0A2K6GI15_MCL1-01      ----gctgtcctgcctttgct----------ggagttggtcggggaggcc
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ----gctgtcctgcccttgct----------ggagtttgtccgggaggcc
A0A337S3J9_MCL1-01      ----gctgtcctgcctttgct----------ggagttggtcggggaggcc
Q7YRZ9_MCL1-01          ----gctgtcctgcctttgct----------ggagttggtcggggaggcc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ----gctgtcctgcctttgct----------ggagttggtcggggaggcc
Q8HYS5_MCL1-01          ----gcggtcctgcctctgct----------ggagctggtgggggaggcc
F1PAP1_MCL1-01          ----gcggtcctgcctctgct----------ggagttggtgggggaggcc
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          ----gctgtcctgcctttgct----------ggagttggtgggggaggcc
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ----gccgtcctgcccttgct----------ggggttagtcgaggaggcc
A0A287BK44_MCL1-01      ----gccgtcctgcccttgct----------ggggttagtcgaggaggcc
A0A452RHX5_MCL1-01      ----gctgtcctgcctttgct----------ggagttggtcggggaggcc
G1L3L7_MCL1-02          ----gctgtcctgcctttgct----------ggagttggtcggggaggcc
G1L3L7_MCL1-01          ----gctgtcctgcctttgct----------ggagttggtcggggaggcc
W5QI41_MCL1-01          ----gccgtccggcctttacc----------tttgatggtcggagaagcc
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          ----gccgtccggcctttacc----------tttgttggtcggagaagcc
A0A452GA25_MCL1-02      ----gccgtccggcctttagc----------tttgatggtcggagaagcc
A0A452GA25_MCL1-01      ----gccgtccggcctttagc----------tttgatggtcggagaagcc
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtggaggagcct
H0XFB7_MCL1-01          ----gcggtcctgcctttgct----------ggagttggtcggggaggcc
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ----gctgtcctgcccctgct----------ggagttggtcggggaatc-
H2N5Y9_MCL1-01          ----gctgtcctgcctctgct----------ggagttggtcggggaatct
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          ----gctgtcctgccgctgct----------ggagttggtcggggaatct
B4DG83_MCL1-01          ----gctgtcctgccgctgct----------ggagttggtcggggaatct
B4DU51_MCL1-01          ----gctgtcctgccgctgct----------ggagttggtcggggaatct
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      ----gctgtcctgcctctgct----------ggagttggtcggggaatct
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      ----gctgtcctgcctctgct----------ggagttggtcggggaatct
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2I3GJZ3_MCL1-02      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K6KRW9_MCL1-02      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K6PPI3_MCL1-02      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K6KRW9_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K5W0W9_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K6ECR0_MCL1-02      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
I7G687_MCL1-01          ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K5LXU8_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggaatct
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      ----gctgtcctgcccctgct----------ggagttggtcggggagcct
A0A2K6V5Y3_MCL1-01      ----gctgtcctgcccctgct----------ggagctggtcggggagcct
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          ----gctgtcctgcctctgct----------ggagttggtcggggagcct
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      ----gctgtcctgcccctgct----------ggagttggtcggggagcct
A0A2K5CFH3_MCL1-03      ----gctgtcctgcccctgct----------ggagttggtcggggagcct
D2ITA0_MCL1-03          aaggggcaggctgg-----------------tgaacaaatcgca------
D2ITA0_MCL1-04          aaggggcaggctgg-----------------tgaacaaatcgca------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          aaggtctgcctgtc-----------------gaagaccattcaggagga-
A0A3B5PQ55_MCL1-01      aatggatatgttgc-----------------gaaaagccttccgacgag-
A0A3B5PQ55_MCL1-02      aatggatatgttgc-----------------gaaaagccttccgacgag-
A0A3P9Q4I8_MCL1-01      aatggatatgttgc-----------------aaaaagcctcccggagag-
A0A3P9Q4I8_MCL1-02      aatggatatgttgc-----------------aaaaagcctcccggagag-
A0A3B3VM25_MCL1-01      aatggatatgttgc-----------------aaaaagcctccaggagag-
A0A087X830_MCL1-01      aatggatatgttgc-----------------aaaaagcctccagaagag-
A0A3B3YCD0_MCL1-01      aatggatatgttgc-----------------aaaaagcctccagaagag-
A0A3Q3VP02_MCL1-01      aaggaatatatggg-----------------aaaacccatccgaaaaga-
G3PJT0_MCL1-01          aacggctacccatc-----------------aaaaccgcagcgggagga-
A0A2U9CJ81_MCL1-01      aaggcgtacgcggc-----------------caagagctgccgggaggac
A0A3Q3B4P5_MCL1-01      aagggataccaaga-----------------caagcgctttcaggagct-
A0A3Q3B4P5_MCL1-02      aagggataccaaga-----------------caagcgctttcaggagct-
A0A3Q3IZW0_MCL1-01      aatgggtatggaac-----------------aaaaacccttgtggatgt-
A0A3Q3GP42_MCL1-01      aac-----------------------------------------------
A0A3Q1GX28_MCL1-02      aatggctatgcaac-----------------aaaaaacattggggctaa-
A0A3Q1GX28_MCL1-01      aatggctatgcaac-----------------aaaaaacattggggctaa-
A0A3Q3M6G2_MCL1-01      aacgggtacgcgac-----------------aaaatccatcgtggccga-
A0A3Q3M6G2_MCL1-02      aacgggtacgcgac-----------------aaaatccatcgtggccga-
A0A3B4T8L9_MCL1-01      aatgggtatgcaac-----------------aaaagcgagtcgggagga-
A0A3B4T8L9_MCL1-02      aatgggtatgcaac-----------------aaaagcgagtcgggagga-
A0A3B4XKA5_MCL1-01      aatgggtatgcaac-----------------aaaagcgagtcgggagga-
A0A3Q0R633_MCL1-01      aacggatatgcacc-----------------aaaaaatatcacg------
A0A3Q0R633_MCL1-03      aacggatatgcacc-----------------aaaaaatatcacg------
I3KXG5_MCL1-01          -------------------------------gaaatct------------
I3JHR5_MCL1-03          aacgggtatacaac-----------------aaaagctatccgg------
I3JHR5_MCL1-02          aacgggtatacaac-----------------aaaagctatccgg------
I3JHR5_MCL1-01          aacgggtatacaac-----------------aaaagctatccgg------
A0A3Q4HLQ8_MCL1-01      aacgggtataccac-----------------aaaagctatccgg------
A0A3P9BVM3_MCL1-01      aacgggtataaaac-----------------aaaagctatccgg------
A0A3P8NP63_MCL1-02      aacgggtataaaac-----------------aaaagctatccgg------
A0A3P8NP63_MCL1-01      aacgggtataaaac-----------------aaaagctatccgg------
A0A3Q2VNL8_MCL1-01      aacgggtataaaac-----------------aaaagctatccgg------
A0A3B4G4Z6_MCL1-01      aacgggtataaaac-----------------aaaagctatccgg------
A0A3B4ZKP6_MCL1-01      aacgggtttgcggg-----------------aaagggcctccgacaggt-
A0A3Q1EQB9_MCL1-01      aacgggtatgcgcc-----------------aaaaagccttcgacaaga-
A0A3Q1EQB9_MCL1-02      aacgggtatgcgcc-----------------aaaaagccttcgacaaga-
A0A3P8RQX7_MCL1-02      aatgggtatgcgtc-----------------caaaaaccttcgacaaga-
A0A3P8RQX7_MCL1-01      aatgggtatgcgtc-----------------caaaaaccttcgacaaga-
A0A3Q1BKL8_MCL1-01      aatgggtatgcgtc-----------------aaaaaaccttcgacaaga-
A0A3Q1BKL8_MCL1-02      aatgggtatgcgtc-----------------aaaaaaccttcgacaaga-
A0A3Q2EDX8_MCL1-01      aatggatacgttgg-----------------aaaaaacctttcaga----
A0A3Q2P7X9_MCL1-02      aacggcttcgcggt-----------------gaaaagcatccagga----
A0A3Q2P7X9_MCL1-01      aacggcttcgcggt-----------------gaaaagcatccagga----
                                                                          

A0A3B3SG34_MCL1-01      g-----------cccgggagcacaaacgcggtcggctcactgc-cgactt
A2BF68_MCL1-02          gattctct------------------------------------------
Q8UWD6_MCL1-01          gactctctc---------------------cagggctcggtac-cgtcct
A2BF68_MCL1-01          gactctctc---------------------cagggctcggtac-cgtcct
Q568W5_MCL1-01          gactctctc---------------------cagggctcggtac-cgtcct
A0A3B1K5R1_MCL1-01      gacattagacctaccaggcccggcgtcgacgacggctcagtgc-ccagct
A0A3B4C6H5_MCL1-01      g---ttaca---------------------gacggttctctac-caacgt
A0A3B4C6H5_MCL1-03      g---ttaca---------------------gacggttctctac-caacgt
B6V6J0_MCL1-01          -----------------------------cggggggtcgctgc-cttgtt
Q568V1_MCL1-01          -----------------------------agacggatctctac-cgacca
Q1L8X3_MCL1-01          -----------------------------agacggatctctac-cgacca
Q9I9N3_MCL1-01          -----------------------------agacggatctctac-cgacca
J7H260_MCL1-01          -----------------------------------ctcccctc-cgctca
A0A3B3R4U0_MCL1-01      cacttacgggcgtcgggcaacga------agacgggtctttgc-cgtcca
A0A3Q2Y539_MCL1-01      --------taacagcgacatgga------tgaaggcgcccagc-cgt---
Q0KFR9_MCL1-01          aatcatttgtctgaccgaagcaacaa---tgacgactctttgc-cgtgca
A0A3P8Y1W8_MCL1-02      agtcgtttgtcagacctggccgacgactccgacgactcattgc-cgtgca
A0A3P8Y1W8_MCL1-01      agtcgtttgtcagacctggccgacgactccgacgactcattgc-cgtgca
A0A3B3CEX1_MCL1-01      --------tcacga---cgacga------cggcggctctctcc-cgaaca
A0A3B3CEX1_MCL1-02      --------tcacga---cgacga------cggcggctctctcc-cgaaca
A0A3P9ILF6_MCL1-01      --------tcacgacgtcgacga------cgatggctctctcc-cgaaca
A0A3P9ILF6_MCL1-02      --------tcacgacgtcgacga------cgatggctctctcc-cgaaca
A0A3B3IJ04_MCL1-01      --------tcacgacgtcgacga------cgatggctctctcc-ccaaca
A0A3B3IJ04_MCL1-02      --------tcacgacgtcgacga------cgatggctctctcc-ccaaca
A0A3P9L1F3_MCL1-02      --------tcacgacgtcgacga------cgatggctctctcc-cgaaca
A0A3P9L1F3_MCL1-01      --------tcacgacgtcgacga------cgatggctctctcc-cgaaca
H3AR18_MCL1-02          ------------ggttacaacgc------cgacggctccgtgc-cgcctt
H3AR18_MCL1-01          -------------atggaattac------cgggggacgggtgc-------
A0A3Q2XZL8_MCL1-01      agcgacgacgacttcgatgtggaaagcagcgacgactcaccac-cgagta
A0A3B4AFB7_MCL1-01      --------ggattacgaaaactc------agaggggtctctgc-catgta
A0A3B4AFB7_MCL1-02      --------ggattacgaaaactc------agaggggtctctgc-catgta
A0A3B1IEV7_MCL1-01      ---tctcca----------tggg------cggcgggtctctgc-ccgact
A0A3B4CGU9_MCL1-03      ---ccgcca----------tggc------cggagggtcgctgc-ccgagt
A0A3B4CGU9_MCL1-02      aaaccaccatcagcctgtgtgac------ggagaggtgaccgtgctgatt
W5MMB7_MCL1-01          acttcccggag-agcggccacgc------cgacgggtccctgc-cctcca
A0A3P8VKM5_MCL1-03      --------------------gga------cgaaggctctgagc-cgtgca
A0A3P8VKM5_MCL1-05      --------------------gga------cgaaggctctgagc-cgtgca
A0A3P8VKM5_MCL1-04      --------------------gga------cgaaggctctgagc-cgtgca
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ----------------gctcccg------agccagctgggcg--gcgaga
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ----------------gccccgg------aggcgattcgttgc-ccggca
A0A1L1RNM6_MCL1-02      ----------------gccccgg------aggcgattcgttgc-ccggca
H9GEA6_MCL1-02          ggagagaaagggaaagg--------------agggccccctct-cttccc
H9GEA6_MCL1-01          ggagagaaagggaaagg--------------agggccccctct-cttccc
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          ag---taactgccctggtacgc---------acggggcacttc-cctcaa
G3WBC5_MCL1-01          gg---ggacacatcgagcaatgc------ccgcggctcactgc-cctcaa
F6ZMX1_MCL1-03          gg---ggacagcccga---------------acggctctttgc-cttcga
F6ZMX1_MCL1-01          gg---ggacagcccga---------------acggctctttgc-cttcga
F6ZMX1_MCL1-02          gg---ggacagcccga---------------acggctctttgc-cttcga
H0XHA5_MCL1-01          gg---taacggccccagcactg---------aca---cacttc-cttcca
G1QAV8_MCL1-01          ag---cgaaggccccg---cag---------gtggctcactgc-cctcga
G1PZ39_MCL1-01          ag---cggcggccccggcgcgg---------ggggctcgctgc-cctcca
P97287_MCL1-01          gc---caagagctccggggccg---------acggctctctgc-cctcca
Q9Z1P3_MCL1-01          gc---taagagctccggagctg---------acggctcgctgc-cctcca
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      gg---gaagagccccagcgccg---------acggttcgctgc-cctcga
A0A287DCH9_MCL1-02      gc---caagagtcccggcgcgg---------acgggtcgctgc-cctcga
A0A287DCH9_MCL1-01      gc---caagagtcccggcgcgg---------acgggtcgctgc-cctcga
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          ag---taaggtccctagcacgg---------acgggtcgctgc-cctcga
G3T756_MCL1-01          ag---taatggccccggtaccg---------acgggtcactac-cctcga
A0A1S3F3I1_MCL1-01      ag---taagagctcgcgcacgg---------acggctcgctcc-cttcca
A0A2K6GI15_MCL1-01      ag---taatggctccagcacgg---------acgggtcactac-cctcga
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          ag---cagtggcccctgcacgg---------acggctcgctcc-cctcga
A0A337S3J9_MCL1-01      ag---cagtggccccggcacag---------acggctcactgc-cctcga
Q7YRZ9_MCL1-01          ag---cagtggccccggcacag---------acggctcactgc-cctcga
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ag---cagtggccccggcacag---------acggctcactgc-cctcga
Q8HYS5_MCL1-01          ag---cagtggccccggcatgg---------acggctcgctac-cctcga
F1PAP1_MCL1-01          ag---cagtggccccggcatgg---------acggctcgctac-cctcga
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          ag---cagtggcccctgcacgg---------acggctcactgc-cctcga
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ag---tagtggccccggcacgg---------acggctcgctcc-cctcga
A0A287BK44_MCL1-01      ag---tagtggccccggcacgg---------acggctcgctcc-cctcga
A0A452RHX5_MCL1-01      ag---cggtggcccttgtacgg---------acggctcactgc-cctcga
G1L3L7_MCL1-02          ag---cggtggcccttgtacgg---------acggctcactgc-cctcga
G1L3L7_MCL1-01          ag---cggtggcccttgtacgg---------acggctcactgc-cctcga
W5QI41_MCL1-01          agtaacaacagtccaggctcgg---------acggctcgctgc-cctcga
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          agtaacaacagtccaggctcgg---------acggctcgctgc-cctcga
A0A452GA25_MCL1-02      agtaacaacagtccaggctcgg---------acggctcgctgc-cctcga
A0A452GA25_MCL1-01      agtaacaacagtccaggctcgg---------acggctcgctgc-cctcga
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gg---taatgactccagtacgg---------atgggtcactac-cctcga
H0XFB7_MCL1-01          ag---taacggccccagcactg---------atgggtcacttc-cttcga
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      -----taatagctccagtacgg---------atgggtcactac-cctcga
H2N5Y9_MCL1-01          gg---taataacaccagtacgg---------acgggtcactac-cctcga
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      gg---taatgacaccagtacgg---------acgggtcactac-cctcga
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          gg---taataacaccagtacgg---------acgggtcactac-cctcga
B4DG83_MCL1-01          gg---taataacaccagtacgg---------acgggtcactac-cctcga
B4DU51_MCL1-01          gg---taataacaccagtacgg---------acgggtcactac-ccttga
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      gg---taataacaccagtacgg---------acgggtcactac-cctcga
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      gg---taataacaccagtacgg---------acgggtcactac-cctcga
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      gg---taataacaccagtacgg---------acgggtcactac-cctcga
A0A2I3GJZ3_MCL1-02      gg---taataacaccagtacgg---------acgggtcactac-cctcga
A0A2K6KRW9_MCL1-02      gg---taatagctccagtacgg---------atgggtcactac-cctcga
A0A2K6PPI3_MCL1-02      gg---taatagctccagtacgg---------atgggtcactac-cctcga
A0A2K6KRW9_MCL1-01      gg---taatagctccagtacgg---------atgggtcactac-cctcga
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      gg---taatagccccagtacgg---------atgggtcactac-cctcga
A0A2K5W0W9_MCL1-01      gg---taatagccccagtacgg---------atgggtcactac-cctcga
A0A2K6ECR0_MCL1-02      gg---taatagccccagtacgg---------atgggtcactac-cctcga
I7G687_MCL1-01          gg---taatagccccagtacgg---------atgggtcactac-cctcga
A0A2K5LXU8_MCL1-01      gg---taatagccccagtacgg---------atgggtcactac-cctcga
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      gg---taatagctccagtacgg---------atgggtcactac-cctcga
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      gg---taatagccccagtacgg---------atgggtcactac-cctcga
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      gg---taatggctccagtacgg---------acgggtcactac-cctcga
A0A2K6V5Y3_MCL1-01      gg---tcatggctccagtacgg---------acgggtcactcc-cctcga
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          gc---taatggctccagtacgg---------acgggtcactac-cgtcga
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      gg---taatggctccagtacgg---------acgggtcactac-cctcga
A0A2K5CFH3_MCL1-03      gg---taatggctccagtacgg---------acgggtcactac-cctcga
D2ITA0_MCL1-03          --------agacgaccaagaagg------aaacggttcgctgc-ctagca
D2ITA0_MCL1-04          --------agacgaccaagaagg------aaacggttcgctgc-ctagca
A0A3P8V8T6_MCL1-01      ------------------------------gtctgtttgacgc-tgtgca
Q4SW32_MCL1-01          -----------------cagcga------ggacggctcgctgc-cgtgta
A0A3B5PQ55_MCL1-01      --------cagcgacgacagcga------cgaaggctctctgc-catgca
A0A3B5PQ55_MCL1-02      --------cagcgacgacagcga------cgaaggctctctgc-catgca
A0A3P9Q4I8_MCL1-01      --------cagcgacgacagcga------cgaaggctctctgc-catgca
A0A3P9Q4I8_MCL1-02      --------cagcgacgacagcga------cgaaggctctctgc-catgca
A0A3B3VM25_MCL1-01      -----------------cagcga------cgaaggctctctgc-catgca
A0A087X830_MCL1-01      --------cagcgacgacagcga------cgaaggctctctgc-catgca
A0A3B3YCD0_MCL1-01      --------cagcgacgacagcga------cgaaggctctctgc-catgca
A0A3Q3VP02_MCL1-01      -----cagcaccgacaccgacga------cgacggttcgctgc-cgtaca
G3PJT0_MCL1-01          --------cagcgaggacaccga------caacgactcgctgc-cgtgca
A0A2U9CJ81_MCL1-01      ggcggcggcggcggcgacgtcgg------cggcggctctctgc-cctcca
A0A3Q3B4P5_MCL1-01      --------cggcgac------ga------ccacggctcgttac-cgagca
A0A3Q3B4P5_MCL1-02      --------cggcgac------ga------ccacggctcgttac-cgagca
A0A3Q3IZW0_MCL1-01      --------cagcgac---attga------caacggctcattgc-cgtgta
A0A3Q3GP42_MCL1-01      ------------gacgatatcga------agacggctcgctgc-cgtgca
A0A3Q1GX28_MCL1-02      --------cagcgacgacatcga------agacggatctttgc-cgtgca
A0A3Q1GX28_MCL1-01      --------cagcgacgacatcga------agacggatctttgc-cgtgca
A0A3Q3M6G2_MCL1-01      --------cacggacgacataga------ggacgggtcgttac-cctgca
A0A3Q3M6G2_MCL1-02      --------cacggacgacataga------ggacgggtcgttac-cctgca
A0A3B4T8L9_MCL1-01      --------cagcgac---gtcga------cgacggctctttgc-cgtgta
A0A3B4T8L9_MCL1-02      --------cagcgac---gtcga------cgacggctctttgc-cgtgta
A0A3B4XKA5_MCL1-01      --------cagcgac---gtcga------cgacggctctttgc-cgtgta
A0A3Q0R633_MCL1-01      ------------gacgacgtgga------agacggttcgttgc-cgagca
A0A3Q0R633_MCL1-03      ------------gacgacgtgga------agacggttcgttgc-cgagca
I3KXG5_MCL1-01          --------------------gga------agacggttcgttgc-cgagca
I3JHR5_MCL1-03          ------------gaccgggagga------agacggttcgttgc-cgagca
I3JHR5_MCL1-02          ------------gaccgggagga------agacggttcgttgc-cgagca
I3JHR5_MCL1-01          ------------gaccgggagga------agacggttcgttgc-cgagca
A0A3Q4HLQ8_MCL1-01      ------------gaccgggagga------agacggttcgttgc-cgagca
A0A3P9BVM3_MCL1-01      ------------gaccgggagga------agacggttcgttgc-cgagca
A0A3P8NP63_MCL1-02      ------------gaccgggagga------agacggttcgttgc-cgagca
A0A3P8NP63_MCL1-01      ------------gaccgggagga------agacggttcgttgc-cgagca
A0A3Q2VNL8_MCL1-01      ------------gaccgggagga------agacggttcgttgc-cgagca
A0A3B4G4Z6_MCL1-01      ------------gaccgggagga------agacggttcgttgc-cgagca
A0A3B4ZKP6_MCL1-01      --------cagcgacagcctgga------ggacagctcgctac-cgtgca
A0A3Q1EQB9_MCL1-01      --------cagcgacagtatgga------ggacggctctttac-cgtgca
A0A3Q1EQB9_MCL1-02      --------cagcgacagtatgga------ggacggctctttac-cgtgca
A0A3P8RQX7_MCL1-02      --------cagcgacagtatgga------ggagggctctttac-cgtgca
A0A3P8RQX7_MCL1-01      --------cagcgacagtatgga------ggagggctctttac-cgtgca
A0A3Q1BKL8_MCL1-01      --------cagcgacagtatgga------ggagggctctttac-cgtgca
A0A3Q1BKL8_MCL1-02      --------cagcgacagtatgga------ggagggctctttac-cgtgca
A0A3Q2EDX8_MCL1-01      --------caacagcgcagacga------cggcgggtctctgc-cgtgca
A0A3Q2P7X9_MCL1-02      --------gaaccg------cga------cgacggctccctgc-ccagca
A0A3Q2P7X9_MCL1-01      --------gaaccg------cga------cgacggctccctgc-ccagca
                                                                          

A0A3B3SG34_MCL1-01      ccccggacggcgacttgccagcttacggacccattt--------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          cgcc---------ttcggacgaa-acgg----------------------
A2BF68_MCL1-01          cgcc---------ttcggacgaa-acgg----------------------
Q568W5_MCL1-01          cgcc---------ttcggacgaa-acgg----------------------
A0A3B1K5R1_MCL1-01      cccc---------cttgtcggactgcgg----------------------
A0A3B4C6H5_MCL1-01      cccc---------cgcgtcggattgtga----------------------
A0A3B4C6H5_MCL1-03      cccc---------cgcgtcggattgtga----------------------
B6V6J0_MCL1-01          cccaggagga---tgaattagatgaggatatggataacggatcccagggt
Q568V1_MCL1-01          ccccagatcc---aga----------------------------------
Q1L8X3_MCL1-01          ccccagatcc---gga----------------------------------
Q9I9N3_MCL1-01          ccccagatcc---gga----------------------------------
J7H260_MCL1-01          cccccacctg---ctccccggacccc------------------------
A0A3B3R4U0_MCL1-01      cgccggggac---gccgccggactgcggga--aaat--------------
A0A3Q2Y539_MCL1-01      tgccggagct---ccaaac-------------------------------
Q0KFR9_MCL1-01          ctccccagat---ggcgtcagaatgtgggcctgaac--------------
A0A3P8Y1W8_MCL1-02      ctcccctgat---ggttactgagtgtagtgcggggt--------------
A0A3P8Y1W8_MCL1-01      ctcccctgat---ggttactgagtgtagtgcggggt--------------
A0A3B3CEX1_MCL1-01      ccccggagc---------tggagtgcgacaacagcg--------------
A0A3B3CEX1_MCL1-02      ccccggagc---------tggagtgcgacaacagcg--------------
A0A3P9ILF6_MCL1-01      ccccggagc---------tggagtgcgaggccagcg--------------
A0A3P9ILF6_MCL1-02      ccccggagc---------tggagtgcgaggccagcg--------------
A0A3B3IJ04_MCL1-01      ccccggagt---------tggagtgcgaggccagcg--------------
A0A3B3IJ04_MCL1-02      ccccggagt---------tggagtgcgaggccagcg--------------
A0A3P9L1F3_MCL1-02      cccccgagc---------tggagtgcgaggccagcg--------------
A0A3P9L1F3_MCL1-01      cccccgagc---------tggagtgcgaggccagcg--------------
H3AR18_MCL1-02          cgccgcccac---cccgtcgacccccgaggacgg----------------
H3AR18_MCL1-01          --ccgc---------------------------a----------------
A0A3Q2XZL8_MCL1-01      cccccgactc---ccag------------------g--------------
A0A3B4AFB7_MCL1-01      cgccagaatt---ccactcagacagtgaaatggagc--------------
A0A3B4AFB7_MCL1-02      cgccagaatt---ccactcagacagtgaaatggagc--------------
A0A3B1IEV7_MCL1-01      ccccgctggc---ggacgtagacttcatccaggact--------------
A0A3B4CGU9_MCL1-03      cccc---gga---gtccgacgacttcgtgcccgact--------------
A0A3B4CGU9_MCL1-02      aaac---cga---aaccaaag-------ggccgagt--------------
W5MMB7_MCL1-01          ccccggacac---cccgctggactgcgg---cagcg--------------
A0A3P8VKM5_MCL1-03      cgccggagcc---acactcggaagcagaactcgatg--------------
A0A3P8VKM5_MCL1-05      cgccggagcc---acactcggaagcagaactcgatg--------------
A0A3P8VKM5_MCL1-04      cgccggagcc---acactcggaagcagaactcgatg--------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      cgccgcccct---cccgcagcaggat------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cgccgcccga---gctgcccga----------------------------
A0A1L1RNM6_MCL1-02      cgccgcccga---gctgcccga----------------------------
H9GEA6_MCL1-02          gg--accac-----ctgc--------------------------------
H9GEA6_MCL1-01          gg--accac-----ctgc--------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          cgcagcccc-----cagc--------------------------------
G3WBC5_MCL1-01          cgccgcccc-----cggccgaggagg------------------------
F6ZMX1_MCL1-03          cgccgcccc-----cagctgag----------------------------
F6ZMX1_MCL1-01          cgccgcccc-----cagctgag----------------------------
F6ZMX1_MCL1-02          cgccgcccc-----cagctgag----------------------------
H0XHA5_MCL1-01          cacctcccc-----cagc--------------------------------
G1QAV8_MCL1-01          ccccgcccc-----ctgc--------------------------------
G1PZ39_MCL1-01          cgccgcccc-----ccgc--------------------------------
P97287_MCL1-01          cgccgccgc-----cgcc--------------------------------
Q9Z1P3_MCL1-01          cgccgccgc-----cgcc--------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      cgccgcccc-----cggcggag----------------------------
A0A287DCH9_MCL1-02      cgccgccgc-----ccgc--------------------------------
A0A287DCH9_MCL1-01      cgccgccgc-----ccgc--------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          cgccgccgc-----ccgc--------------------------------
G3T756_MCL1-01          cgccgcccc-----tagc--------------------------------
A0A1S3F3I1_MCL1-01      cgccgcctc-----cagc--------------------------------
A0A2K6GI15_MCL1-01      cgccgcccc-----cagc--------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          cgccgcccc-----cagc--------------------------------
A0A337S3J9_MCL1-01      cgccacccc-----cagc--------------------------------
Q7YRZ9_MCL1-01          cgccacccc-----cagc--------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      cgccacccc-----cagc--------------------------------
Q8HYS5_MCL1-01          cgccacccc-----cggc--------------------------------
F1PAP1_MCL1-01          cgccacccc-----cggc--------------------------------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          cgccacccc-----cagc--------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cgccgcccc-----cggc--------------------------------
A0A287BK44_MCL1-01      cgccgcccc-----cggc--------------------------------
A0A452RHX5_MCL1-01      cgccacccc-----cagc--------------------------------
G1L3L7_MCL1-02          cgccacccc-----cagc--------------------------------
G1L3L7_MCL1-01          cgccacccc-----cagc--------------------------------
W5QI41_MCL1-01          cgccgcccc-----catc--------------------------------
F1MQX4_MCL1-01          ----------------tc--------------------------------
A5PJR2_MCL1-01          cgccgcccc-----cagc--------------------------------
A0A452GA25_MCL1-02      cgccgcccc-----catc--------------------------------
A0A452GA25_MCL1-01      cgccgcccc-----catc--------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      cgccgccga-----ca----------------------------------
H0XFB7_MCL1-01          caccgcccc-----cagc--------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      cgccgccgc-----cagc--------------------------------
H2N5Y9_MCL1-01          cgccgccgc-----cagc--------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          cgccgccgc-----cagc--------------------------------
B4DG83_MCL1-01          cgccgccgc-----cagc--------------------------------
B4DU51_MCL1-01          cgccgccgc-----cagc--------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2I3GJZ3_MCL1-02      cgccgccgc-----cagc--------------------------------
A0A2K6KRW9_MCL1-02      cgccgccgc-----cagc--------------------------------
A0A2K6PPI3_MCL1-02      cgccgccgc-----cagc--------------------------------
A0A2K6KRW9_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2K5W0W9_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2K6ECR0_MCL1-02      cgccgccgc-----cagc--------------------------------
I7G687_MCL1-01          cgccgccgc-----cagc--------------------------------
A0A2K5LXU8_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      cgccgccgc-----cagc--------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      cgccgccgc-----cagc--------------------------------
A0A2K6V5Y3_MCL1-01      cgccgccgc-----ccgc--------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          cgccgccgc-----cagc--------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      cgccgcctc-----cagc--------------------------------
A0A2K5CFH3_MCL1-03      cgccgcctc-----cagc--------------------------------
D2ITA0_MCL1-03          ctccggaact---ccagtcagaagtagacacggaca--------------
D2ITA0_MCL1-04          ctccggaact---ccagtcagaagtagacacggaca--------------
A0A3P8V8T6_MCL1-01      ca------------------------------------------------
Q4SW32_MCL1-01          cgccggagtc---gcactcgggcgacgtgctggacg--------------
A0A3B5PQ55_MCL1-01      ccccggcgca---gcacccagacagtgaaaaagacg--------------
A0A3B5PQ55_MCL1-02      ccccggcgca---gcacccagacagtgaaaaagacg--------------
A0A3P9Q4I8_MCL1-01      ccccggcgca---gca---agacggtgaaaccgacg--------------
A0A3P9Q4I8_MCL1-02      ccccggcgca---gca---agacggtgaaaccgacg--------------
A0A3B3VM25_MCL1-01      ctccagcgca---gca---agacagtgaaaccgtcg--------------
A0A087X830_MCL1-01      ctccagcgca---gca---agacagtgaaaccgacg--------------
A0A3B3YCD0_MCL1-01      ctccagcgca---gca---agacagtgaaaccgacg--------------
A0A3Q3VP02_MCL1-01      cgccggatat---gtccccggacagtgaactcaacg--------------
G3PJT0_MCL1-01          ccccggag---------tcggacagcgaaaccgacg--------------
A0A2U9CJ81_MCL1-01      ccccggag---------tcggacggcgagcacgacg--------------
A0A3Q3B4P5_MCL1-01      cgccggaggt---------ggacggtaaccccgacg--------------
A0A3Q3B4P5_MCL1-02      cgccggaggt---------ggacggtaaccccgacg--------------
A0A3Q3IZW0_MCL1-01      gtcctgtgct---acagccggataatgaaattgaag--------------
A0A3Q3GP42_MCL1-01      ccccggagc---------cggacagtgaaaccgaag--------------
A0A3Q1GX28_MCL1-02      ccccggagct---gatgtcggacagcgaggtcgatg--------------
A0A3Q1GX28_MCL1-01      ccccggagct---gatgtcggacagcgaggtcgatg--------------
A0A3Q3M6G2_MCL1-01      ccccggagct---gcagtcggacagcgaagcc------------------
A0A3Q3M6G2_MCL1-02      ccccggagct---gcagtcggacagcgaagcc------------------
A0A3B4T8L9_MCL1-01      ctccggagat---tcagtcggacggagaaaccgatg--------------
A0A3B4T8L9_MCL1-02      ctccggagat---tcagtcggacggagaaaccgatg--------------
A0A3B4XKA5_MCL1-01      ctccggagat---gcagtcggatggcgaaaccgacg--------------
A0A3Q0R633_MCL1-01      ccccggagtt---tcattcggatagtgaatcc------------------
A0A3Q0R633_MCL1-03      ccccggagtt---tcattcggatagtgaatcc------------------
I3KXG5_MCL1-01          ccccgga-------------------------------------------
I3JHR5_MCL1-03          ccccggagta---tcatttggacggtgaatcc------------------
I3JHR5_MCL1-02          ccccggagta---tcatttggacggtgaatcc------------------
I3JHR5_MCL1-01          ccccggagta---tcatttggacggtgaatcc------------------
A0A3Q4HLQ8_MCL1-01      ccccggagtt---tcattcggacagtgaatcc------------------
A0A3P9BVM3_MCL1-01      ccccagagtt---tcattcggacagtgaatcc------------------
A0A3P8NP63_MCL1-02      ccccggagtt---tcattcggacagtgaatcc------------------
A0A3P8NP63_MCL1-01      ccccggagtt---tcattcggacagtgaatcc------------------
A0A3Q2VNL8_MCL1-01      ccccggagtt---tcattcggacagtgaatcc------------------
A0A3B4G4Z6_MCL1-01      ccccggagtt---tcattcggacagtgaatcc------------------
A0A3B4ZKP6_MCL1-01      ctccggagct---acagtcggacagtgaaaccgacg--------------
A0A3Q1EQB9_MCL1-01      ccccagagct---ccagtcggacagtgaaaccgacg--------------
A0A3Q1EQB9_MCL1-02      ccccagagct---ccagtcggacagtgaaaccgacg--------------
A0A3P8RQX7_MCL1-02      ccccggagct---gcagtcggacagtgaaaccgacg--------------
A0A3P8RQX7_MCL1-01      ccccggagct---gcagtcggacagtgaaaccgacg--------------
A0A3Q1BKL8_MCL1-01      ccccggagct---gcagtcggacagtgaaaccgacg--------------
A0A3Q1BKL8_MCL1-02      ccccggagct---gcagtcggacagtgaaaccgacg--------------
A0A3Q2EDX8_MCL1-01      ccccggagat---gccaacggacagccaccccgcca--------------
A0A3Q2P7X9_MCL1-02      ccccggagat---gcaggcggacagcgaggccgccg--------------
A0A3Q2P7X9_MCL1-01      ccccggagat---gcaggcggacagcgaggccgccg--------------
                                                                          

A0A3B3SG34_MCL1-01      -----gtggtttctctcgcagcgccgt--------cgaaatgctggacca
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          -----gggattatccccccacc-----------------gcccttgacat
A2BF68_MCL1-01          -----gggattatccccccacc-----------------gcccttgacat
Q568W5_MCL1-01          -----gggattatccccccacc-----------------gcccttgacat
A0A3B1K5R1_MCL1-01      -----ggagatggccgttgggaactgcaagcagtacgaaacgctggacgg
A0A3B4C6H5_MCL1-01      -----ggagttggactcagaccaattcaaggaatctgaaactttggacag
A0A3B4C6H5_MCL1-03      -----ggagttggactcagaccaattcaaggaatctgaaactttggacag
B6V6J0_MCL1-01          tccacgtctcccccggacagccccgtgtgccctaaggatggattatatat
Q568V1_MCL1-01          -----------------------ggagctcgactacgccgaactggaacg
Q1L8X3_MCL1-01          -----------------------ggagctcgactacgccgaactggaacg
Q9I9N3_MCL1-01          -----------------------ggagctcgactacgccgaactggaacg
J7H260_MCL1-01          ------------------------------------------ctgcacac
A0A3B3R4U0_MCL1-01      ----------gctgacgtttcccaacaggggg----------ctcagcca
A0A3Q2Y539_MCL1-01      -----------------------ccctcccggccaaggcgtcttggacac
Q0KFR9_MCL1-01          ----------tatcgaattgtccatcgggcgatgaagta---ttggaaca
A0A3P8Y1W8_MCL1-02      ----------tatcacattgcccatcgggcaatgaggtt---ttggacaa
A0A3P8Y1W8_MCL1-01      ----------tatcacattgcccatcgggcaatgaggtt---ttggacaa
A0A3B3CEX1_MCL1-01      ----------tacttgtacccaacgaccc----accga-----taaacca
A0A3B3CEX1_MCL1-02      ----------tacttgtacccaacgaccc----accga-----taaacca
A0A3P9ILF6_MCL1-01      ----------tttccgg---cgacaactcgggaatcgacgctttaaacga
A0A3P9ILF6_MCL1-02      ----------tttccgg---cgacaactcgggaatcgacgctttaaacga
A0A3B3IJ04_MCL1-01      ----------tttccgg---cgacaactcgggaatcgacgctttaaacga
A0A3B3IJ04_MCL1-02      ----------tttccgg---cgacaactcgggaatcgacgctttaaacga
A0A3P9L1F3_MCL1-02      ----------tttccgg---cgacaactcgggaatcgacgctttaaacga
A0A3P9L1F3_MCL1-01      ----------tttccgg---cgacaactcgggaatcgacgctttaaacga
H3AR18_MCL1-02          -----------------------ggacggggacatggcggagtttcgcaa
H3AR18_MCL1-01          -----------------------ggacggggacatggcggagtttcgcaa
A0A3Q2XZL8_MCL1-01      ----------actcactagtcgccgacggccgcaacgacgtggtggacgc
A0A3B4AFB7_MCL1-01      ----------tctccagctactcggcggagcacgaagtg---ttagagag
A0A3B4AFB7_MCL1-02      ----------tctccagctactcggcggagcacgaagtg---ttagagag
A0A3B1IEV7_MCL1-01      ----------ttagctgccgctgcccgggcgcg---------ctggaggc
A0A3B4CGU9_MCL1-03      ----------tcggcggc---------agcgcc---------ctggtgga
A0A3B4CGU9_MCL1-02      ----------cagg----------------------------ctggagga
W5MMB7_MCL1-01          ----------tccccgagttcctctccgaggcccacgggcagctgaacgc
A0A3P8VKM5_MCL1-03      ----------tctcc------caggccggggacgaggtg---ctggatac
A0A3P8VKM5_MCL1-05      ----------tctcc------caggccggggacgaggtg---ctggatac
A0A3P8VKM5_MCL1-04      ----------tctcc------caggccggggacgaggtg---ctggatac
U3KKY6_MCL1-01          ------------------------------aaaaaaaataaaaaaaatc-
A0A493U0E8_MCL1-01      -------------------gttgcacttttaaaaaatgcaaaaggtttcg
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      -------------------cttgatccccgacgagctgcggcaggaatc-
A0A1L1RNM6_MCL1-02      -------------------cttgatccccgacgagctgcggcaggaatc-
H9GEA6_MCL1-02          --------------------------------ggaagacga---------
H9GEA6_MCL1-01          --------------------------------ggaagacga---------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          -----------------------agaggaagaagaagacaagttgtaccc
G3WBC5_MCL1-01          -------------------acgaggacgaggaggaggatgagttgtacgg
F6ZMX1_MCL1-03          ---------------------gaggatgaagaagaggatgaactatacgg
F6ZMX1_MCL1-01          ---------------------gaggatgaagaagaggatgaactatacgg
F6ZMX1_MCL1-02          ---------------------gaggatgaagaagaggatgaactatacgg
H0XHA5_MCL1-01          --------------------------agaggaggaggatgagttatactg
G1QAV8_MCL1-01          -----------------------tgaggaggaggaggaattgtca-----
G1PZ39_MCL1-01          -----------------------ggaggaggaggaggacgagctgttccg
P97287_MCL1-01          -----------------------cgaggaggaagaggacgacctataccg
Q9Z1P3_MCL1-01          -----------------------tgaggaggaagacgacgagctgtacca
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      ---------------------gaggaggaggaggaggacgcgctgtaccg
A0A287DCH9_MCL1-02      -----------------------ggaggaggaggacgacgagctgtaccg
A0A287DCH9_MCL1-01      -----------------------ggaggaggaggacgacgagctgtaccg
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
G3T756_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
A0A1S3F3I1_MCL1-01      -----------------------ggaggaggaggacgacgagttgtaccg
A0A2K6GI15_MCL1-01      -----------------------agaggaggaggacgacgagttgtaccg
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
A0A337S3J9_MCL1-01      -----------------------agaggaggaggaggacgagttgttccg
Q7YRZ9_MCL1-01          -----------------------agaggaggaggaggacgagttgttccg
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      -----------------------agaggaggaggaggacgagttgttccg
Q8HYS5_MCL1-01          -----------------------ggaggaggaggaagatgagttgtaccg
F1PAP1_MCL1-01          -----------------------ggaggaggaggaagatgagttgtaccg
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          -----------------------agaggaggaggaagacgagttgtaccg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      -----------------------agaggaggaggaggacgagttataccg
A0A287BK44_MCL1-01      -----------------------agaggaggaggaggacgagttataccg
A0A452RHX5_MCL1-01      -----------------------agaggaggaggaagacgagttgtaccg
G1L3L7_MCL1-02          -----------------------agaggaggaggaagacgagttgtaccg
G1L3L7_MCL1-01          -----------------------agaggaggaggaagacgagttgtaccg
W5QI41_MCL1-01          -----------------------agaggaggaggaggacgagttatatcg
F1MQX4_MCL1-01          -----------------------agaggaggaggaggacgagttatattg
A5PJR2_MCL1-01          -----------------------agaggaggaggaggacgagttatatcg
A0A452GA25_MCL1-02      -----------------------agaggaggaggaggacgagttatatcg
A0A452GA25_MCL1-01      -----------------------agaggaggaggaggacgagttatatcg
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          -----------------------agaggaggaggaggatgagttataccg
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      -----------------------agaggaggaggaggacgagttgtaccg
H2N5Y9_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
B4DG83_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
B4DU51_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2I3GJZ3_MCL1-02      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K6KRW9_MCL1-02      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K6PPI3_MCL1-02      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K6KRW9_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K5W0W9_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K6ECR0_MCL1-02      -----------------------agaggaggaggaggacgagttgtaccg
I7G687_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
A0A2K5LXU8_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K6V5Y3_MCL1-01      -----------------------agaggaggaggaggacgagttgtaccg
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          -----------------------agaggaggaggaggacgagttgtaccg
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      -----------------------ggaggaggaggaggacgagttgtaccg
A0A2K5CFH3_MCL1-03      -----------------------ggaggaggaggaggacgagttgtaccg
D2ITA0_MCL1-03          -------------------gccaggcgggggaagaagtg---ttggataa
D2ITA0_MCL1-04          -------------------gccaggcgggggaagaagtg---ttggataa
A0A3P8V8T6_MCL1-01      ------------------------------------------ctggaaaa
Q4SW32_MCL1-01          ----------tgtccgggcgtccggcgggggacgaggcggctctcgacag
A0A3B5PQ55_MCL1-01      ----------cgacggccgtaggtgcgagcaaccaagtg---ctggataa
A0A3B5PQ55_MCL1-02      ----------cgacggccgtaggtgcgagcaaccaagtg---ctggataa
A0A3P9Q4I8_MCL1-01      ----------cgtctgctgtacgtgcgagcaaccaagtg---ctggataa
A0A3P9Q4I8_MCL1-02      ----------cgtctgctgtacgtgcgagcaaccaagtg---ctggataa
A0A3B3VM25_MCL1-01      ----------cgtctgctgtacgtgcgagcaaccaagtg---ctggataa
A0A087X830_MCL1-01      ----------cgtctgctgtacgtgcgagcaaccaagtg---ctggataa
A0A3B3YCD0_MCL1-01      ----------cgtctgctgtacgtgcgagcaaccaagtg---ctggataa
A0A3Q3VP02_MCL1-01      ----------tctccggttgtttggcgggggatgaactg---ttggagaa
G3PJT0_MCL1-01          ----------tctccgactccccggcgggggccgcggct---ctggagag
A0A2U9CJ81_MCL1-01      ----------tctccggttgtccggcggcggacgaggcg---ctggacag
A0A3Q3B4P5_MCL1-01      ----------tccccggcggt---gctgaggacgaagtg---ctggagaa
A0A3Q3B4P5_MCL1-02      ----------tccccggcggt---gctgaggacgaagtg---ctggagaa
A0A3Q3IZW0_MCL1-01      ----------tctccagttccccagcagagtacgaagtc---ctggagaa
A0A3Q3GP42_MCL1-01      ----------tctccagctgtcccactgggggcgaagtc---ctggagag
A0A3Q1GX28_MCL1-02      ----------tctccagttgtccagcaggggacgaggtg---ctggagaa
A0A3Q1GX28_MCL1-01      ----------tctccagttgtccagcaggggacgaggtg---ctggagaa
A0A3Q3M6G2_MCL1-01      ------------cccagctgcccggccggggacgaggtc---ctggagaa
A0A3Q3M6G2_MCL1-02      ------------cccagctgcccggccggggacgaggtc---ctggagaa
A0A3B4T8L9_MCL1-01      ----------tccctagttgtccagcaggggatgaagtg---ttggagga
A0A3B4T8L9_MCL1-02      ----------tccctagttgtccagcaggggatgaagtg---ttggagga
A0A3B4XKA5_MCL1-01      ----------tccctagttgtccagctggg---gaagtg---ttggagtc
A0A3Q0R633_MCL1-01      ------------------------------gacgaggcg---ctggagag
A0A3Q0R633_MCL1-03      ------------------------------gacgaggcg---ctggagag
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          ------------------------------gacgaggag---ctggagag
I3JHR5_MCL1-02          ------------------------------gacgaggag---ctggagag
I3JHR5_MCL1-01          ------------------------------gacgaggag---ctggagag
A0A3Q4HLQ8_MCL1-01      ------------------------------gacgagcag---ctggagag
A0A3P9BVM3_MCL1-01      ------------------------------gacgagcag---ctggagag
A0A3P8NP63_MCL1-02      ------------------------------gacgagcag---ctggagag
A0A3P8NP63_MCL1-01      ------------------------------gacgagcag---ctggagag
A0A3Q2VNL8_MCL1-01      ------------------------------gacgagcag---ctggagag
A0A3B4G4Z6_MCL1-01      ------------------------------gacgagcag---ctggagag
A0A3B4ZKP6_MCL1-01      ----------tgtcgagttgcccggcgggggacgaggtg---ctggagaa
A0A3Q1EQB9_MCL1-01      ----------tctccagttgtccaacaggggacgagttg---ctggagaa
A0A3Q1EQB9_MCL1-02      ----------tctccagttgtccaacaggggacgagttg---ctggagaa
A0A3P8RQX7_MCL1-02      ----------tctccagttgtccagcaggagacgagttg---ctggagaa
A0A3P8RQX7_MCL1-01      ----------tctccagttgtccagcaggagacgagttg---ctggagaa
A0A3Q1BKL8_MCL1-01      ----------tctccagttgtccagcaggagacgagttg---ctggagaa
A0A3Q1BKL8_MCL1-02      ----------tctccagttgtccagcaggagacgagttg---ctggagaa
A0A3Q2EDX8_MCL1-01      ----------caccgggcggccatgcgggggacgaagcg---ctggacaa
A0A3Q2P7X9_MCL1-02      ----------gctgcgggagccacgccggccaggaggcg---ctggacag
A0A3Q2P7X9_MCL1-01      ----------gctgcgggagccacgccggccaggaggcg---ctggacag
                                                                          

A0A3B3SG34_MCL1-01      agagactagcgaattaatcacgactttcttcgccgaatacac--------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ggacacgcgggagattattgacactttcttaaaaatctttac--------
A2BF68_MCL1-01          ggacacgcgggagattattgacactttcttaaaaatctttac--------
Q568W5_MCL1-01          ggacacgcgggagattattgacactttcttaataatctttac--------
A0A3B1K5R1_MCL1-01      agacacgcgagagattatcagtgactttctgaggaacttttg--------
A0A3B4C6H5_MCL1-01      agacacttcagaaatagtcattgactttttgcaaaacttcac--------
A0A3B4C6H5_MCL1-03      agacacttcagaaatagtcattgactttttgcaaaacttcac--------
B6V6J0_MCL1-01          ggacacccagcagctcattctcgctttctaccgcg--tgtacagcggcga
Q568V1_MCL1-01          cgatactcggcagctcttattggatttttaccgcacacacac----ggga
Q1L8X3_MCL1-01          cgatactcggcagctcttattggatttttaccgcacacacac----ggga
Q9I9N3_MCL1-01          cgatactcggcagctcttattggatttttaccgcacacacac----ggga
J7H260_MCL1-01          ggaaacccgcgccctgctgcacaccttcttcagggaatgggc--------
A0A3B3R4U0_MCL1-01      ggagactcatgagcttatcgggaccttcttacgga--cttac--------
A0A3Q2Y539_MCL1-01      cgagacgagacgtctcatcggccgcttcctccgtgactttac--------
Q0KFR9_MCL1-01          tgataccagacaactcattgagaattttttgggggactacac--------
A0A3P8Y1W8_MCL1-02      cgataccagacaactcattgagaatttattaagggactacac--------
A0A3P8Y1W8_MCL1-01      cgataccagacaactcattgagaatttattaagggactacac--------
A0A3B3CEX1_MCL1-01      ggacaccacggaattcctcacgaacttctttaggaactatgt--------
A0A3B3CEX1_MCL1-02      ggacaccacggaattcctcacgaacttctttaggaactatgt--------
A0A3P9ILF6_MCL1-01      ggacaccacggaattcctcaccaatttctttaggaactttgt--------
A0A3P9ILF6_MCL1-02      ggacaccacggaattcctcaccaatttctttaggaactttgt--------
A0A3B3IJ04_MCL1-01      ggacaccacggaattcctcaccaatttctttaggaactttgt--------
A0A3B3IJ04_MCL1-02      ggacaccacggaattcctcaccaatttctttaggaactttgt--------
A0A3P9L1F3_MCL1-02      ggacaccacggaattcctcaccaatttctttaggaactttgt--------
A0A3P9L1F3_MCL1-01      ggacaccacggaattcctcaccaatttctttaggaactttgt--------
H3AR18_MCL1-02          ggagacgctgaagctgttgcggagttacttgtgcgaggtggc--------
H3AR18_MCL1-01          ggagacgctgaagctgttgcggagttacttgtgcgaggtggc--------
A0A3Q2XZL8_MCL1-01      cgagaccaagggcctcattagacgttttctcacagactttac--------
A0A3B4AFB7_MCL1-01      cgacacgaggcagcttcttagcgattttttcaagcttttcac--------
A0A3B4AFB7_MCL1-02      cgacacgaggcagcttcttagcgattttttcaagcttttcac--------
A0A3B1IEV7_MCL1-01      ggagacccgccgcctgatggtggagttttaccgcgggtacct--------
A0A3B4CGU9_MCL1-03      ggagacccggcggctcatcgggggcttttaccgcggatatat--------
A0A3B4CGU9_MCL1-02      ggagaccctctgcatcatcggggatttttaccagggatac----------
W5MMB7_MCL1-01          ggagacccgggagttaatcgggacctttttgcagatgtacac--------
A0A3P8VKM5_MCL1-03      cgataccaaggaacttatttttcagttctacagagactttac--------
A0A3P8VKM5_MCL1-05      cgataccaaggaacttatttttcagttctacagagactttac--------
A0A3P8VKM5_MCL1-04      cgataccaaggaacttatttttcagttctacagagactttac--------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      agccggcccccaccccttccctcatcaccct------------------g
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ------cctggagctcatcctccggtacctccgggaggcggcgggagagg
A0A1L1RNM6_MCL1-02      ------cctggagctcatcctccggtacctccgggaggcggcgggagagg
H9GEA6_MCL1-02          -----cgctggaagtggtaggccgctacctgcgcgaggccgccgacgagg
H9GEA6_MCL1-01          -----cgctggaagtggtaggccgctacctgcgcgaggccgccgacgagg
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          gcaatcgctggatattatctttcggtaccttcacgagcaggc------ca
G3WBC5_MCL1-01          gcagtccttggagttgataacccgatacctccgcgagcaggc------gg
F6ZMX1_MCL1-03          gcagtccttggagctcatcagccggtaccttcgcgagcaggc------gg
F6ZMX1_MCL1-01          gcagtccttggagctcatcagccggtaccttcgcgagcaggc------gg
F6ZMX1_MCL1-02          gcagtccttggagctcatcagccggtaccttcgcgagcaggc------gg
H0XHA5_MCL1-01          gcagtcgatggagatcatctctcggtacctatgggagcagga------aa
G1QAV8_MCL1-01          ----ctgctggagatgatccctcagcaccttagggaacgggc--------
G1PZ39_MCL1-01          gcagtcgctggagatcatctctcggtacc---gggagcaggc------ga
P97287_MCL1-01          ccagtcgctggagatcatctcgcgctacttgcgggagcaggc------ga
Q9Z1P3_MCL1-01          ccagtcgctggagatcatctcccgctacctgcgggagcaggc------ga
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      ---------------------------------------ggc------ga
A0A286Y1M5_MCL1-01      acagtcgctggagatcatctcgcggtacctgcgggagcaggc------cg
A0A287DCH9_MCL1-02      gcagtcgctggagatcatttcgcggtacctccgcgagcaggc------ga
A0A287DCH9_MCL1-01      gcagtcgctggagatcatttcgcggtacctccgcgagcaggc------ga
G1T2Q0_MCL1-02          ---------------------------------------ggc------ga
G1T2Q0_MCL1-01          gcagtcgctggagattatcgcccggtaccttcgggagcaggc------ga
G3T756_MCL1-01          gcagtcgctagagattatctctcggtaccttcaggagcaggc------aa
A0A1S3F3I1_MCL1-01      gcagtcgctggagattatctgtcgctaccttagggagcaagc------ca
A0A2K6GI15_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------aa
F7AVA6_MCL1-02          ---------------------------------------ggc------ta
F7AVA6_MCL1-01          gcaatcgctggagattatctctcgttaccttcgggaacaggc------ta
A0A337S3J9_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ga
Q7YRZ9_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------ga
A0A337S3J9_MCL1-04      ---------------------------------------ggc------ga
A0A337S3J9_MCL1-03      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ga
Q8HYS5_MCL1-01          gcagtccctggagattatctctcggtaccttcgggaacaggc------ca
F1PAP1_MCL1-01          gcagtccctggagattatctctcggtaccttcgggaacaggc------ca
F1PAP1_MCL1-02          ---------------------------------------ggc------ca
M3XZZ5_MCL1-01          gcagtctctggagattatttctcggtacctgcgggagcaggc------aa
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      gcagtccctggagattatctctcggtaccttcgggagcaggc------aa
A0A287BK44_MCL1-01      gcagtccctggagattatctctcggtaccttcgggagcaggc------aa
A0A452RHX5_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------aa
G1L3L7_MCL1-02          gcagtcgctggagattatctctcggtaccttcgggagcaggc------aa
G1L3L7_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------aa
W5QI41_MCL1-01          gcagtccctggagattatctctcagtacctcctggagcaagc------aa
F1MQX4_MCL1-01          gcagtccctggagattatctctcggtacctccgggagcaggc------aa
A5PJR2_MCL1-01          gcagtccctggagataatctctcagtacctccgggagcaggc------aa
A0A452GA25_MCL1-02      gcagtccctggagattatctctcagtacctcctggagcaggc------aa
A0A452GA25_MCL1-01      gcagtccctggagattatctctcagtacctcctggagcaggc------aa
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ----tcactggagattatctctcggtaccttcgggaacaggc------ga
H0XFB7_MCL1-01          gcagtcgctggagatcatctctcggtaccttcgggagcaggc------ga
A0A2K6GI15_MCL1-03      ---------------------------------------ggc------aa
A0A2K5I9I0_MCL1-02      gcagtcgctggaaattatctctcggtaccttcgggagcaggc------ca
H2N5Y9_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
C8YZ26_MCL1-01          ---------------------------------------ggc------ca
A0A2I2YQH7_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
A0A2I2YQH7_MCL1-03      ----------------------------------------gc------ca
B4E3L8_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
B4DG83_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
B4DU51_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
Q07820_MCL1-04          ---------------------------------------ggc------ca
B4DLY8_MCL1-01          ---------------------------------------ggc------cg
A0A2I3RTV4_MCL1-01      gcagtccctggagattatctctcggtaccttcgggagcaggc------ca
A0A2R9BPJ5_MCL1-03      ---------------------------------------ggc------ca
A0A2I3RTV4_MCL1-03      ---------------------------------------ggc------ca
A0A2R9BPJ5_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
A0A2K5I9I0_MCL1-03      ---------------------------------------ggc------ca
A0A2I3GJZ3_MCL1-01      gcagtcgctggagatcatctctcggtaccttcgggagcaggc------ca
A0A2I3GJZ3_MCL1-02      gcagtcgctggagatcatctctcggtaccttcgggagcaggc------ca
A0A2K6KRW9_MCL1-02      gcagtcactggaaattatctctcggtaccttcgggagcaggc------ca
A0A2K6PPI3_MCL1-02      gcagtcactggaaattatctctcggtaccttcgggagcaggc------ca
A0A2K6KRW9_MCL1-01      gcagtcactggaaattatctctcggtaccttcgggagcaggc------ca
A0A2K6PPI3_MCL1-03      ---------------------------------------ggc------ca
A0A2I3LFM0_MCL1-01      gcagtcgctggagattatctcttggtaccttcgggagcaggc------ca
A0A2K5W0W9_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
A0A2K6ECR0_MCL1-02      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
I7G687_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
A0A2K5LXU8_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
A0A2K5LXU8_MCL1-03      ---------------------------------------ggc------ca
A0A0D9RZP5_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
A0A2K5W0W9_MCL1-03      ---------------------------------------ggc------ca
A0A2K6ECR0_MCL1-03      ---------------------------------------ggc------ca
A0A2K5XSB2_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ca
A0A2K5XSB2_MCL1-03      ---------------------------------------ggc------ca
A0A2I3LFM0_MCL1-03      ---------------------------------------agc------ca
A0A2K5R5E2_MCL1-03      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ga
A0A2K6V5Y3_MCL1-01      gcagtcgctggagattatctctcggtacctccgggagcaggc------ga
A0A2K6V5Y3_MCL1-03      ---------------------------------------ggc------ga
A0A2K5R5E2_MCL1-04      ---------------------------------------ggc------ga
F7GTF7_MCL1-01          gcagtcgctggagattatctctcggtaccttcgggagcaggc------ga
F7GTF7_MCL1-02          ---------------------------------------ggc------ga
A0A2K5CFH3_MCL1-01      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ga
A0A2K5CFH3_MCL1-03      gcagtcgctggagattatctctcggtaccttcgggagcaggc------ga
D2ITA0_MCL1-03          cgacaccaagcgaatcattcgcatttttctcagagactatgc--------
D2ITA0_MCL1-04          cgacaccaagcgaatcattcgcatttttctcagagactatgc--------
A0A3P8V8T6_MCL1-01      tgacaccaggcaattgatttgcgatttcctgaaagacttcac--------
Q4SW32_MCL1-01          cgacacgaggcagctggtgagccgtttaatggcggacgttac--------
A0A3B5PQ55_MCL1-01      cgacacaacggagcttattagcagttttctgagagactttac--------
A0A3B5PQ55_MCL1-02      cgacacaacggagcttattagcagttttctgagagactttac--------
A0A3P9Q4I8_MCL1-01      cgacacaacggagcttattagcagttttctaagaaattttac--------
A0A3P9Q4I8_MCL1-02      cgacacaacggagcttattagcagttttctaagaaattttac--------
A0A3B3VM25_MCL1-01      cgacacaatggagcttattggcagttttctaagaaattttac--------
A0A087X830_MCL1-01      cgacacaatggagctcattagcagttttctaagaaattttac--------
A0A3B3YCD0_MCL1-01      cgacacaatggagctcattagcagttttctaagacattttac--------
A0A3Q3VP02_MCL1-01      ggacacgaggcagctcattagccgcgtcttgatggaactttc--------
G3PJT0_MCL1-01          cgacacgaggcaactcctcggccgcttcctgagagaatttac--------
A0A2U9CJ81_MCL1-01      cttcaccagggaactcattagccagttcctgagagactatgt--------
A0A3Q3B4P5_MCL1-01      cgacacgaagcatctgatcagccgtttcctacaagagtttac--------
A0A3Q3B4P5_MCL1-02      cgacacgaagcatctgatcagccgtttcctacaagagtttac--------
A0A3Q3IZW0_MCL1-01      tgacacgaggctactaatttgccacttccttagagattatac--------
A0A3Q3GP42_MCL1-01      cgacaccaggcaactcatcagcgccttcctcagagagcatac--------
A0A3Q1GX28_MCL1-02      cgacacgaggcagctcctaagccagtttctccaagacttttc--------
A0A3Q1GX28_MCL1-01      cgacacgaggcagctcctaagccagtttctccaagacttttc--------
A0A3Q3M6G2_MCL1-01      cgacaccaggcagctcatctgtcaatacctgaaagacgtttc--------
A0A3Q3M6G2_MCL1-02      cgacaccaggcagctcatctgtcaatacctgaaagacgtttc--------
A0A3B4T8L9_MCL1-01      cgatacgaggcaacttattagccagtccatgaaaagctttac--------
A0A3B4T8L9_MCL1-02      cgatacgaggcaacttattagccagtccatgaaaagctttac--------
A0A3B4XKA5_MCL1-01      cgatacgagtcaactcattagccagtccatgaaaagctttac--------
A0A3Q0R633_MCL1-01      ggaaacgaaaagcctcattactagtttctttagagactttac--------
A0A3Q0R633_MCL1-03      ggaaacgaaaagcctcattactagtttctttagagactttac--------
I3KXG5_MCL1-01          agaaactaaactcattattcacagttttttgggagactttac--------
I3JHR5_MCL1-03          agaaacgaaactccttattcacagttttttgggtgattttac--------
I3JHR5_MCL1-02          agaaacgaaactccttattcacagttttttgggtgattttac--------
I3JHR5_MCL1-01          agaaacgaaactccttattcacagttttttgggtgattttac--------
A0A3Q4HLQ8_MCL1-01      agaaacgaaactccttattcacagttttttgggtgactttac--------
A0A3P9BVM3_MCL1-01      agaaacgaaactccttattcacagttttttgggtgactttat--------
A0A3P8NP63_MCL1-02      agaaacgaaactccttattcacagttttttgggtgactttat--------
A0A3P8NP63_MCL1-01      agaaacgaaactccttattcacagttttttgggtgactttat--------
A0A3Q2VNL8_MCL1-01      agaaacgaaactccttattcacagttttttgggtgactttac--------
A0A3B4G4Z6_MCL1-01      agaaacgaaactccttattcacagttttttgggtgactttac--------
A0A3B4ZKP6_MCL1-01      tgacacgaggcaactgattagcagcttcctaaaagactttac--------
A0A3Q1EQB9_MCL1-01      tgacacgaggcaactcattcgccgtttcttaagagactttac--------
A0A3Q1EQB9_MCL1-02      tgacacgaggcaactcattcgccgtttcttaagagactttac--------
A0A3P8RQX7_MCL1-02      tgacacgaggcaactccttcgccgtttcttaagagactttac--------
A0A3P8RQX7_MCL1-01      tgacacgaggcaactccttcgccgtttcttaagagactttac--------
A0A3Q1BKL8_MCL1-01      tgacacgaggcaactccttcgccgtttcttaagagactttac--------
A0A3Q1BKL8_MCL1-02      tgacacgaggcaactccttcgccgtttcttaagagactttac--------
A0A3Q2EDX8_MCL1-01      cgacacgaaggagcttattagcagtttcctaagagactttac--------
A0A3Q2P7X9_MCL1-02      cgacaccacggagcttattagcggtttcctcagagactttac--------
A0A3Q2P7X9_MCL1-01      cgacaccacggagcttattagcggtttcctcagagactttac--------
                                                                          

A0A3B3SG34_MCL1-01      -------ggggctgtgtgcgacat--------------------------
A2BF68_MCL1-02          --------ggactctttc--------------------------------
Q8UWD6_MCL1-01          -------aggactccctcattcta--------------------------
A2BF68_MCL1-01          -------aggactccctcattcta--------------------------
Q568W5_MCL1-01          -------aggactccctcattcta--------------------------
A0A3B1K5R1_MCL1-01      -------cggactctctcggtcct--------------------------
A0A3B4C6H5_MCL1-01      -------cgggctgtctcggtcct--------------------------
A0A3B4C6H5_MCL1-03      -------cgggctgtctcggtcct--------------------------
B6V6J0_MCL1-01          ggagagcggcgaattagaggcttc--------------------------
Q568V1_MCL1-01          atgtgtccggtagaccgtaaactc--------------------------
Q1L8X3_MCL1-01          atgtgtccggtagaccgtaaactc--------------------------
Q9I9N3_MCL1-01          atgtgtccggtagaccgtaaactc--------------------------
J7H260_MCL1-01          -------cggagacgcgaagcagg--------------------------
A0A3B3R4U0_MCL1-01      -------agcggcctcccggcctc--------------------------
A0A3Q2Y539_MCL1-01      -------cgggctgtccactgctg--------------------------
Q0KFR9_MCL1-01          -------aggactgtctcagcctc--------------------------
A0A3P8Y1W8_MCL1-02      -------aggactgtctcaacctc--------------------------
A0A3P8Y1W8_MCL1-01      -------aggactgtctcaacctc--------------------------
A0A3B3CEX1_MCL1-01      -------tggattatctcaatctc--------------------------
A0A3B3CEX1_MCL1-02      -------tggattatctcaatctc--------------------------
A0A3P9ILF6_MCL1-01      -------tggaatttctcagtatc--------------------------
A0A3P9ILF6_MCL1-02      -------tggaatttctcagtatc--------------------------
A0A3B3IJ04_MCL1-01      -------tggaatttctcagtatc--------------------------
A0A3B3IJ04_MCL1-02      -------tggaatttctcagtatc--------------------------
A0A3P9L1F3_MCL1-02      -------tggaatttctcagtatc--------------------------
A0A3P9L1F3_MCL1-01      -------tggaatttctcagtatc--------------------------
H3AR18_MCL1-02          -gggctgcgagagcacggagacgg--------------------------
H3AR18_MCL1-01          -gggctgcgagagcacggagacgg--------------------------
A0A3Q2XZL8_MCL1-01      -------cggcctgtcgactgcta--------------------------
A0A3B4AFB7_MCL1-01      -------ggggatttctcagccga--------------------------
A0A3B4AFB7_MCL1-02      -------ggggatttctcagccga--------------------------
A0A3B1IEV7_MCL1-01      --gggccagaagccccgggagc----------------------------
A0A3B4CGU9_MCL1-03      --cggccagaagacccgggacc----------------------------
A0A3B4CGU9_MCL1-02      ---------aggagccgaaacc----------------------------
W5MMB7_MCL1-01          --------ggggttgccgcaccgc--------------------------
A0A3P8VKM5_MCL1-03      -------aactcattctccgtcga--------------------------
A0A3P8VKM5_MCL1-05      -------aactcattctccgtcga--------------------------
A0A3P8VKM5_MCL1-04      -------aactcattctccgtcga--------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ctgggcgagatttttggg----gtttcaccacccccggccaaatttttgg
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ccgagcccggcgttaaaaagctgtttccggggctcctgggagggccaggg
A0A1L1RNM6_MCL1-02      ccgagcccggcgttaaaaagctgtttccggggctcctgggagggccaggg
H9GEA6_MCL1-02          ccgggtccaaaggcaccgggcccaagttctccttccaaggcttgctgggg
H9GEA6_MCL1-01          ccgggtccaaaggcaccgggcccaagttctccttccaaggcttgctgggg
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          tcggcgcca-----------------------------------------
G3WBC5_MCL1-01          tcggcaccaaggacaccaagcccc----------------------tacg
F6ZMX1_MCL1-03          ttggcacgaaggaggccaagcccc----------------------tacg
F6ZMX1_MCL1-01          ttggcacgaaggaggccaagcccc----------------------tacg
F6ZMX1_MCL1-02          ttggcacgaaggaggccaagcccc----------------------tacg
H0XHA5_MCL1-01          ctgg----------------------------------------------
G1QAV8_MCL1-01          -tggcgccagggac-caaagcca---------------------------
G1PZ39_MCL1-01          ccggcgccaaggacgccaagcccc----------------------tggg
P97287_MCL1-01          ccggctccaaggactcgaagcctc----------------------tggg
Q9Z1P3_MCL1-01          cgggctccaaggacgcgaagcctc----------------------tggg
A0A2K6F6N9_MCL1-01      -----------------------c----------------------tggg
A0A2K5DMS4_MCL1-01      ctggcgccaaggacacaaagccaa----------------------tggg
A0A286Y1M5_MCL1-01      cgggcgccaaggactcgaagccgc----------------------tggg
A0A287DCH9_MCL1-02      ccggctccaaggacgcgaagccgc----------------------tgcg
A0A287DCH9_MCL1-01      ccggctccaaggacgcgaagccgc----------------------tgcg
G1T2Q0_MCL1-02          ccggcgccaaggacgcgaagccga----------------------tggg
G1T2Q0_MCL1-01          ccggcgccaaggacgcgaagccga----------------------tggg
G3T756_MCL1-01          ccggcgccaaggacaccaagccaa----------------------tggg
A0A1S3F3I1_MCL1-01      cgggcgccaaggacgccaagccgc----------------------tggg
A0A2K6GI15_MCL1-01      ccggcgccaaggacgcaaagccaa----------------------tggg
F7AVA6_MCL1-02          ccggcaccaaggacacgaagccaa----------------------tggg
F7AVA6_MCL1-01          ccggcaccaaggacacgaagccaa----------------------tggg
A0A337S3J9_MCL1-01      ccggcgccaaggacgcgaaaccac----------------------tggg
Q7YRZ9_MCL1-01          ccggcgccaaggacgcgaaaccac----------------------tggg
A0A337S3J9_MCL1-04      ccggcgccaaggacgcgaaaccac----------------------tggg
A0A337S3J9_MCL1-03      ccggcgccaaggacgcgaaaccac----------------------tggg
Q8HYS5_MCL1-01          caggcgccaaggacgcgaaaccac----------------------tggg
F1PAP1_MCL1-01          caggcgccaaggacgcgaaaccac----------------------tggg
F1PAP1_MCL1-02          caggcgccaaggacgcgaaaccac----------------------tggg
M3XZZ5_MCL1-01          cgggcgccaaggacgcgaaaccac----------------------tggg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ccggcgccaaggacgcgaagccaa----------------------tggg
A0A287BK44_MCL1-01      ccggcgccaaggacgcgaagccaa----------------------tggg
A0A452RHX5_MCL1-01      caggcgccaaggacgcgaaaccgc----------------------tggg
G1L3L7_MCL1-02          caggcgccaaggacgcgaaaccgc----------------------tggg
G1L3L7_MCL1-01          caggcgccaaggacgcgaaaccgc----------------------tggg
W5QI41_MCL1-01          ccggcaccaaggacgcgaagcccc----------------------tggg
F1MQX4_MCL1-01          ccggcgccaaggatgtgaagcccc----------------------tggg
A5PJR2_MCL1-01          ccggcgccaaggacgcgaagcccc----------------------tggg
A0A452GA25_MCL1-02      ccggcgccaaggacgcgaagcccc----------------------tggg
A0A452GA25_MCL1-01      ccggcgccaaggacgcgaagcccc----------------------tggg
G2HFR3_MCL1-01          ---------------------cat----------------------tgtg
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ctggcgccaaggacacaaagccaa----------------------tgga
H0XFB7_MCL1-01          ccggtgccaaggacgcgaaaccaa----------------------tggg
A0A2K6GI15_MCL1-03      ccggcgccaaggacgcaaagccaa----------------------tggg
A0A2K5I9I0_MCL1-02      ctggcgccaaggacacacagccaa----------------------tggg
H2N5Y9_MCL1-01          ccggcgccaaggacacaaagccat----------------------tggg
C8YZ26_MCL1-01          ccggcgccaaggacacaaagccaa----------------------tggg
A0A2I2YQH7_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2I2YQH7_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
B4E3L8_MCL1-01          ccggcgccaaggacacaaagccaa----------------------tggg
B4DG83_MCL1-01          ccggcgccaaggacacaaagccaa----------------------tggg
B4DU51_MCL1-01          ccggcgccaaggacacaaagccaa----------------------tggg
Q07820_MCL1-04          ccggcgccaaggacacaaagccaa----------------------tggg
B4DLY8_MCL1-01          ccg--cccaaggacacaaagccaa----------------------tggg
A0A2I3RTV4_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2R9BPJ5_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2I3RTV4_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2R9BPJ5_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5I9I0_MCL1-03      ctggcgccaaggacacacagccaa----------------------tggg
A0A2I3GJZ3_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2I3GJZ3_MCL1-02      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6KRW9_MCL1-02      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6PPI3_MCL1-02      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6KRW9_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6PPI3_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2I3LFM0_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5W0W9_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6ECR0_MCL1-02      ccggcgccaaggacacaaagccaa----------------------tggg
I7G687_MCL1-01          ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5LXU8_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5LXU8_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A0D9RZP5_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tgag
A0A2K5W0W9_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6ECR0_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5XSB2_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5XSB2_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2I3LFM0_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5R5E2_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6V5Y3_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K6V5Y3_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5R5E2_MCL1-04      ccggcgccaaggacacaaagccaa----------------------tggg
F7GTF7_MCL1-01          ccggcgccaaggacacaaagccaa----------------------tggg
F7GTF7_MCL1-02          ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5CFH3_MCL1-01      ccggcgccaaggacacaaagccaa----------------------tggg
A0A2K5CFH3_MCL1-03      ccggcgccaaggacacaaagccaa----------------------tggg
D2ITA0_MCL1-03          -------aggggcatcaaaagcta--------------------------
D2ITA0_MCL1-04          -------aggggcatcaaaagcta--------------------------
A0A3P8V8T6_MCL1-01      -------cacaaaatctacccaac--------------------------
Q4SW32_MCL1-01          -------cggcatcagcagagccc--------------------------
A0A3B5PQ55_MCL1-01      -------gggactttcaaagtgtc--------------------------
A0A3B5PQ55_MCL1-02      -------gggactttcaaagtgtc--------------------------
A0A3P9Q4I8_MCL1-01      -------tggactttcaaagtgtc--------------------------
A0A3P9Q4I8_MCL1-02      -------tggactttcaaagtgtc--------------------------
A0A3B3VM25_MCL1-01      -------aggactttcaaagtgtc--------------------------
A0A087X830_MCL1-01      -------aggactttcaaagtgtc--------------------------
A0A3B3YCD0_MCL1-01      -------aggactttcaaagtgtc--------------------------
A0A3Q3VP02_MCL1-01      -------tggacacggaagagcac--------------------------
G3PJT0_MCL1-01          -------gggactgtcgaaaaccc--------------------------
A0A2U9CJ81_MCL1-01      -------cgcgcgcacggacccgc--------------------------
A0A3Q3B4P5_MCL1-01      -------tggactatcaaaacgtc--------------------------
A0A3Q3B4P5_MCL1-02      -------tggactatcaaaacgtc--------------------------
A0A3Q3IZW0_MCL1-01      -------tggactatctacacatc--------------------------
A0A3Q3GP42_MCL1-01      -------tgggctttcaaagcctg--------------------------
A0A3Q1GX28_MCL1-02      -------tggacttactaagcctc--------------------------
A0A3Q1GX28_MCL1-01      -------tggacttactaagcctc--------------------------
A0A3Q3M6G2_MCL1-01      -------tggactttctaaacccc--------------------------
A0A3Q3M6G2_MCL1-02      -------tggactttctaaacccc--------------------------
A0A3B4T8L9_MCL1-01      -------cggacgctcgataccgc--------------------------
A0A3B4T8L9_MCL1-02      -------cggacgctcgataccgc--------------------------
A0A3B4XKA5_MCL1-01      -------cggacggtcgatacagc--------------------------
A0A3Q0R633_MCL1-01      -------tggactttctcaacgac--------------------------
A0A3Q0R633_MCL1-03      -------tggactttctcaacgac--------------------------
I3KXG5_MCL1-01          -------tggactttctcagcctc--------------------------
I3JHR5_MCL1-03          -------tggactttctcagcctc--------------------------
I3JHR5_MCL1-02          -------tggactttctcagcctc--------------------------
I3JHR5_MCL1-01          -------tggactttctcagcctc--------------------------
A0A3Q4HLQ8_MCL1-01      -------tggactttcgcagcctc--------------------------
A0A3P9BVM3_MCL1-01      -------tggactttctcagcctc--------------------------
A0A3P8NP63_MCL1-02      -------tggactttctcagcctc--------------------------
A0A3P8NP63_MCL1-01      -------tggactttctcagcctc--------------------------
A0A3Q2VNL8_MCL1-01      -------tggactttctcagcctc--------------------------
A0A3B4G4Z6_MCL1-01      -------tggactttctcagcctc--------------------------
A0A3B4ZKP6_MCL1-01      -------tggactttcaaagcctc--------------------------
A0A3Q1EQB9_MCL1-01      -------tggactttcaaagcccc--------------------------
A0A3Q1EQB9_MCL1-02      -------tggactttcaaagcccc--------------------------
A0A3P8RQX7_MCL1-02      -------tggactttcaaagcccc--------------------------
A0A3P8RQX7_MCL1-01      -------tggactttcaaagcccc--------------------------
A0A3Q1BKL8_MCL1-01      -------tggactttcaaagcccc--------------------------
A0A3Q1BKL8_MCL1-02      -------tggactttcaaagcccc--------------------------
A0A3Q2EDX8_MCL1-01      -------gggacttcctaaacaac--------------------------
A0A3Q2P7X9_MCL1-02      -------tggactgtcgggccatc--------------------------
A0A3Q2P7X9_MCL1-01      -------tggactgtcgggccatc--------------------------
                                                                          

A0A3B3SG34_MCL1-01      ---------------------------tacagagac---gaaacgaggcg
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ---------------------------aaagtggac---gaaaacaagta
A2BF68_MCL1-01          ---------------------------aaagtggac---gaaaacaagta
Q568W5_MCL1-01          ---------------------------aaagtggac---gaaaacaagta
A0A3B1K5R1_MCL1-01      ---------------------------gtggaggac---acggtgcggtt
A0A3B4C6H5_MCL1-01      ---------------------------gtggtcggc---accgtggggtt
A0A3B4C6H5_MCL1-03      ---------------------------gtggtcggc---accgtggggtt
B6V6J0_MCL1-01          ----------------ctgtctcctccaacatggcgtccaccacaaagcc
Q568V1_MCL1-01          -----------------------------------------catcacgcc
Q1L8X3_MCL1-01          -----------------------------------------catcacgcc
Q9I9N3_MCL1-01          -----------------------------------------catcacgcc
J7H260_MCL1-01          ---------------------------aggacggcgacagcccgaaggcg
A0A3B3R4U0_MCL1-01      ---------------------------ggccagccg----acacaaagcg
A0A3Q2Y539_MCL1-01      ---------------------------cttggatcc---aaagcaaagcc
Q0KFR9_MCL1-01          ---------------------------gatggacgc---aaagcaagcct
A0A3P8Y1W8_MCL1-02      ---------------------------gttggaaac---aaaacaagtct
A0A3P8Y1W8_MCL1-01      ---------------------------gttggaaac---aaaacaagtct
A0A3B3CEX1_MCL1-01      ---------------------------gccaccggg---agagcaaatac
A0A3B3CEX1_MCL1-02      ---------------------------gccaccggg---agagcaaatac
A0A3P9ILF6_MCL1-01      ---------------------------cacaccggg---ataataaatac
A0A3P9ILF6_MCL1-02      ---------------------------cacaccggg---ataataaatac
A0A3B3IJ04_MCL1-01      ---------------------------ggcaccggg---ataataaatac
A0A3B3IJ04_MCL1-02      ---------------------------ggcaccggg---ataataaatac
A0A3P9L1F3_MCL1-02      ---------------------------ggcaccggg---ataataaatac
A0A3P9L1F3_MCL1-01      ---------------------------ggcaccggg---ataataaatac
H3AR18_MCL1-02          ------ccttcaggttcggtctagatcagtggagcggtggcgagaagccg
H3AR18_MCL1-01          ------ccttcaggttcggtctagatcagtggagcggtggcgagaagccg
A0A3Q2XZL8_MCL1-01      ---------------------------gctggaacg---aaagcaaggca
A0A3B4AFB7_MCL1-01      ---------------------------agtggaaac---aacgtccggcc
A0A3B4AFB7_MCL1-02      ---------------------------agtggaaac---aacgtccggcc
A0A3B1IEV7_MCL1-01      ---------------------------------------agagcccggcc
A0A3B4CGU9_MCL1-03      ---------------------------------------agcaccccgcc
A0A3B4CGU9_MCL1-02      ---------------------------------------agcacccagcc
W5MMB7_MCL1-01          -----------------------------cggagcc---gaggcaaggcc
A0A3P8VKM5_MCL1-03      ---------------------------aatggggcg---aacgcaaagcg
A0A3P8VKM5_MCL1-05      ---------------------------aatggggcg---aacgcaaagcg
A0A3P8VKM5_MCL1-04      ---------------------------aatggggcg---aacgcaaagcg
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ggtgctggcaaggaaaccacactcg----ggggagc-----------agg
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      cggcccggcagggcgagcagcgccgtcatggagaaa-----------gcg
A0A1L1RNM6_MCL1-02      cggcccggcagggcgagcagcgccgtcatggagaaa-----------gcg
H9GEA6_MCL1-02          cgcttc-----gggagcagccccaacgaggcggagg---tggcgcgcgcg
H9GEA6_MCL1-01          cgcttc-----gggagcagccccaacgaggcggagg---tggcgcgcgcg
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          ----cc-----cagggccgcc------agctggaag-----------ggg
G3WBC5_MCL1-01          c--------------------------agtgggaag-----------gca
F6ZMX1_MCL1-03          c--------------------------agcggcaag-----------gcc
F6ZMX1_MCL1-01          c--------------------------agcggcaag-----------gcc
F6ZMX1_MCL1-02          c--------------------------agcggcaag-----------gcc
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          ------------gggcccgcg------ggtcggcgg-----------ggt
G1PZ39_MCL1-01          cgggcc-----cgcggcctcc------agccggaag-----------gcg
P97287_MCL1-01          cgaggc-----gggcgcggcg------ggccggaga-----------gcg
Q9Z1P3_MCL1-01          cgaggc-----cggcgcagcg------ggccggagg-----------gcg
A0A2K6F6N9_MCL1-01      cctggc-----tgggttt--------------------------------
A0A2K5DMS4_MCL1-01      caggtc-----tgaggccgcc------aacagtaag-----------gcg
A0A286Y1M5_MCL1-01      cggggt-----ggggcccacc------agcaggaag-----------gca
A0A287DCH9_MCL1-02      tgggtc-----gggggccgcc------agcaggaag-----------gcg
A0A287DCH9_MCL1-01      tgggtc-----gggggccgcc------agcaggaag-----------gcg
G1T2Q0_MCL1-02          ccgggc-----cggcagcgcg------agccggaag-----------gcg
G1T2Q0_MCL1-01          ccgggc-----cggcagcgcg------agccggaag-----------gcg
G3T756_MCL1-01          cgggtc-----tggggcggcc------agcaggaag-----------gcg
A0A1S3F3I1_MCL1-01      tggggc-----cggcgcggcc------agcaggaag-----------gcg
A0A2K6GI15_MCL1-01      caggtc-----tggggccgcc------agcaggaag-----------gcg
F7AVA6_MCL1-02          cgggtc-----tggggccgcc------agccggaag-----------gcg
F7AVA6_MCL1-01          cgggtc-----tggggccgcc------agccggaag-----------gcg
A0A337S3J9_MCL1-01      cgggtc-----tggggcggcc------agccgaaag-----------gcg
Q7YRZ9_MCL1-01          cgggtc-----tggggcggcc------agccgaaag-----------gcg
A0A337S3J9_MCL1-04      cgggtc-----tggggcggcc------agccgaaag-----------gcg
A0A337S3J9_MCL1-03      cgggtc-----tggggcggcc------agccgaaag-----------gcg
Q8HYS5_MCL1-01          cgggtc-----tcgggcggcc------agccggaag-----------gcg
F1PAP1_MCL1-01          cgggtc-----tcgggcggcc------agccggaag-----------gcg
F1PAP1_MCL1-02          cgggtc-----tcgggcggcc------agccggaag-----------gcg
M3XZZ5_MCL1-01          cgggcc-----tggggctgcc------agccggaag-----------gcg
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      cgggtc-----tggggccgcc------agccggaag-----------gcg
A0A287BK44_MCL1-01      cgggtc-----tggggccgcc------agccggaag-----------gcg
A0A452RHX5_MCL1-01      cgggtc-----tggggcggcc------agccggaag-----------gcg
G1L3L7_MCL1-02          cgggtc-----tggggcggcc------agccggaag-----------gcg
G1L3L7_MCL1-01          cgggtc-----tggggcggcc------agccggaag-----------gcg
W5QI41_MCL1-01          cgggtc-----tggggccacc------agccggaag-----------gcg
F1MQX4_MCL1-01          cgggtc-----tggggccacc------agccggaag-----------gcg
A5PJR2_MCL1-01          cgggtc-----tgggaccaca------agccggaag-----------gcg
A0A452GA25_MCL1-02      cgggtc-----tggggccacc------agccggaag-----------gcg
A0A452GA25_MCL1-01      cgggtc-----tggggccacc------agccggaag-----------gcg
G2HFR3_MCL1-01          ca-----------------------------------------------t
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      caggtc-----cggggccgcc------agcaggaag-----------gct
H0XFB7_MCL1-01          cagggc-----aggagccgcc------agcaggaag-----------gcg
A0A2K6GI15_MCL1-03      caggtc-----tggggccgcc------agcaggaag-----------gcg
A0A2K5I9I0_MCL1-02      caggtc-----tggggccacc------agcaggaag-----------gct
H2N5Y9_MCL1-01          caggtc-----tggggccacc------tgcaggaag-----------gct
C8YZ26_MCL1-01          caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2I2YQH7_MCL1-01      caggtc-----tggggcaacc------agcaggaag-----------gcg
A0A2I2YQH7_MCL1-03      caggtc-----tggggcaacc------agcaggaag-----------gcg
B4E3L8_MCL1-01          caggtc-----tggggccacc------agcaggaag-----------gcg
B4DG83_MCL1-01          caggtc-----tggggccacc------agcaggaag-----------gcg
B4DU51_MCL1-01          caggtc-----tggggccacc------agcaggaag-----------gcg
Q07820_MCL1-04          caggtc-----tggggccacc------agcaggaag-----------gcg
B4DLY8_MCL1-01          caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2I3RTV4_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2R9BPJ5_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2I3RTV4_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2R9BPJ5_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2K5I9I0_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2I3GJZ3_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2I3GJZ3_MCL1-02      caggtc-----tggggccacc------agcaggaag-----------gcg
A0A2K6KRW9_MCL1-02      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K6PPI3_MCL1-02      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K6KRW9_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K6PPI3_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2I3LFM0_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K5W0W9_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K6ECR0_MCL1-02      caggtc-----tggggccacc------agcaggaag-----------gct
I7G687_MCL1-01          caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K5LXU8_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K5LXU8_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gct
A0A0D9RZP5_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K5W0W9_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K6ECR0_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K5XSB2_MCL1-01      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K5XSB2_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2I3LFM0_MCL1-03      caggtc-----tggggccacc------agcaggaag-----------gct
A0A2K5R5E2_MCL1-03      caggtc-----cggggccgcc------agcaggaag-----------gct
A0A2K6V5Y3_MCL1-01      caggtc-----cggggccgcc------agcaggaag-----------gcg
A0A2K6V5Y3_MCL1-03      caggtc-----cggggccgcc------agcaggaag-----------gcg
A0A2K5R5E2_MCL1-04      caggtc-----cggggccgcc------agcaggaag-----------gct
F7GTF7_MCL1-01          caggtc-----cggggccgcc------agcaggaag-----------gcg
F7GTF7_MCL1-02          caggtc-----cggggccgcc------agcaggaag-----------gcg
A0A2K5CFH3_MCL1-01      caggtc-----cggggccgcc------agcaggaag-----------gcg
A0A2K5CFH3_MCL1-03      caggtc-----cggggccgcc------agcaggaag-----------gcg
D2ITA0_MCL1-03          ---------------------------aaaggacaagacaagacgaggtt
D2ITA0_MCL1-04          ---------------------------aaaggacaagacaagacgaggtt
A0A3P8V8T6_MCL1-01      ---------------------------gattggtgg---agagcaaagca
Q4SW32_MCL1-01          ---------------------------agtggaggg---agagcagagcg
A0A3B5PQ55_MCL1-01      ---------------------------ggtggggtc---aaaataaagct
A0A3B5PQ55_MCL1-02      ---------------------------ggtggggtc---aaaataaagct
A0A3P9Q4I8_MCL1-01      ---------------------------ggtggagtc---aaaataaagct
A0A3P9Q4I8_MCL1-02      ---------------------------ggtggagtc---aaaataaagct
A0A3B3VM25_MCL1-01      ---------------------------ggtggagtc---aaaataaagct
A0A087X830_MCL1-01      ---------------------------ggtggagtc---aaaataaagct
A0A3B3YCD0_MCL1-01      ---------------------------ggtggagtc---aaaataaagct
A0A3Q3VP02_MCL1-01      ---------------------------gatggactg---aaagcagaaca
G3PJT0_MCL1-01          ---------------------------agtggaacc---cgagcagggag
A0A2U9CJ81_MCL1-01      ---------------------------ggtggaccg---acagcaaagcg
A0A3Q3B4P5_MCL1-01      ---------------------------agtggtcag---agagtaaggag
A0A3Q3B4P5_MCL1-02      ---------------------------agtggtcag---agagtaaggag
A0A3Q3IZW0_MCL1-01      ---------------------------ggtggaccc---gcagaaaaact
A0A3Q3GP42_MCL1-01      ---------------------------gttggaatg---agagtagtgca
A0A3Q1GX28_MCL1-02      ---------------------------gttggtgtg---aaaccaaagaa
A0A3Q1GX28_MCL1-01      ---------------------------gttggtgtg---aaaccaaagaa
A0A3Q3M6G2_MCL1-01      ---------------------------ggtggcacg---actccaaagca
A0A3Q3M6G2_MCL1-02      ---------------------------ggtggcacg---actccaaagca
A0A3B4T8L9_MCL1-01      ---------------------------ggtggactg---aacacagagca
A0A3B4T8L9_MCL1-02      ---------------------------ggtggactg---aacacagagca
A0A3B4XKA5_MCL1-01      ---------------------------ggcggactg---aacacagagca
A0A3Q0R633_MCL1-01      ---------------------------gatggaaag---aaagcgaagca
A0A3Q0R633_MCL1-03      ---------------------------gatggaaag---aaagcgaagca
I3KXG5_MCL1-01          ---------------------------aacgaaagg---aaaccaaagca
I3JHR5_MCL1-03          ---------------------------aacgaaagg---aaaccaaagca
I3JHR5_MCL1-02          ---------------------------aacgaaagg---aaaccaaagca
I3JHR5_MCL1-01          ---------------------------aacgaaagg---aaaccaaagca
A0A3Q4HLQ8_MCL1-01      ---------------------------aacgaaagg---aaaccaaagca
A0A3P9BVM3_MCL1-01      ---------------------------aacgaaaag---aaaccaaagca
A0A3P8NP63_MCL1-02      ---------------------------aacgaaaag---aaaccaaagca
A0A3P8NP63_MCL1-01      ---------------------------aacgaaaag---aaaccaaagca
A0A3Q2VNL8_MCL1-01      ---------------------------aacgaaaag---aaaccaaagca
A0A3B4G4Z6_MCL1-01      ---------------------------aacgaaaag---aaaccaaagca
A0A3B4ZKP6_MCL1-01      ---------------------------ggtggaacg---agggcaaagca
A0A3Q1EQB9_MCL1-01      ---------------------------ggtggaatg---aaagcaaagca
A0A3Q1EQB9_MCL1-02      ---------------------------ggtggaatg---aaagcaaagca
A0A3P8RQX7_MCL1-02      ---------------------------ggtggaatg---aaagcaaagca
A0A3P8RQX7_MCL1-01      ---------------------------ggtggaatg---aaagcaaagca
A0A3Q1BKL8_MCL1-01      ---------------------------ggtggaatg---aaagcaaagca
A0A3Q1BKL8_MCL1-02      ---------------------------ggtggaatg---aaagcaaagca
A0A3Q2EDX8_MCL1-01      ---------------------------ggcggaatc---aaactaaagct
A0A3Q2P7X9_MCL1-02      ---------------------------ggtggtaca---cgaaaaaatct
A0A3Q2P7X9_MCL1-01      ---------------------------ggtggtaca---cgaaaaaatct
                                                                          

A0A3B3SG34_MCL1-01      ctctccacactgaagcgggtggtggcgactgttgtcgaaaaacacaagtt
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          ctgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagct
A2BF68_MCL1-01          ctgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagct
Q568W5_MCL1-01          ctgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagct
A0A3B1K5R1_MCL1-01      gtacagacaatgaagcgggtggtggacgatctggtggtcaaacatgggat
A0A3B4C6H5_MCL1-01      gtacagacaataaggagggtggtggacggcctggtggtgaagcatgagct
A0A3B4C6H5_MCL1-03      gtacagacaataaggagggtggtggacggcctggtggtgaagcatgagct
B6V6J0_MCL1-01          ctggaaaccctgctgagggtcgggggagagattatagagaagcaccacat
Q568V1_MCL1-01          ataccgacgatgaagcgggtggtcgacaatattctcgtgaagcaccagat
Q1L8X3_MCL1-01          ataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagat
Q9I9N3_MCL1-01          ataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagat
J7H260_MCL1-01          ctgcccaccatgcgcaggctggggggcgacatcaatgagaagcaccgaat
A0A3B3R4U0_MCL1-01      taccctgtcctcagacgagtggcggagactgtcataggaaagcacttgat
A0A3Q2Y539_MCL1-01      cagtcgacaatgaagagggtcgtgacgagactggtggacaagcacaggat
Q0KFR9_MCL1-01          cttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgata
A0A3P8Y1W8_MCL1-02      cttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcacacata
A0A3P8Y1W8_MCL1-01      cttgtgacgatgaaaagagtggtgggcgacgtaatagccaagcacacata
A0A3B3CEX1_MCL1-01      atatcgacggcgaaaagagtagtgaacgacatgatggataaacatcggtt
A0A3B3CEX1_MCL1-02      atatcgacggcgaaaagagtagtgaacgacatgatggataaacatcggtt
A0A3P9ILF6_MCL1-01      atgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacacaagat
A0A3P9ILF6_MCL1-02      atgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacacaagat
A0A3B3IJ04_MCL1-01      atgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacacaagat
A0A3B3IJ04_MCL1-02      atgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacacaagat
A0A3P9L1F3_MCL1-02      atgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacacaagat
A0A3P9L1F3_MCL1-01      atgtcgaccgcgaaaagagtggtgaacgacgtgttagagaaacacaagat
H3AR18_MCL1-02          ctggacaccctccggcgggtcggggatagcatcatagacaaacaccgcat
H3AR18_MCL1-01          ctggacaccctccggcgggtcggggatagcatcatagacaaacaccgcat
A0A3Q2XZL8_MCL1-01      cattcgaccatgaaaagagtcgtggctaaggttttggaaaagcacaagta
A0A3B4AFB7_MCL1-01      ctatctacaatgaagggagttgtggacaagcttttggaaaagcacagata
A0A3B4AFB7_MCL1-02      ctatctacaatgaagggagttgtggacaagcttttggaaaagcacagata
A0A3B1IEV7_MCL1-01      ctgcggaccatgagccgggtggtggcgggggtcgtcctcaaacacgggat
A0A3B4CGU9_MCL1-03      cacggcacgatgagcagggtggtggagggggtgatcctcaagcacagcat
A0A3B4CGU9_MCL1-02      tcggacacgctgagcagagtggtggaggggatgctccacaaacacagtgt
W5MMB7_MCL1-01          ctggagaccctgaagcgcgtcgtggacagtgtggtggcgaagcatcagat
A0A3P8VKM5_MCL1-03      cttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagata
A0A3P8VKM5_MCL1-05      cttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagata
A0A3P8VKM5_MCL1-04      cttacgacgatgaaaagagtcgtggacgacgttttggagaaacacagata
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ggggggtcaccgttgaggatttgggacgt---------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      ctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaatt
A0A1L1RNM6_MCL1-02      ctggaaacgttgcggagggtcggggacggcgtgatgcagaaacacgaatt
H9GEA6_MCL1-02          ctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctgct
H9GEA6_MCL1-01          ctggagacgctgcgccgggtgggcgagagcctccgggagaagcacctgct
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          tgagaaacc-tgccgcgggtcgcagacggtgtgcagcgcaacgaggagac
G3WBC5_MCL1-01          ctggagaccctgcggcgcgtgggagacggtgtccagaggaaccacgagac
F6ZMX1_MCL1-03          ttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagag
F6ZMX1_MCL1-01          ttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagag
F6ZMX1_MCL1-02          ttagagaccctgcgacgcgtgggagacggtgtccagaggaaccacgagag
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          gcagcggcgtgcagcagggt--gcagcggggtgcgg------caggagac
G1PZ39_MCL1-01          ctggagaccctgcggcgggtcggggacggcgtgcagcggaaccacgagat
P97287_MCL1-01          ctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagac
Q9Z1P3_MCL1-01          ctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagac
A0A2K6F6N9_MCL1-01      -----------------------------------------------gaa
A0A2K5DMS4_MCL1-01      ctggagaccttacgaggggttggggaaggcgtgccccgcaaccacgagat
A0A286Y1M5_MCL1-01      ctggagaccctgcggcgggtcggggacggcgtgcagcgcaaccaccagac
A0A287DCH9_MCL1-02      ctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagac
A0A287DCH9_MCL1-01      ctggagaccctgcggcgggtcggcgacggagtgcagcgcaaccacgagac
G1T2Q0_MCL1-02          ctcgagaccctgcggcgggtcggggacggtgtgcagcgcaaccacgagac
G1T2Q0_MCL1-01          ctcgagaccctgcggcgggtcggggacggtgtgcagcgcaaccacgagac
G3T756_MCL1-01          ttagagaccctccggcgagtcgcggacggggtgcagcgcaaccacgagac
A0A1S3F3I1_MCL1-01      ctggagaccctgcggcgggtcggggacggggtgcagcgcaaccacgagac
A0A2K6GI15_MCL1-01      ctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccacgagac
F7AVA6_MCL1-02          ttagagaccctgcggcgggtcggggacggagtgcagcgcaatcacgagac
F7AVA6_MCL1-01          ttagagaccctgcggcgggtcggggacggagtgcagcgcaatcacgagac
A0A337S3J9_MCL1-01      ttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagac
Q7YRZ9_MCL1-01          ttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagac
A0A337S3J9_MCL1-04      ttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagac
A0A337S3J9_MCL1-03      ttagagaccctccgacgggtcggggacggcgtgcagcgcaaccacgagac
Q8HYS5_MCL1-01          ttagagaccctccagcgagtcggggacggggtacagcgcaaccacgagac
F1PAP1_MCL1-01          ttagagaccctccggcgagtcggggacggggtacagcgcaaccacgagac
F1PAP1_MCL1-02          ttagagaccctccggcgagtcggggacggggtacagcgcaaccacgagac
M3XZZ5_MCL1-01          ttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagac
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      ttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagac
A0A287BK44_MCL1-01      ttagagaccctgcgacgggtcggggacggggtgcagcgcaaccacgagac
A0A452RHX5_MCL1-01      ttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagac
G1L3L7_MCL1-02          ttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagac
G1L3L7_MCL1-01          ttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagac
W5QI41_MCL1-01          ttggagaccctgcgcagagtcggggatggggtgcagcgcaaccacgagac
F1MQX4_MCL1-01          ttggagaccctgcaccgagtcggggatggggtgcagcacaaccacgagac
A5PJR2_MCL1-01          ttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagac
A0A452GA25_MCL1-02      ttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagac
A0A452GA25_MCL1-01      ttggagaccctgcgccgagtcggggatggggtgcagcgcaaccacgagac
G2HFR3_MCL1-01          ctggatatatacccaccacctgagtgtaccattca---------------
A0A2K5EPX0_MCL1-02      ttata---ataac------------------ttaaagataaccac-----
A0A2K5EPX0_MCL1-01      ctgcatgcttttc------------------tt--------cccc-----
A0A2K5C7L5_MCL1-01      ctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagac
H0XFB7_MCL1-01          ctggagaccttgcgccgcgttggggacggggtgcagcgcaaccacgagac
A0A2K6GI15_MCL1-03      ctagagaccttacgacgtgtcggggacggtgtgcagcgcaaccacgagac
A0A2K5I9I0_MCL1-02      ctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagac
H2N5Y9_MCL1-01          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
C8YZ26_MCL1-01          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2I2YQH7_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2I2YQH7_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
B4E3L8_MCL1-01          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
B4DG83_MCL1-01          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
B4DU51_MCL1-01          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
Q07820_MCL1-04          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
B4DLY8_MCL1-01          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2I3RTV4_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagac
A0A2R9BPJ5_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagac
A0A2I3RTV4_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagac
A0A2R9BPJ5_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagac
A0A2K5I9I0_MCL1-03      ctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagac
A0A2I3GJZ3_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagac
A0A2I3GJZ3_MCL1-02      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccatgagac
A0A2K6KRW9_MCL1-02      ctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagac
A0A2K6PPI3_MCL1-02      ctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagac
A0A2K6KRW9_MCL1-01      ctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagac
A0A2K6PPI3_MCL1-03      ctggagaccttacgacgggtgggggatggcgtgcagcgcaaccacgagac
A0A2I3LFM0_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K5W0W9_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K6ECR0_MCL1-02      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
I7G687_MCL1-01          ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K5LXU8_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K5LXU8_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A0D9RZP5_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K5W0W9_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K6ECR0_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K5XSB2_MCL1-01      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K5XSB2_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2I3LFM0_MCL1-03      ctggagaccttacgacgggttggggatggcgtgcagcgcaaccacgagac
A0A2K5R5E2_MCL1-03      ctggagaccttacgacgggtgggggacggcgtgcagcgcaaccacgagac
A0A2K6V5Y3_MCL1-01      ctggagaccctgcggcgggtcggggacggcgtgcagcgcaaccacgagac
A0A2K6V5Y3_MCL1-03      ctggagaccctgcggcgggtcggggacggcgtgcagcgcaaccacgagac
A0A2K5R5E2_MCL1-04      ctggagaccttacgacgggtgggggacggcgtgcagcgcaaccacgagac
F7GTF7_MCL1-01          ctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagac
F7GTF7_MCL1-02          ctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagac
A0A2K5CFH3_MCL1-01      ctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagac
A0A2K5CFH3_MCL1-03      ctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagac
D2ITA0_MCL1-03          caagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaata
D2ITA0_MCL1-04          caagtgactatgagaagagttgtagacggcgtgcttgaaaaacaccaata
A0A3P8V8T6_MCL1-01      ttgtcaactatgaaaagagtggtaaaaggcattttagacaaacacagaca
Q4SW32_MCL1-01          ctggcgacgacgaagcgagtggtgggagacctgatggagaagcaccgata
A0A3B5PQ55_MCL1-01      ctatctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagta
A0A3B5PQ55_MCL1-02      ctatctacgatgaaaagggtggtggaggaccttttgtcgaagcacaagta
A0A3P9Q4I8_MCL1-01      ctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagata
A0A3P9Q4I8_MCL1-02      ctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagata
A0A3B3VM25_MCL1-01      ctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagata
A0A087X830_MCL1-01      ctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagata
A0A3B3YCD0_MCL1-01      ctatctacgatgaaaagggtggtggaggacgttttgtcgaagcacagata
A0A3Q3VP02_MCL1-01      ctatcaacgatgaaaagagtcgtggccgagcttttggaaaaacacagata
G3PJT0_MCL1-01          ctcaccaccatgaagagggtggtgggcgacgttttggagaagcacagata
A0A2U9CJ81_MCL1-01      ctgtccacgatgaagagagtggtggaccgactggtggagaagcacagata
A0A3Q3B4P5_MCL1-01      ttatcgacgatgaacagagtggtggaggaccttttgacaaaacacagatt
A0A3Q3B4P5_MCL1-02      ttatcgacgatgaacagagtggtggaggaccttttgacaaaacacagatt
A0A3Q3IZW0_MCL1-01      ctatcgacgatgaaaagagttgtggagggcgttttggaaaaacacagata
A0A3Q3GP42_MCL1-01      ctatcgacgatgaaaagagtcgtggaggacgtgctggcgaaacacagata
A0A3Q1GX28_MCL1-02      ctatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagata
A0A3Q1GX28_MCL1-01      ctatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagata
A0A3Q3M6G2_MCL1-01      ctgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagata
A0A3Q3M6G2_MCL1-02      ctgtcgacaatgaaacgagttgtggaagaccttttggaaaaatacagata
A0A3B4T8L9_MCL1-01      ctacaaacaatgaagagggttgtggacggcgttttggaaaaacacagata
A0A3B4T8L9_MCL1-02      ctacaaacaatgaagagggttgtggacggcgttttggaaaaacacagata
A0A3B4XKA5_MCL1-01      ctacaaacaatgaagagggttgtggaaggcgttttggaaaaacacagata
A0A3Q0R633_MCL1-01      ctaaaaacaatgaaaagagttgtggcggacgtattagaaaagcaccgata
A0A3Q0R633_MCL1-03      ctaaaaacaatgaaaagagttgtggcggacgtattagaaaagcaccgata
I3KXG5_MCL1-01          ctaaaaatgatgaaaagagttgttgcggacgtattagaaaagcacagata
I3JHR5_MCL1-03          ctaaaaacgatgaaaagagttgttgcggacgtattagaaaagcacagata
I3JHR5_MCL1-02          ctaaaaacgatgaaaagagttgttgcggacgtattagaaaagcacagata
I3JHR5_MCL1-01          ctaaaaacgatgaaaagagttgttgcggacgtattagaaaagcacagata
A0A3Q4HLQ8_MCL1-01      ctaaagacgatgaaaagagttgttgcggacgtattagaaaagcacagata
A0A3P9BVM3_MCL1-01      ctaaagacgatgaaaagagttgttgcggacgtattagaaaagcacagata
A0A3P8NP63_MCL1-02      ctaaagacgatgaaaagagttgttgcggacgtattagaaaagcacagata
A0A3P8NP63_MCL1-01      ctaaagacgatgaaaagagttgttgcggacgtattagaaaagcacagata
A0A3Q2VNL8_MCL1-01      ctaaagacgatgaaaagagttgttgcggacgtattagaaaagcacagata
A0A3B4G4Z6_MCL1-01      ctaaagacgatgaaaagagttgttgcggacgtattagaaaagcacagata
A0A3B4ZKP6_MCL1-01      ttatctacaatgaaaagagttgtggaggacgttttggaaaagcacagata
A0A3Q1EQB9_MCL1-01      ttatcaacaatgaaaagagtggtggatgacgttttggacaaacacagata
A0A3Q1EQB9_MCL1-02      ttatcaacaatgaaaagagtggtggatgacgttttggacaaacacagata
A0A3P8RQX7_MCL1-02      ttatcaacaatgaaaagagttgtggatgacgttttggacaaacacagata
A0A3P8RQX7_MCL1-01      ttatcaacaatgaaaagagttgtggatgacgttttggacaaacacagata
A0A3Q1BKL8_MCL1-01      ttatcaacaatgaaaagagttgtggatgacgttttggacaaacacagata
A0A3Q1BKL8_MCL1-02      ttatcaacaatgaaaagagttgtggatgacgttttggacaaacacagata
A0A3Q2EDX8_MCL1-01      ctgtctaccatgaaaagggtggtggaggacgttttgtcgaaacacagata
A0A3Q2P7X9_MCL1-02      ctgtctaccatgaagagggtggtggaggatctgttgtcgaagcacagata
A0A3Q2P7X9_MCL1-01      ctgtctaccatgaagagggtggtggaggatctgttgtcgaagcacagata
                                                                          

A0A3B3SG34_MCL1-01      tgcttacaatggtatgattggaaaactaagtttgaatcagcagagtgatg
A2BF68_MCL1-02          ---------aggtatgattgcacggctgaatctggagcagaaaggagaag
Q8UWD6_MCL1-01          cgcttacaaaggtatgattgcacggctgaatctggagcagaaaggagaag
A2BF68_MCL1-01          cgcttacaaaggtatgattgcacggctgaatctggagcagaaaggagaag
Q568W5_MCL1-01          cgcttacaaaggtatgattgcacggctgaatctggagcagaaaggagaag
A0A3B1K5R1_MCL1-01      tgcgtacaaaggtatgttgaacaaactgggtatggaagacagaggagatg
A0A3B4C6H5_MCL1-01      cgtctacaaaggtatgtttactaggctgggtatggaagacagaggagatg
A0A3B4C6H5_MCL1-03      cgtctacaaaggtatgtttactaggctgggtatggaagacagaggagatg
B6V6J0_MCL1-01          ggccttcacgggcatgctacaaaggttgtctatacatagcaga---gaag
Q568V1_MCL1-01          cgcatacaaaggaatgatccagcgtcttcagctggactctcagccggcct
Q1L8X3_MCL1-01          cgcatacaaaggaatgatccagcgtcttcagctggactctcagccggcct
Q9I9N3_MCL1-01          cgcatacaaaggaatgatccagcgtcttcagctggactctcagccggcct
J7H260_MCL1-01          ggcctttcagggcatgttgcagaagttatctatacaacgtcca---gaag
A0A3B3R4U0_MCL1-01      cgcgtacaatggcatgattaaaaaactagaactggataagcgtggggacg
A0A3Q2Y539_MCL1-01      cttattcaataacatggtcaacgaactgtcactggaccaaagagggctcg
Q0KFR9_MCL1-01          cgcatacaatggtatggtcgccaaacttgacttggatgaccgatgcgatg
A0A3P8Y1W8_MCL1-02      cgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatg
A0A3P8Y1W8_MCL1-01      cgcatacaagggtatgatctccaaactttgcttggatgatcaaggggatg
A0A3B3CEX1_MCL1-01      cgcctttaatggtatgatcaataggctgtctttggaagacaatttggacg
A0A3B3CEX1_MCL1-02      cgcctttaatggtatgatcaataggctgtctttggaagacaatttggacg
A0A3P9ILF6_MCL1-01      tacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatg
A0A3P9ILF6_MCL1-02      tacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatg
A0A3B3IJ04_MCL1-01      tacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatg
A0A3B3IJ04_MCL1-02      tacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatg
A0A3P9L1F3_MCL1-02      tacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatg
A0A3P9L1F3_MCL1-01      tacttacaacggtatgatcgtcagactgtcgttggacgaccagggggatg
H3AR18_MCL1-02          cgcctttaatggaatgcaacaaaagctaaacatccataaggag---gacg
H3AR18_MCL1-01          cgcctttaatggaatgcaacaaaagctaaacatccataaggag---gacg
A0A3Q2XZL8_MCL1-01      caagtacaatggtatcatcaacaaattgtctctggacgaccgaggggaca
A0A3B4AFB7_MCL1-01      cgcatataatggtatgataaacaaactggctctggacgacaggggggacg
A0A3B4AFB7_MCL1-02      cgcatataatggtatgataaacaaactggctctggacgacaggggggacg
A0A3B1IEV7_MCL1-01      cgcctacaacggtatggtccagaagctgaatttggaggagcaggacgaca
A0A3B4CGU9_MCL1-03      cgcgtacaacggtatggtccagcgattgtgtttggagcagcaagacgata
A0A3B4CGU9_MCL1-02      tgcctacagcggtatggtccagcgattgtgtttggagcagcaagacgata
W5MMB7_MCL1-01          cgcctaccacggcatgatcgcgaagctggagctggagaacaagggtgagg
A0A3P8VKM5_MCL1-03      tgcatacaatggtatgatcaacaaactttcattagaaaacagacagggtg
A0A3P8VKM5_MCL1-05      tgcatacaatggtatgatcaacaaactttcattagaaaacagacagggtg
A0A3P8VKM5_MCL1-04      tgcatacaatggtatgatcaacaaactttcattagaaaacagacagggtg
U3KKY6_MCL1-01          -----tcccaggaatgctccgaaaactggaaatccagcaagaa---gagg
A0A493U0E8_MCL1-01      ----tcccttggaatgcttcggaagctggaaatcaagaaggag---gagg
G1MPY7_MCL1-01          ----ttttcaggaatgcttcggaagctggaaatcaaaaaagaa---gaag
A0A1L1RNM6_MCL1-01      ggccttccagggaatgcttcggaagctggaaatcaaaaaggaa---gatg
A0A1L1RNM6_MCL1-02      ggccttccagggaatgcttcggaagctggaaatcaaaaaggaa---gatg
H9GEA6_MCL1-02          ggccttccaaggaatgcttagaaagttggaaataaagaaagaa---gagg
H9GEA6_MCL1-01          ggccttccaaggaatgcttagaaagttggaaataaagaaagaa---gagg
K7FPN7_MCL1-01          ----------gggatgcttcggaaactagacatcaagaatgag---gagg
G3TVG9_MCL1-01          ggtctcccaaggcatgcttcggaaaccggacttcaaaaacgaa---aatg
G3WBC5_MCL1-01          ggctttccaaggtatgcttcgcaaactggatatcaagaacgaa---gagg
F6ZMX1_MCL1-03          ggctttccaaggcatgcttcggaaattggatatcaaaaacgaa---gagg
F6ZMX1_MCL1-01          ggctttccaaggcatgcttcggaaattggatatcaaaaacgaa---gagg
F6ZMX1_MCL1-02          ggctttccaaggcatgcttcggaaattggatatcaaaaacgaa---gagg
H0XHA5_MCL1-01          ------------------------------------------a---gagg
G1QAV8_MCL1-01          tgccttcctaggtatgctt---gaactggacaccgaaaacgaa---gaca
G1PZ39_MCL1-01          ggccttccaaggtgagc---gggggccgcgcgcc----------------
P97287_MCL1-01          ggccttccagggcatgctccggaaactggacattaaaaacgaa---ggcg
Q9Z1P3_MCL1-01          ggccttccagggcatgcttcggaaactggacattaaaaacgag---gacg
A0A2K6F6N9_MCL1-01      ggccttccaaggcatgcttcagaaactggacatcaaaaacgaa---gacg
A0A2K5DMS4_MCL1-01      ggccttacaaggcatgcttcggaatctggacaacaaaaacgaa---gaca
A0A286Y1M5_MCL1-01      cgccttccaaggaatgcttcggaaactggacatcaaaaacgaa---gacg
A0A287DCH9_MCL1-02      ggccttccaaggcatgcttcggaagctggacatcaaaaacgag---gatg
A0A287DCH9_MCL1-01      ggccttccaaggcatgcttcggaagctggacatcaaaaacgag---gatg
G1T2Q0_MCL1-02          ggccttccaaggaatgcttcggaaactggacatcaaaaacgaa---gacg
G1T2Q0_MCL1-01          ggccttccaaggaatgcttcggaaactggacatcaaaaacgaa---gacg
G3T756_MCL1-01          ggccttccaaggaatgcttcggaaactggacatcaaaaacgaa---gatg
A0A1S3F3I1_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K6GI15_MCL1-01      ggccttccaa----------------------------------------
F7AVA6_MCL1-02          ggccttccaaggcatgcttcggaaactggacatcaaaaatgaa---gacg
F7AVA6_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaatgaa---gacg
A0A337S3J9_MCL1-01      cgccttccaaggcatgcttcggaaactggacatcaaaaacgaa---aacg
Q7YRZ9_MCL1-01          cgccttccaaggcatgcttcggaaactggacatcaaaaacgaa---aacg
A0A337S3J9_MCL1-04      cgccttccaaggcatgcttcggaaactggacatcaaaaacgaa---aacg
A0A337S3J9_MCL1-03      cgccttccaaggcatgcttcggaaactggacatcaaaaacgaa---aacg
Q8HYS5_MCL1-01          agccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
F1PAP1_MCL1-01          agccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
F1PAP1_MCL1-02          agccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
M3XZZ5_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
Q95KR3_MCL1-01          -gccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A287BK44_MCL1-02      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A287BK44_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A452RHX5_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
G1L3L7_MCL1-02          ggccttccaaggcatgcttcggaaactggacatcaaaaatgaa---gacg
G1L3L7_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaatgaa---gacg
W5QI41_MCL1-01          ggctttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
F1MQX4_MCL1-01          ggctttccaaggcatgcttcagaaactggacatcaaaaacgaa---gacg
A5PJR2_MCL1-01          ggctttccaaggcatgcttcggaaactggacatcaaaaatgaa---gacg
A0A452GA25_MCL1-02      ggctttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A452GA25_MCL1-01      ggctttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
G2HFR3_MCL1-01          ------------catgtt------actggacatcaaaaacgaa---gacg
A0A2K5EPX0_MCL1-02      ---------atgcatgcttcgaaaactggacatcaaaaacaaa---gacg
A0A2K5EPX0_MCL1-01      ---------aggcatgcttcgaaaactggacatcaaaaacaaa---gacg
A0A2K5C7L5_MCL1-01      ggccttccaa----------------------------------------
H0XFB7_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K6GI15_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5I9I0_MCL1-02      ggccttccaa----------------------------------------
H2N5Y9_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
C8YZ26_MCL1-01          ggccttccaaggcatgcttcggagactggacatcaaaaacgaa---gacg
A0A2I2YQH7_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2I2YQH7_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
B4E3L8_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
B4DG83_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
B4DU51_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
Q07820_MCL1-04          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
B4DLY8_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2I3RTV4_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2R9BPJ5_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2I3RTV4_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2R9BPJ5_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5I9I0_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2I3GJZ3_MCL1-01      ggccttccaa----------------------------------------
A0A2I3GJZ3_MCL1-02      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K6KRW9_MCL1-02      ggctttccaa----------------------------------------
A0A2K6PPI3_MCL1-02      ggctttccaa----------------------------------------
A0A2K6KRW9_MCL1-01      ggctttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K6PPI3_MCL1-03      ggctttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2I3LFM0_MCL1-01      ggccttccaa----------------------------------------
A0A2K5W0W9_MCL1-01      ggccttccaa----------------------------------------
A0A2K6ECR0_MCL1-02      ggccttccaa----------------------------------------
I7G687_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5LXU8_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5LXU8_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A0D9RZP5_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5W0W9_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K6ECR0_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5XSB2_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5XSB2_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2I3LFM0_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5R5E2_MCL1-03      ggccttccaa----------------------------------------
A0A2K6V5Y3_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K6V5Y3_MCL1-03      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5R5E2_MCL1-04      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
F7GTF7_MCL1-01          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
F7GTF7_MCL1-02          ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5CFH3_MCL1-01      ggccttccaaggcatgcttcggaaactggacatcaaaaacgaa---gacg
A0A2K5CFH3_MCL1-03      ggccttccaa----------------------------------------
D2ITA0_MCL1-03          cgcatacaagggtatgatccagaaattggaattggacggccgaggggaag
D2ITA0_MCL1-04          cgcatacaagggtatgatccagaaattggaattggacggccgaggggaag
A0A3P8V8T6_MCL1-01      tgcattcagtggcatgatcaacaacctctcttttgaaaacggagtatata
Q4SW32_MCL1-01          cacgtacagaggtatgatcaacaaattgttcatggaggaccgagtaggcg
A0A3B5PQ55_MCL1-01      tgcatacaatggtatggtcaataggcttgctctggataacgagccggacg
A0A3B5PQ55_MCL1-02      tgcatacaatggtatggtcaataggcttgctctggataacgagccggacg
A0A3P9Q4I8_MCL1-01      tgcatacaatggtatgctcagcaagcttgctctggataaccagccggaca
A0A3P9Q4I8_MCL1-02      tgcatacaatggtatgctcagcaagcttgctctggataaccagccggaca
A0A3B3VM25_MCL1-01      tgcatacaatggtatgctcaacaggcttgctctggataaccagccggaca
A0A087X830_MCL1-01      tgcatacaatggtatgctcaacaggcttgctctggataaccagccggaca
A0A3B3YCD0_MCL1-01      tgcatacaatggtatgctcaacaggcttgctctggataaccagccggaca
A0A3Q3VP02_MCL1-01      cgtatacaatggtatgacaaaaagactgtcattggctgacacacaggaca
G3PJT0_MCL1-01          cgtattcaatggtatggtgaacaaattgtcactggacgaccgaggcgacg
A0A2U9CJ81_MCL1-01      cgcatacaacggtatgatgaatagactgtccttggacaacagaagggacg
A0A3Q3B4P5_MCL1-01      cgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgagg
A0A3Q3B4P5_MCL1-02      cgcgtacaatggtataatcaagaaactgtctttggatgacaaaagtgagg
A0A3Q3IZW0_MCL1-01      cgcatacaaaggcatgatcaacaaactgtcactggacgagagaggggatg
A0A3Q3GP42_MCL1-01      cgcgtataatggtatgatcaacaaactgtcactggaagacagaggggacg
A0A3Q1GX28_MCL1-02      cgcgtacaatggtatgatcaacaaactctcactggatgacaaagtggacg
A0A3Q1GX28_MCL1-01      cgcgtacaatggtatgatcaacaaactctcactggatgacaaagtggacg
A0A3Q3M6G2_MCL1-01      cacatacaatggtatgatcaacaaactgtccttggacgacagaggtgatg
A0A3Q3M6G2_MCL1-02      cacatacaatggtatgatcaacaaactgtccttggacgacagaggtgatg
A0A3B4T8L9_MCL1-01      cgcatacaatggtatgatcaacaaactgtcactggacaacacaggggatg
A0A3B4T8L9_MCL1-02      cgcatacaatggtatgatcaacaaactgtcactggacaacacaggggatg
A0A3B4XKA5_MCL1-01      cgcatacaatggtatgatcaacaaactgtcactggacaacagaggggatg
A0A3Q0R633_MCL1-01      cgcatacaacggaatggtcaacaaattgtcattggatgaaagaggggagg
A0A3Q0R633_MCL1-03      cgcatacaacggaatggtcaacaaattgtcattggatgaaagaggggagg
I3KXG5_MCL1-01          tgcttacaacggaatgattaataaattgtcattggatgaaagagaagaag
I3JHR5_MCL1-03          cgcttacaacggaatgattaataaactgtcattggatgaaagacacgagg
I3JHR5_MCL1-02          cgcttacaacggaatgattaataaactgtcattggatgaaagacacgagg
I3JHR5_MCL1-01          cgcttacaacggaatgattaataaactgtcattggatgaaagacacgagg
A0A3Q4HLQ8_MCL1-01      cgcttacaacggaatgattaataaactgtcattggatgaaagagacgagg
A0A3P9BVM3_MCL1-01      cgcttacaacggaatgattaataaattgtcattggatgaaagagacgagg
A0A3P8NP63_MCL1-02      cgcttacaacggaatgattaataaattgtcattggatgaaagagacgagg
A0A3P8NP63_MCL1-01      cgcttacaacggaatgattaataaattgtcattggatgaaagagacgagg
A0A3Q2VNL8_MCL1-01      cgcttacaacggaatgattaataaattgtcattggatgaaagagacgagg
A0A3B4G4Z6_MCL1-01      cgcttacaacggaatgattaataaattgtcattggatgaaagagacgagg
A0A3B4ZKP6_MCL1-01      cgcgtacaacggtatgatcaacaaactgtcgctggatgacagaggggacg
A0A3Q1EQB9_MCL1-01      ctcatacaatggtatgatcaacaaactgtcgctggatgacataggggatg
A0A3Q1EQB9_MCL1-02      ctcatacaatggtatgatcaacaaactgtcgctggatgacataggggatg
A0A3P8RQX7_MCL1-02      cgcatacaatggtatgatcaacaaactgtcgctggatgacagaggggatg
A0A3P8RQX7_MCL1-01      cgcatacaatggtatgatcaacaaactgtcgctggatgacagaggggatg
A0A3Q1BKL8_MCL1-01      cgcatacaatggtatgatcaacaaactgtcgctggatgacagaggggatg
A0A3Q1BKL8_MCL1-02      cgcatacaatggtatgatcaacaaactgtcgctggatgacagaggggatg
A0A3Q2EDX8_MCL1-01      cgcttacaatggtatgatgaataagctttgtttagatgaagtaccggaca
A0A3Q2P7X9_MCL1-02      cgcttacaccggtatgatcaggaagctcaacctggatcagaagtcagacg
A0A3Q2P7X9_MCL1-01      cgcttacaccggtatgatcaggaagctcaacctggatcagaagtcagacg
                                                                          

A0A3B3SG34_MCL1-01      acatgaccgtaatcaaaactgtagctgagagaatattcagtgatgg----
A2BF68_MCL1-02          atgtaagtttcatcaagcaagtggcaacagagctctttagcgatgg----
Q8UWD6_MCL1-01          atgtaagtttcatcaagcaagtggcaacagagctctttagcgatgg----
A2BF68_MCL1-01          atgtaagtttcatcaagcaagtggcaacagagctctttagcgatgg----
Q568W5_MCL1-01          atgtaagtttcatcaagcaagtggcaacagagctctttagcgatgg----
A0A3B1K5R1_MCL1-01      acatgtatgtaattagggcagtagctaaggagctattcagtgatgg----
A0A3B4C6H5_MCL1-01      acatgcatataattaggacagtggctaaggagctcttcagcgatgg----
A0A3B4C6H5_MCL1-03      acatgcatataattaggacagtggctaaggagctcttcagcgatgg----
B6V6J0_MCL1-01          acttgcagaaactttctgaggttcccgctttggtctttaatgacgg----
Q568V1_MCL1-01          ctctggacttcatcagatgtatagcaagcaccatgtttaaagatgg----
Q1L8X3_MCL1-01          ctctggacttcatcagatgtatagcaagcaccatgtttaaagatgg----
Q9I9N3_MCL1-01          ctctggacttcatcagatgtatagcaagcaccatgtttaaagatgg----
J7H260_MCL1-01          atatccagaagctctccgaggtcccctctatggtcttcagcgatgg----
A0A3B3R4U0_MCL1-01      acacaagtttcgtcacgaaggtggccgaggaaatcttcagtgacaa----
A0A3Q2Y539_MCL1-01      acaggtcctttgtcagccaggtggcccaaacggaattcgccaatgg----
Q0KFR9_MCL1-01          acatgggcgtcatcaattctgtggccaagaccatgttcagtgacgg----
A0A3P8Y1W8_MCL1-02      acatgggtttcatcacgtctgtggccaagagtctgttcagtgatgg----
A0A3P8Y1W8_MCL1-01      acatgggtttcatcacgtctgtggccaagagtctgttcagtgatgg----
A0A3B3CEX1_MCL1-01      atatgtcatttattagccgcgtagcagagaacatgtttgcggaccg----
A0A3B3CEX1_MCL1-02      atatgtcatttattagccgcgtagcagagaacatgtttgcggaccg----
A0A3P9ILF6_MCL1-01      atatgtcatttgtcagcagcgtagcgaagagcctttttgcggatgg----
A0A3P9ILF6_MCL1-02      atatgtcatttgtcagcagcgtagcgaagagcctttttgcggatgg----
A0A3B3IJ04_MCL1-01      atatgtcatttgtcagcagcgtagcgaagagcctttttgcggatgg----
A0A3B3IJ04_MCL1-02      atatgtcatttgtcagcagcgtagcgaagagcctttttgcggatgg----
A0A3P9L1F3_MCL1-02      atatgtcatttgtcagcagcgtagcgaagagcctttttgcggatgg----
A0A3P9L1F3_MCL1-01      atatgtcatttgtcagcagcgtagcgaagagcctttttgcggatgg----
H3AR18_MCL1-02          acctccacattatacccgaaattggtaaccagatctttaaggacgg----
H3AR18_MCL1-01          acctccacattatacccgaaattggtaaccagatctttaaggacgg----
A0A3Q2XZL8_MCL1-01      acgtgagcttcatcagtgaagtagccaagagcctgttttcggatgg----
A0A3B4AFB7_MCL1-01      acgtatcgtttattggcacagtagccaagagtatctttgaagatgg----
A0A3B4AFB7_MCL1-02      acgtatcgtttattggcacagtagccaagagtatctttgaagatgg----
A0A3B1IEV7_MCL1-01      gtatggacattattagcagcgtagctaaggctctgtttagcgacgg----
A0A3B4CGU9_MCL1-03      gcatggagtttattagcagtgtggcgaagaccctgttcaatgatgg----
A0A3B4CGU9_MCL1-02      gcatggaatttattagcagcgtggcgaagaccctgtttgatgatgg----
W5MMB7_MCL1-01          acgtgagcttcgtgacgggcgtggccaaaagcttgttcagcgacgg----
A0A3P8VKM5_MCL1-03      atttgactttcatcagctctgttgccaaaagcctgtttggagatgg----
A0A3P8VKM5_MCL1-05      atttgactttcatcagctctgttgccaaaagcctgtttggagatgg----
A0A3P8VKM5_MCL1-04      atttgactttcatcagctctgttgccaaaagcctgtttggagatgg----
U3KKY6_MCL1-01          acctgcagtcggtggtggaggtggctgcccacgtgttcagcgatgg----
A0A493U0E8_MCL1-01      acctgcaggccgtgggtgaggtggcggcccacctcttcagcgacgg----
G1MPY7_MCL1-01          atctgcaggcggtgtgtgaggtggctgctcacgttttcagtgatgg----
A0A1L1RNM6_MCL1-01      acctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatgg----
A0A1L1RNM6_MCL1-02      acctgcaggctgtgtgtgaggtggctgctcacgttttcaatgatgg----
H9GEA6_MCL1-02          acttggcgtctgtggcagaagtgacaacagaggtcttcagagatgg----
H9GEA6_MCL1-01          acttggcgtctgtggcagaagtgacaacagaggtcttcagagatgg----
K7FPN7_MCL1-01          atctcaagtcagtgtcatcagttgcaacccatgttttcagtgatgg----
G3TVG9_MCL1-01          atgtgaaatctttgtctggagcgatggtccatgttttcagtggtgg----
G3WBC5_MCL1-01          acattaaggccgtgtctcgcgtggtaactcatgtgttcagtgacgg----
F6ZMX1_MCL1-03          atattaaagctgtgtctcgagtggcgacccatgttttcagtgacgg----
F6ZMX1_MCL1-01          atattaaagctgtgtctcgagtggcgacccatgttttcagtgacgg----
F6ZMX1_MCL1-02          atattaaagctgtgtctcgagtggcgacccatgttttcagtgacgg----
H0XHA5_MCL1-01          atatcaactctttgtctcgagtgatggcccatgttttcagttacgg----
G1QAV8_MCL1-01          acgtcaaatcttcgtctcaagcgatggttcatgcttttagggacgg----
G1PZ39_MCL1-01          ---ctctgtcttgtccgcgatcgctgg-----gctcccgtgggtggaaac
P97287_MCL1-01          atgttaaatctttttctcgagtaatggtccatgttttcaaagatgg----
Q9Z1P3_MCL1-01          atgttaaatctttttctcgagtgatgacccatgttttcaaagatgg----
A0A2K6F6N9_MCL1-01      atgtcaaatctttatcacgagtgatggtccatgttttcagtgacag----
A0A2K5DMS4_MCL1-01      atgtcaaatctttct---------------------------acgg----
A0A286Y1M5_MCL1-01      atgtcaaatccttgtcgcgagtggttgcccttgttttcagtgacgg----
A0A287DCH9_MCL1-02      atgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacgg----
A0A287DCH9_MCL1-01      atgtcaagtctctgtctcgcgtgatggtccatgttttcagtgacgg----
G1T2Q0_MCL1-02          atgtcaaatctttgtctcgagtgatggtccatgttttcagtgatgg----
G1T2Q0_MCL1-01          atgtcaaatctttgtctcgagtgatggtccatgttttcagtgatgg----
G3T756_MCL1-01          atgtcaaatctttatctcgagtaatggcccatgttttcagtgacgg----
A0A1S3F3I1_MCL1-01      acgtcaaatctttatctcgagtgatgatccatgttttcagtgacgg----
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          atgtcaaatctttgtctcgagtgatggcccacgttttcagtgacgg----
F7AVA6_MCL1-01          atgtcaaatctttgtctcgagtgatggcccacgttttcagtgacgg----
A0A337S3J9_MCL1-01      atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
Q7YRZ9_MCL1-01          atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
A0A337S3J9_MCL1-04      atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
A0A337S3J9_MCL1-03      atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
Q8HYS5_MCL1-01          atgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacgg----
F1PAP1_MCL1-01          atgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacgg----
F1PAP1_MCL1-02          atgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacgg----
M3XZZ5_MCL1-01          atgtcaaatctttgtctcgagtgatggtgcatgttttcagtgacgg----
Q95KR3_MCL1-01          atgtcaaatctttgtctcgagtgatggtccacgttttaagtgacgg----
A0A287BK44_MCL1-02      atgtcaaatctttgtctcgagtgatggtccacgttttcagtgacgg----
A0A287BK44_MCL1-01      atgtcaaatctttgtctcgagtgatggtccacgttttcagtgacgg----
A0A452RHX5_MCL1-01      atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
G1L3L7_MCL1-02          atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
G1L3L7_MCL1-01          atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
W5QI41_MCL1-01          atgtcaagtctttgtctcgagtgatggttcatgttttcagtgacgg----
F1MQX4_MCL1-01          atgttaaatctttgtctcgagtgatggttcatgttttcagtgacag----
A5PJR2_MCL1-01          atgtcaaatctttgtctcgagtgatggttcatgttttcagtgacgg----
A0A452GA25_MCL1-02      atgtcaagtctttgtctcgagtgatggttcatgttttcagtgacgg----
A0A452GA25_MCL1-01      atgtcaagtctttgtctcgagtgatggttcatgttttcagtgacgg----
G2HFR3_MCL1-01          atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2K5EPX0_MCL1-02      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5EPX0_MCL1-01      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
A0A2K6GI15_MCL1-03      atgtcaaatctttgtctcgagtgatggtccatgttttcagtgacgg----
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          atgtgaaatcgttgtctcgagtgatggtccatgttttcagcgacgg----
C8YZ26_MCL1-01          atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2I2YQH7_MCL1-01      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2I2YQH7_MCL1-03      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
B4E3L8_MCL1-01          atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacag----
B4DG83_MCL1-01          atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
B4DU51_MCL1-01          atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
Q07820_MCL1-04          atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
B4DLY8_MCL1-01          atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2I3RTV4_MCL1-01      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2R9BPJ5_MCL1-03      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2I3RTV4_MCL1-03      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2R9BPJ5_MCL1-01      atgtgaaatcgttgtctcgagtgatgatccatgttttcagcgacgg----
A0A2K5I9I0_MCL1-03      atgtcaaatctttatctcgagtgatgatccatgttttcagcgacgg----
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      atgtcaaatcgttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      atgtcaaatctttatctcgagtgatggtccatgttttcagcgacgg----
A0A2K6PPI3_MCL1-03      atgtcaaatctttatctcgagtgatggtccatgttttcagcgacgg----
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          atgtcaaatctttgtctcgagtgatggtccatgtttttagcgacgg----
A0A2K5LXU8_MCL1-01      atgtcaaatccttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5LXU8_MCL1-03      atgtcaaatccttgtctcgagtgatggtccatgttttcagcgacgg----
A0A0D9RZP5_MCL1-01      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5W0W9_MCL1-03      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K6ECR0_MCL1-03      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5XSB2_MCL1-01      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5XSB2_MCL1-03      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2I3LFM0_MCL1-03      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K6V5Y3_MCL1-03      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5R5E2_MCL1-04      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
F7GTF7_MCL1-01          atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
F7GTF7_MCL1-02          atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5CFH3_MCL1-01      atgtcaaatctttgtctcgagtgatggtccatgttttcagcgacgg----
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          acatgagttttgtcacgtctgtggccaagagtctcttcgcagacag----
D2ITA0_MCL1-04          acatgagttttgtcacgtctgtggccaagagtctcttcgcagacag----
A0A3P8V8T6_MCL1-01      atattggagttgttggggcagtggccaggagcctcttcagagatgg----
Q4SW32_MCL1-01          acgtgagctttgtcggcgccgtggctaagagcacgttcgaggacgg----
A0A3B5PQ55_MCL1-01      acatggagtttgttacggaaatagcagagagtctcttttcagacgg----
A0A3B5PQ55_MCL1-02      acatggagtttgttacggaaatagcagagagtctcttttcagacgg----
A0A3P9Q4I8_MCL1-01      atatggggtttgttacggaagtagcagagagtctcttttcagacgg----
A0A3P9Q4I8_MCL1-02      atatggggtttgttacggaagtagcagagagtctcttttcagacgg----
A0A3B3VM25_MCL1-01      atatggggtttgttacggaagtagcacagaatctcttttcagacgg----
A0A087X830_MCL1-01      atatggggtttgttacggaagtagcagagaatctcttttcagacgg----
A0A3B3YCD0_MCL1-01      atatggggtttgttacggaagtagcagagaatctcttttcagacgg----
A0A3Q3VP02_MCL1-01      atgtgagttttgtcagcactgtatccagagatctgttttcagatgg----
G3PJT0_MCL1-01          acgccagtttcgtgcgggaggtcgccacgagcctcttcgcggacgg----
A0A2U9CJ81_MCL1-01      atgtgacgtttgtcggcgccgtagccaggagcctcttcggggacgg----
A0A3Q3B4P5_MCL1-01      acatgacgtttgtaacaaaaacagcccggagccttttcgcagacgg----
A0A3Q3B4P5_MCL1-02      acatgacgtttgtaacaaaaacagcccggagccttttcgcagacgg----
A0A3Q3IZW0_MCL1-01      atatgagttttgtcggctcagtggcccagagcatcttcgctgatgg----
A0A3Q3GP42_MCL1-01      atgcaagttttgtcagcgctgtggcaaagagcctttttgcggatgg----
A0A3Q1GX28_MCL1-02      atgtgagttttatcacggcagtagcccagagccttttctcagatgg----
A0A3Q1GX28_MCL1-01      atgtgagttttatcacggcagtagcccagagccttttctcagatgg----
A0A3Q3M6G2_MCL1-01      atgtgagattcgtcagcactgtagccaagagcctgtttgctgatgg----
A0A3Q3M6G2_MCL1-02      atgtgagattcgtcagcactgtagccaagagcctgtttgctgatgg----
A0A3B4T8L9_MCL1-01      atgtgaggtttgtcggtgcagtagcgaagagcctgttcgcagatgg----
A0A3B4T8L9_MCL1-02      atgtgaggtttgtcggtgcagtagcgaagagcctgttcgcagatgg----
A0A3B4XKA5_MCL1-01      atgtgaggtttgtcggtgcagtagcgaagagcctgttcgcagatgg----
A0A3Q0R633_MCL1-01      acgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaa----
A0A3Q0R633_MCL1-03      acgtgacatttgtgagcgcggtagccaagagcctgtttgcagacaa----
I3KXG5_MCL1-01          atatgtcatt---------tgtagcgaagagcctctttggagacca----
I3JHR5_MCL1-03          atatgtcatttgtcggtgctgtagcgaagagcctctttgcagacca----
I3JHR5_MCL1-02          atatgtcatttgtcggtgctgtagcgaagagcctctttgcagacca----
I3JHR5_MCL1-01          atatgtcatttgtcggtgctgtagcgaagagcctctttgcagacca----
A0A3Q4HLQ8_MCL1-01      atatgtcatttgtcggtgctgtagcgaagagcctctttggagacca----
A0A3P9BVM3_MCL1-01      atatgtcttttgtcggtgctgtagcgaagagcctctttggagacca----
A0A3P8NP63_MCL1-02      atatgtcatttgtcggtgctgtagcgaagagcctctttggagacca----
A0A3P8NP63_MCL1-01      atatgtcatttgtcggtgctgtagcgaagagcctctttggagacca----
A0A3Q2VNL8_MCL1-01      atatgtcatttgtcggtgctgtagcgaagagcctctttggagacca----
A0A3B4G4Z6_MCL1-01      atatgtcatttgtcggtgctgtagcgaagagcctctttggagacca----
A0A3B4ZKP6_MCL1-01      atgtgtcgtttgtcagtgccgtagccaagagcctcttcgcagacag----
A0A3Q1EQB9_MCL1-01      atgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacag----
A0A3Q1EQB9_MCL1-02      atgtgtcgtttgtcagtgcagtagctaagagcctgtttgcagacag----
A0A3P8RQX7_MCL1-02      atgtgtcgtttgtcagtgcagtagccaagagcctctttgcagacag----
A0A3P8RQX7_MCL1-01      atgtgtcgtttgtcagtgcagtagccaagagcctctttgcagacag----
A0A3Q1BKL8_MCL1-01      atgtgtcgtttgtcagtgcagtagctaagagcctctttgcagacag----
A0A3Q1BKL8_MCL1-02      atgtgtcgtttgtcagtgcagtagctaagagcctctttgcagacag----
A0A3Q2EDX8_MCL1-01      acatgggatttgtgagttcagtcgccacgagcctcttttcagacgg----
A0A3Q2P7X9_MCL1-02      acatggggttcgtgacatcggttgcggtcagccttttctcggacgg----
A0A3Q2P7X9_MCL1-01      acatggggttcgtgacatcggttgcggtcagccttttctcggacgg----
                                                                          

A0A3B3SG34_MCL1-01      aaccacaaactgggggcgtattgccagccttgtggcctttggggcagagg
A2BF68_MCL1-02          caccacaaactggggtcgtattgccagcctgctgacatttggggcaatgc
Q8UWD6_MCL1-01          caccacaaactggggtcgtattgccagcctgctgacatttggggcaatgc
A2BF68_MCL1-01          caccacaaactggggtcgtattgccagcctgctgacatttggggcaatgc
Q568W5_MCL1-01          caccacaaactggggtcgtattgccagcctgctgacatttggggcaatgc
A0A3B1K5R1_MCL1-01      catcaccaactggggcagggtcgccagcctggtggcctttggagcagtgg
A0A3B4C6H5_MCL1-01      catcaccaactggggtcgaatcgccagcctgctggcctttggtgcagtgg
A0A3B4C6H5_MCL1-03      catcaccaactggggtcgaatcgccagcctgctggcctttggtgcagtgg
B6V6J0_MCL1-01          agttacaaattggggccgcattgttacggtcataagctttggcgcgtttg
Q568V1_MCL1-01          cgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtgg
Q1L8X3_MCL1-01          cgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtgg
Q9I9N3_MCL1-01          cgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtgg
J7H260_MCL1-01          ggttaccaattggggccgtatcgtcaccgtgataagctttggtgcgtttg
A0A3B3R4U0_MCL1-01      ggtcaccaactggggtcgcatcgccagcctgatagcgtttgggggtgtcg
A0A3Q2Y539_MCL1-01      gaacattaactggggtcgcatcgccagcctgttggccttctgtgccgtgc
Q0KFR9_MCL1-01          gatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtgg
A0A3P8Y1W8_MCL1-02      gactacaaactggggtcgcattgccagcttggtgggctttggggcagtag
A0A3P8Y1W8_MCL1-01      gactacaaactggggtcgcattgccagcttggtgggctttggggcagtag
A0A3B3CEX1_MCL1-01      gaccaccaactggggccgcatcgccagcctgctggccttcggggcggcgg
A0A3B3CEX1_MCL1-02      gaccaccaactggggccgcatcgccagcctgctggccttcggggcggcgg
A0A3P9ILF6_MCL1-01      gaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcgg
A0A3P9ILF6_MCL1-02      gaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcgg
A0A3B3IJ04_MCL1-01      gaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcgg
A0A3B3IJ04_MCL1-02      gaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcgg
A0A3P9L1F3_MCL1-02      gaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcgg
A0A3P9L1F3_MCL1-01      gaccaccaactggggccgcatcgtcagcctgctggccttcggggcggcgg
H3AR18_MCL1-02          tgcaacaaactggggtcgcattgttagtcttattgcttttggagcagtcg
H3AR18_MCL1-01          tgcaacaaactggggtcgcattgttagtcttattgcttttggagcagtcg
A0A3Q2XZL8_MCL1-01      gacaaccaactgggggcgcgtggccagcttggtggcctttggggccattg
A0A3B4AFB7_MCL1-01      taccactaactggggtcgtattgccagccttatagcctttggggctgtgg
A0A3B4AFB7_MCL1-02      taccactaactggggtcgtattgccagccttatagcctttggggctgtgg
A0A3B1IEV7_MCL1-01      aaccacgaactgggggcggatcgttagcctggtggcgttcggcgcggtgg
A0A3B4CGU9_MCL1-03      gaccaccaactgggggcggattgccagtctggtggcgtttggtgcggtgg
A0A3B4CGU9_MCL1-02      gatcaccaactgggggcggattgccagtctggtggcgttgggtgcggtgg
W5MMB7_MCL1-01          gaagaccaactggggccgcatcgccagcctggtgtcgttcggcgcggtgg
A0A3P8VKM5_MCL1-03      taccacaaactggggtcggatcaccagcctggtggcctttggggcagttg
A0A3P8VKM5_MCL1-05      taccacaaactggggtcggatcaccagcctggtggcctttggggcagttg
A0A3P8VKM5_MCL1-04      taccacaaactggggtcggatcaccagcctggtggcctttggggcagttg
U3KKY6_MCL1-01          ggtgaccaactggggacgtgtggtgaccctcattgcctttggagccttcg
A0A493U0E8_MCL1-01      ggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcg
G1MPY7_MCL1-01          agtaacaaactggggccgagttgtcacactcatctcatttggtgccttcg
A0A1L1RNM6_MCL1-01      agtaacaaactggggccgagttgtcacgctcatctcatttggtgcctttg
A0A1L1RNM6_MCL1-02      agtaacaaactggggccgagttgtcacgctcatctcatttggtgcctttg
H9GEA6_MCL1-02          cataataaactggggccgcattgtgactctcatctcttttggtgcctttg
H9GEA6_MCL1-01          cataataaactggggccgcattgtgactctcatctcttttggtgcctttg
K7FPN7_MCL1-01          aataacaaactggggtagaattgtaacactcatctcttttggtgcctttg
G3TVG9_MCL1-01          aataacaaaatggggcagaattgtgact---atatcttttggtgcctttg
G3WBC5_MCL1-01          ggtgacgaattggggcagaattgtgactctcatttctttcggggcctttg
F6ZMX1_MCL1-03          tataacaaactggggcaggattgtgactctcatttctttcggtgcctttg
F6ZMX1_MCL1-01          tataacaaactggggcaggattgtgactctcatttctttcggtgcctttg
F6ZMX1_MCL1-02          tataacaaactggggcaggattgtgactctcatttctttcggtgcctttg
H0XHA5_MCL1-01          cgtaacaaattggggcaggattatgaccctaat---ttttggtggctttg
G1QAV8_MCL1-01          agtgacaaac---ggcaggattgtgactc--atttcttttggtgcctttg
G1PZ39_MCL1-01          cgagacgagcccgggctggaagggctctccgcccgtttccgaaacc----
P97287_MCL1-01          cgtaacaaactggggcaggattgtgactcttatttctttcggtgcctttg
Q9Z1P3_MCL1-01          cgtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A2K6F6N9_MCL1-01      cgtaacaaactggggcaggattgtgactttaatttctttttgtgcctttg
A0A2K5DMS4_MCL1-01      cgtaacaaactggggtaggattgtgactctcagttcttttggtgcctttg
A0A286Y1M5_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A287DCH9_MCL1-02      agtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A287DCH9_MCL1-01      agtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
G1T2Q0_MCL1-02          cgtaacaaactggggcaggattgtgactctgatttctttcggtgcctttg
G1T2Q0_MCL1-01          cgtaacaaactggggcaggattgtgactctgatttctttcggtgcctttg
G3T756_MCL1-01          gataacaaactggggcagaattgtgactctcatatcttttggtgcctttg
A0A1S3F3I1_MCL1-01      cgtaacaaactggggtaggattgtgactctaatttctttcggtgcctttg
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          agtgacaaactggggcaggattgtgactcttatttcttttggtgcctttg
F7AVA6_MCL1-01          agtgacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A337S3J9_MCL1-01      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
Q7YRZ9_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A337S3J9_MCL1-04      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A337S3J9_MCL1-03      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
Q8HYS5_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcctttggtgcctttg
F1PAP1_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcctttggtgcctttg
F1PAP1_MCL1-02          agtaacaaactggggcaggattgtgactcttatttcctttggtgcctttg
M3XZZ5_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
Q95KR3_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A287BK44_MCL1-02      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A287BK44_MCL1-01      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A452RHX5_MCL1-01      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
G1L3L7_MCL1-02          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
G1L3L7_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
W5QI41_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
F1MQX4_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A5PJR2_MCL1-01          agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A452GA25_MCL1-02      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
A0A452GA25_MCL1-01      agtaacaaactggggcaggattgtgactcttatttcttttggtgcctttg
G2HFR3_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5EPX0_MCL1-02      cgtaacaaactggggtaggatcgtgactctcatttcttttggtgcctttg
A0A2K5EPX0_MCL1-01      cgtaacaaactggggtaggatcgtgactctcatttcttttggtgcctttg
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          cgtaacaaactggggcaggattgtgactctaatttcttttggtgcctttg
A0A2K6GI15_MCL1-03      cgtaacaaactggggcaggattgtgactctaatttcttttggtgcctttg
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
C8YZ26_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2I2YQH7_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2I2YQH7_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
B4E3L8_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
B4DG83_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
B4DU51_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
Q07820_MCL1-04          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
B4DLY8_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2I3RTV4_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2R9BPJ5_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2I3RTV4_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2R9BPJ5_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5I9I0_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K6PPI3_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5LXU8_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5LXU8_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A0D9RZP5_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5W0W9_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K6ECR0_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5XSB2_MCL1-01      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5XSB2_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2I3LFM0_MCL1-03      cgtaacaaactggggcaggattgtgactctcatttcttttggtgcctttg
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      cgtaacaaactggggtaggattgtgactctcatttcttttggtgcctttg
A0A2K6V5Y3_MCL1-03      cgtaacaaactggggtaggattgtgactctcatttcttttggtgcctttg
A0A2K5R5E2_MCL1-04      cgtaacaaactggggtaggattgtgactctcatttattttggtgcctttg
F7GTF7_MCL1-01          cgtaacaaactggggtaggattgtgactctcatttcttttggtgcctttg
F7GTF7_MCL1-02          cgtaacaaactggggtaggattgtgactctcatttcttttggtgcctttg
A0A2K5CFH3_MCL1-01      cgtaacaaactggggtaggattgtgactctcatttcttttggtgcctttg
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          cacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcgt
D2ITA0_MCL1-04          cacaacaaactgggggcgtatcgccagcctggtggccttcggagcagcgt
A0A3P8V8T6_MCL1-01      cacctccaactggggtcgaatagttagcctggttgcatttggggcagtgc
Q4SW32_MCL1-01          gaacaccaactggggtcgcgtggccagcctgctggccttcgcagccgtgg
A0A3B5PQ55_MCL1-01      gatcaccaactggggtcggatcgccagcctggtgacgttcggggctgcgg
A0A3B5PQ55_MCL1-02      gatcaccaactggggtcggatcgccagcctggtgacgttcggggctgcgg
A0A3P9Q4I8_MCL1-01      gaccaccaactggggtcggatcgtcagcctggtggcgttcggggctgtag
A0A3P9Q4I8_MCL1-02      gaccaccaactggggtcggatcgtcagcctggtggcgttcggggctgtag
A0A3B3VM25_MCL1-01      gaccaccaactggggtcggatcgtcagcctggtggcgttcggggctgcag
A0A087X830_MCL1-01      gaccaccaactggggtcggatcgtcagcctggtggcgttcggggctgcag
A0A3B3YCD0_MCL1-01      gaccaccaactggggtcggatcgtcagcctggtggcgttcggggctgcag
A0A3Q3VP02_MCL1-01      agcaacgaactggggccgtattgccagcctggttgcctttggggtcgtgg
G3PJT0_MCL1-01          caccacgaactggggccgcatcgccagcctggtggccttcggggcggtgg
A0A2U9CJ81_MCL1-01      caacacaaactggggccgcgtctccagcctggtggcgttcggggccgtgg
A0A3Q3B4P5_MCL1-01      gatcaccaactggggtcggatctccagcctggtggcctttggcgcagtgg
A0A3Q3B4P5_MCL1-02      gatcaccaactggggtcggatctccagcctggtggcctttggcgcagtgg
A0A3Q3IZW0_MCL1-01      gaccaccaactgggggcggattaccagccttttggcctttggtgcagtgg
A0A3Q3GP42_MCL1-01      aacaacaaactggggcaggatcgccagcctggtcgcttttggagcggctg
A0A3Q1GX28_MCL1-02      aaccacaaactggggtcgtatcgccagcctggtggcctttggggcagcag
A0A3Q1GX28_MCL1-01      aaccacaaactggggtcgtatcgccagcctggtggcctttggggcagcag
A0A3Q3M6G2_MCL1-01      gaccaccaactggggtcggatcgccagcctggtggccttcggggccgtgg
A0A3Q3M6G2_MCL1-02      gaccaccaactggggtcggatcgccagcctggtggccttcggggccgtgg
A0A3B4T8L9_MCL1-01      caccacaaactggggtcgcatcgccagcctggtggccttcggggcggtgg
A0A3B4T8L9_MCL1-02      caccacaaactggggtcgcatcgccagcctggtggccttcggggcggtgg
A0A3B4XKA5_MCL1-01      caccacaaactggggtcgcatcgccagcctggtggccttcggggtggtgg
A0A3Q0R633_MCL1-01      aaccaccaactggggtcgtattgccagtctgatggcctttggggcagtgg
A0A3Q0R633_MCL1-03      aaccaccaactggggtcgtattgccagtctgatggcctttggggcagtgg
I3KXG5_MCL1-01          cacgaccaactggggtcgtattgtcagctttgtggccttcggggcagtgg
I3JHR5_MCL1-03          cacgaccaactggggtcgtattgtcagctttgtggccttcggagcagtgg
I3JHR5_MCL1-02          cacgaccaactggggtcgtattgtcagctttgtggccttcggagcagtgg
I3JHR5_MCL1-01          cacgaccaactggggtcgtattgtcagctttgtggccttcggagcagtgg
A0A3Q4HLQ8_MCL1-01      cacgaccaactggggtcgtgttgtcagctttgtggccttcggggcagtgg
A0A3P9BVM3_MCL1-01      cacgaccaactggggtcgtattgtcagctttatggccttcggggcagtgg
A0A3P8NP63_MCL1-02      cacgaccaactggggtcgtattgtcagctttatggccttcggggcagtgg
A0A3P8NP63_MCL1-01      cacgaccaactggggtcgtattgtcagctttatggccttcggggcagtgg
A0A3Q2VNL8_MCL1-01      cacgaccaactggggtcgtattgtcagctttatggccttcggggcagtgg
A0A3B4G4Z6_MCL1-01      cacgaccaactggggtcgtattgtcagctttatggccttcggggcagtgg
A0A3B4ZKP6_MCL1-01      gaccaccaactggggtcgcatcaccagcctggtggccttcggggcagtgg
A0A3Q1EQB9_MCL1-01      gacaaccaactggggtcgtattacgagcctggtggccttcggggcggtgg
A0A3Q1EQB9_MCL1-02      gacaaccaactggggtcgtattacgagcctggtggccttcggggcggtgg
A0A3P8RQX7_MCL1-02      gacgaccaactggggtcgtattacgagcctggtggcctttggggcggtgg
A0A3P8RQX7_MCL1-01      gacgaccaactggggtcgtattacgagcctggtggcctttggggcggtgg
A0A3Q1BKL8_MCL1-01      gacgaccaactggggtcgtattacgagcctggtggcctttggggcggtgg
A0A3Q1BKL8_MCL1-02      gacgaccaactggggtcgtattacgagcctggtggcctttggggcggtgg
A0A3Q2EDX8_MCL1-01      aaccacgaattggggccggatagtgagcctggtggccttcggggctgtgg
A0A3Q2P7X9_MCL1-02      aaccaccaactggggtcgtatcgccagcctggtggccttcggggcggtgc
A0A3Q2P7X9_MCL1-01      aaccaccaactggggtcgtatcgccagcctggtggccttcggggcggtgc
                                                                          

A0A3B3SG34_MCL1-01      tgtgtaaatacctgaaggagactgggcgggagcactgc---gtggaggct
A2BF68_MCL1-02          tgtgcaaataccagaatgacagaggacatagcaagtat---gtgaggttg
Q8UWD6_MCL1-01          tgtgcaaataccagaatgacagaggacatagcaagtat---gtgaggttg
A2BF68_MCL1-01          tgtgcaaataccagaatgacagaggacatagcaagtat---gtgaggttg
Q568W5_MCL1-01          tgtgcaaataccagaatgacagaggacatagcaagtat---gtgaggttg
A0A3B1K5R1_MCL1-01      tgtccaagcatcagcatgacatgggccgaggccactgt---gtgagtcta
A0A3B4C6H5_MCL1-01      tgtgccagcaccagaaccaaatgggccgaggtcactgc---gtgagtctt
A0A3B4C6H5_MCL1-03      tgtgccagcaccagaaccaaatgggccgaggtcactgc---gtgagtctt
B6V6J0_MCL1-01          ttgcaaagcatctaaagagcttaaaccttgaagactgc---atcggagtt
Q568V1_MCL1-01          tttgctctcgattgaaggagctccagcaggatcagtgt---gtggagaga
Q1L8X3_MCL1-01          tttgctctcgattgaaggagctccagcaggatcagtgt---gtggagagg
Q9I9N3_MCL1-01          tttgctctcgattgaaggagctccagcaggatcagtgt---gtggagagg
J7H260_MCL1-01          tggctaaacatttgaaaagcatccacatggagaactgc---gttggaatc
A0A3B3R4U0_MCL1-01      tgtgcaagtacctgaaagatcacggacagaccaactgc---gtggatgat
A0A3Q2Y539_MCL1-01      tgtctcaagccttgaaagaaaatcagcaggagaggtgc---gtggaactg
Q0KFR9_MCL1-01          tgagccagcacctgaaggagaggggcaggggacactgc---gttgagttg
A0A3P8Y1W8_MCL1-02      tgagtcaacacctgaaggagatgggcaagggaaactgc---gttgagttg
A0A3P8Y1W8_MCL1-01      tgagtcaacacctgaaggagatgggcaagggaaactgc---gttgagttg
A0A3B3CEX1_MCL1-01      tgtgtctgcagctgaaggagaagggcagaggtcactcc---gtggacctg
A0A3B3CEX1_MCL1-02      tgtgtctgcagctgaaggagaagggcagaggtcactcc---gtggacctg
A0A3P9ILF6_MCL1-01      tgtgtcagtccttgaaggaaaagggcagaggtcactgc---gtggacctg
A0A3P9ILF6_MCL1-02      tgtgtcagtccttgaaggaaaagggcagaggtcactgc---gtggacctg
A0A3B3IJ04_MCL1-01      tgtgtcagtccttgaaggaaaagggcagaggtcactgc---gtggacctg
A0A3B3IJ04_MCL1-02      tgtgtcagtccttgaaggaaaagggcagaggtcactgc---gtggacctg
A0A3P9L1F3_MCL1-02      tgtgtcagtccttgaaggaaaagggcagaggtcactgc---gtggacctg
A0A3P9L1F3_MCL1-01      tgtgtcagtccttgaaggaaaagggcagaggtcactgc---gtggacctg
H3AR18_MCL1-02          ttgccaagaagctcaaaaagatgaacctggaagacagc---attgaacag
H3AR18_MCL1-01          ttgccaagaagctcaaaaagatgaacctggaagacagc---attgaacag
A0A3Q2XZL8_MCL1-01      tgtcccagcacctgaaagaaaagggccgggcccactgt---gtggagccg
A0A3B4AFB7_MCL1-01      tgtgccagtacctcaagacaaaaggaagagaaagctgt---gtggagcga
A0A3B4AFB7_MCL1-02      tgtgccagtacctcaagacaaaaggaagagaaagctgt---gtggagcga
A0A3B1IEV7_MCL1-01      tgtgtgatcatctgaagaagaagagtcgagatcactgc---gtggagaac
A0A3B4CGU9_MCL1-03      tctgtgagcagatgaaggaagcaggcagagagcagtgt---gtggagaac
A0A3B4CGU9_MCL1-02      tctgtgagtggctgaaggaggtgggcagagagcagtgt---gtggagaac
W5MMB7_MCL1-01          tggccaagcagatgaaggactcgggccgggagagctgc---gtggaggcg
A0A3P8VKM5_MCL1-03      tgtgtcagcacctaaaggagtgtggtcaagagaactca---acagagcta
A0A3P8VKM5_MCL1-05      tgtgtcagcacctaaaggagtgtggtcaagagaactca---acagagcta
A0A3P8VKM5_MCL1-04      tgtgtcagcacctaaaggagtgtggtcaagagaactca---acagagcta
U3KKY6_MCL1-01          tggccaagcacctgaagagcatcaagcaggagcagagc---atcacttcc
A0A493U0E8_MCL1-01      tcgcccggcacctgaaaagcgtaaagcaggagaaaagc---atcggctcc
G1MPY7_MCL1-01          ttgcaaaacacctgaaaagcatcaaccaagagaaatgc---atcagctcg
A0A1L1RNM6_MCL1-01      ttgcaaaacacctgaaaagcatcaaccaagagaaatgc---atcacctcg
A0A1L1RNM6_MCL1-02      ttgcaaaacacctgaaaagcatcaaccaagagaaatgc---atcacctcg
H9GEA6_MCL1-02          ttgccaaacacctgaagagcataaaccaagagaatgct---atcaacact
H9GEA6_MCL1-01          ttgccaaacacctgaagagcataaaccaagagaatgct---atcaacact
K7FPN7_MCL1-01          ttgcaaaacacctgaagagcataaaccaggagaattgc---atcaacacg
G3TVG9_MCL1-01          tggtcaaacacttcgggagcataaaccaagaa-gctgc------------
G3WBC5_MCL1-01          tggcaaagcacttgaagagcataaaccaggaaagttgc---atagacccg
F6ZMX1_MCL1-03          tggcaaagcacttgaagagcataaaccaggaaagttgc---atagacccg
F6ZMX1_MCL1-01          tggcaaagcacttgaagagcataaaccaggaaagttgc---atagacccg
F6ZMX1_MCL1-02          tggcaaagcacttgaagagcataaaccaggaaagttgc---atagacccg
H0XHA5_MCL1-01          tggccaagcacctgaagaccataaaccaagaaggctac---atcaaaccg
G1QAV8_MCL1-01          tagc----cacttgaagagcataaaccaagaaagctgc---attgaaccg
G1PZ39_MCL1-01          ------agcatattctggccatgagtcattgtttccgcccacccgattcc
P97287_MCL1-01          tggccaaacacttaaagagcgtaaaccaagaaagcttc---atcgaacca
Q9Z1P3_MCL1-01          tggccaaacacttaaagagcataaaccaagaaagctgc---atcgaacct
A0A2K6F6N9_MCL1-01      tgtccaaacacttgaagaccataaaccaagagagctgc---atcgaacca
A0A2K5DMS4_MCL1-01      tggccaaacacttgaagaccataaaccaagaaagttgc---atcgaacca
A0A286Y1M5_MCL1-01      tggccaaacacttgaagagcataaaccaagaaagctgc---atcgaacca
A0A287DCH9_MCL1-02      tggccaaacacttgaagagcataaaccaagaaagctgc---attgaaccc
A0A287DCH9_MCL1-01      tggccaaacacttgaagagcataaaccaagaaagctgc---attgaaccc
G1T2Q0_MCL1-02          tggccaaacacttgaagagcataaaccaagaaagctgc---atagaacct
G1T2Q0_MCL1-01          tggccaaacacttgaagagcataaaccaagaaagctgc---atagaacct
G3T756_MCL1-01          tggccaaacacttgaagagcgtaaaccaagaaagccgc---atcgaacca
A0A1S3F3I1_MCL1-01      tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
F7AVA6_MCL1-01          tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
A0A337S3J9_MCL1-01      tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
Q7YRZ9_MCL1-01          tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
A0A337S3J9_MCL1-04      tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
A0A337S3J9_MCL1-03      tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
Q8HYS5_MCL1-01          tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
F1PAP1_MCL1-01          tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
F1PAP1_MCL1-02          tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
M3XZZ5_MCL1-01          tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
Q95KR3_MCL1-01          tggccaaacacttgaagagtataaatcaagaaagctgc---atcgaaccg
A0A287BK44_MCL1-02      tggccaaacacttgaagagtataaatcaagaaagctgc---atcgaaccg
A0A287BK44_MCL1-01      tggccaaacacttgaagagtataaatcaagaaagctgc---atcgaaccg
A0A452RHX5_MCL1-01      tggccaaacacttgaagagtataaaccaagaaagctgc---atcgaacca
G1L3L7_MCL1-02          tggccaaacacttgaagagtataaaccaagaaggctgc---atcgaacca
G1L3L7_MCL1-01          tggccaaacacttgaagagtataaaccaagaaggctgc---atcgaacca
W5QI41_MCL1-01          tggccaaacacttgaagagtataaatcaagaaagctgc---atcgaacca
F1MQX4_MCL1-01          tggccaaacactttaagagtataaatcaagaaagctgc---atcgaacca
A5PJR2_MCL1-01          tggccaaacacttgaagagtataaatcaagaaagctgc---atcgaacca
A0A452GA25_MCL1-02      tggccaaacacttgaagagtataaatcaagaaagctgc---atcgaacca
A0A452GA25_MCL1-01      tggccaaacacttgaagagtataaatcaagaaagctgc---atcgaacca
G2HFR3_MCL1-01          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5EPX0_MCL1-02      tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
A0A2K5EPX0_MCL1-01      tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          tggccaaacacttgaagagcataaaccaagaaagctgc---atcgaacca
A0A2K6GI15_MCL1-03      tggccaaacacttgaagagcataaaccaagaaagctgc---atcgaacca
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
C8YZ26_MCL1-01          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2I2YQH7_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2I2YQH7_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
B4E3L8_MCL1-01          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
B4DG83_MCL1-01          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
B4DU51_MCL1-01          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
Q07820_MCL1-04          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
B4DLY8_MCL1-01          tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2I3RTV4_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2R9BPJ5_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2I3RTV4_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2R9BPJ5_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5I9I0_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagttgc---atcgaacca
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagttgc---atcgaacca
A0A2K6PPI3_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagttgc---atcgaacca
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          tggcgaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5LXU8_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5LXU8_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A0D9RZP5_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5W0W9_MCL1-03      tggcgaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K6ECR0_MCL1-03      tggcgaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5XSB2_MCL1-01      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5XSB2_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2I3LFM0_MCL1-03      tggctaaacacttgaagaccataaaccaagaaagctgc---atcgaacca
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
A0A2K6V5Y3_MCL1-03      tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
A0A2K5R5E2_MCL1-04      tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
F7GTF7_MCL1-01          tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
F7GTF7_MCL1-02          tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
A0A2K5CFH3_MCL1-01      tggccaaacacttgaagaccataaaccaagaaagctgc---attgaacca
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          tgtgtcagtacctagaggccaggggtaaagaaggctgc---gtgtcgctg
D2ITA0_MCL1-04          tgtgtcagtacctagaggccaggggtaaagaaggctgc---gtgtcgctg
A0A3P8V8T6_MCL1-01      tttgtcagcacctaaaggagaaaggctgggagaacacg---gtggaccag
Q4SW32_MCL1-01          tggcccagtacttgaacgaccacggtcagagggactgc---gtggagcag
A0A3B5PQ55_MCL1-01      tgtgtcagcgcctgaaggagaggggcagagagcactgc---gtggagctg
A0A3B5PQ55_MCL1-02      tgtgtcagcgcctgaaggagaggggcagagagcactgc---gtggagctg
A0A3P9Q4I8_MCL1-01      tgtgtcagcacctgaaggagaggggcagagagcactgc---gtggatctg
A0A3P9Q4I8_MCL1-02      tgtgtcagcacctgaaggagaggggcagagagcactgc---gtggatctg
A0A3B3VM25_MCL1-01      tgtgtcagcacctgaaggaaaggggcagagagcattgc---gtggagctg
A0A087X830_MCL1-01      tgtgtcagcacctgaaggagaggggcagagagcattgc---gtggagctg
A0A3B3YCD0_MCL1-01      tgtgtcagcacctgaaggagaggggcagagagcattgc---gtggagctg
A0A3Q3VP02_MCL1-01      tgtcccagtgcctgaaggagaacggcaagagtgaccgt---gtggagctg
G3PJT0_MCL1-01          tgtgccaacacctggcggagcgaggccgggggaactgc---gtggagctg
A0A2U9CJ81_MCL1-01      tgagtcagcacctgaaggagacgggcagggggaactgc---gtggagctc
A0A3Q3B4P5_MCL1-01      tggcggtgcacctgaaggagaaggggagggaggaatgc---gtggagctg
A0A3Q3B4P5_MCL1-02      tggcggtgcacctgaaggagaaggggagggaggaatgc---gtggagctg
A0A3Q3IZW0_MCL1-01      tgtgtcagtacctgaaggagaaaggcagggagaactgt---gtggagttg
A0A3Q3GP42_MCL1-01      tgtcacaatacctgaaggagaatggcagggggcactgt---gtggagctg
A0A3Q1GX28_MCL1-02      tgtgtcagcacctgaaggaaaaacacagggagaactgt---gtggatctg
A0A3Q1GX28_MCL1-01      tgtgtcagcacctgaaggaaaaacacagggagaactgt---gtggatctg
A0A3Q3M6G2_MCL1-01      tgtgtcagtacctgaaggagaaaggcaggggggactgt---gtggagctg
A0A3Q3M6G2_MCL1-02      tgtgtcagtacctgaaggagaaaggcaggggggactgt---gtggagctg
A0A3B4T8L9_MCL1-01      tgtgtcagcgcatgaaggagacaggcagggagaactgt---gtggaatct
A0A3B4T8L9_MCL1-02      tgtgtcagcgcatgaaggagacaggcagggagaactgt---gtggaatct
A0A3B4XKA5_MCL1-01      tgtgtcagcacatgaaggacacaggcagggagaactgt---gtggaatct
A0A3Q0R633_MCL1-01      tgtgtcagcgcttgaaggaaaaaggcagggacaattgt---gtggagctg
A0A3Q0R633_MCL1-03      tgtgtcagcgcttgaaggaaaaaggcagggacaattgt---gtggagctg
I3KXG5_MCL1-01          tgtctcagcacctgaaggaaaagggcagggacaactgc---gtggtgcta
I3JHR5_MCL1-03          tgtctcagcacctgaaggaaaagggcagagacaactgc---gtggcgcta
I3JHR5_MCL1-02          tgtctcagcacctgaaggaaaagggcagagacaactgc---gtggcgcta
I3JHR5_MCL1-01          tgtctcagcacctgaaggaaaagggcagagacaactgc---gtggcgcta
A0A3Q4HLQ8_MCL1-01      tctctcagcacctgaaggaaaagggcagggacaactgc---gtggcgcta
A0A3P9BVM3_MCL1-01      tctctcagcacctgaaggaaaagggcagggacaattac---gtggcgcta
A0A3P8NP63_MCL1-02      tctctcagcacctgaaggaaaagggcagggacaactac---gtggcgcta
A0A3P8NP63_MCL1-01      tctctcagcacctgaaggaaaagggcagggacaactac---gtggcgcta
A0A3Q2VNL8_MCL1-01      tctctcagcacctgaaggaaaagggcagggacaactac---gtggcgcta
A0A3B4G4Z6_MCL1-01      tctctcagcacctgaaggaaaagggcagggacaactac---gtggcgcta
A0A3B4ZKP6_MCL1-01      tgtgccagtacctgaaggagaggggcagggagaactgc---gtcgacctg
A0A3Q1EQB9_MCL1-01      tttgtcagtacttaaaggagaggggcagggagaactgc---gtggacctg
A0A3Q1EQB9_MCL1-02      tttgtcagtacttaaaggagaggggcagggagaactgc---gtggacctg
A0A3P8RQX7_MCL1-02      tatgtcagtacctgaaggagaggggcagggagaactgc---gtggacctg
A0A3P8RQX7_MCL1-01      tatgtcagtacctgaaggagaggggcagggagaactgc---gtggacctg
A0A3Q1BKL8_MCL1-01      tatgtcagtacctgaaggagaggggcagggagaactgc---gtggacctg
A0A3Q1BKL8_MCL1-02      tatgtcagtacctgaaggagaggggcagggagaactgc---gtggacctg
A0A3Q2EDX8_MCL1-01      tgtgtcagcacctgaaggagaaaggcagagagaactgc---gtggagctg
A0A3Q2P7X9_MCL1-02      tgtgccagcacctgaaggagagcggccggtctcactgc---gtggacctg
A0A3Q2P7X9_MCL1-01      tgtgccagcacctgaaggagagcggccggtctcactgc---gtggacctg
                                                                          

A0A3B3SG34_MCL1-01      gtggggaagcagatctcctcctacctgctctcagagcagcgacaatggct
A2BF68_MCL1-02          gtaggggaggagatctcgtcttatctacttacagagcagcgggactggat
Q8UWD6_MCL1-01          gtaggggaggagatctcgtcttatctacttacagagcagcgggactggat
A2BF68_MCL1-01          gtaggggaggagatctcgtcttatctacttacagagcagcgggactggat
Q568W5_MCL1-01          gtaggggaggagatctcgtcttatctacttacagagcagcgggactggat
A0A3B1K5R1_MCL1-01      gtgggtgaagaactatcctcatatcttctgtcagacgaaagggactggct
A0A3B4C6H5_MCL1-01      gtgggccaagagatttcctcatatcttctttcagaccaaaaagactggct
A0A3B4C6H5_MCL1-03      gtgggccaagagatttcctcatatcttctttcagaccaaaaagactggct
B6V6J0_MCL1-01          ttggcagagcacttcacgcagttcctaatgatgagcaaaaaagactggat
Q568V1_MCL1-01          gtggctgagcagatctcctcatatctgacctcagaacagcaggactggat
Q1L8X3_MCL1-01          gtggctgagcagatctcctcatatctgacctcagaacagcaggactggat
Q9I9N3_MCL1-01          gtggctgagcagatctcctcatatctgacctcagaacagcaggactggat
J7H260_MCL1-01          ctagcggacagcttcacagactatcttatgacccagaagaaagaatggat
A0A3B3R4U0_MCL1-01      gtggcaagccggatcagctgctacctgctggaacaccagagggactggct
A0A3Q2Y539_MCL1-01      gtggcccaggaggtctcgacctacttgctgtcacaccagcgcacctggct
Q0KFR9_MCL1-01          gtgggccaagagattgccaaatacctcctctctgaccaaagtgactggct
A0A3P8Y1W8_MCL1-02      gttggccaagaaatctccacatacctcctcactgaccaaagggcctggct
A0A3P8Y1W8_MCL1-01      gttggccaagaaatctccacatacctcctcactgaccaaagggcctggct
A0A3B3CEX1_MCL1-01      gtcagtcaggagatctgcacgtacctgctgcgtgagcagcgggactggct
A0A3B3CEX1_MCL1-02      gtcagtcaggagatctgcacgtacctgctgcgtgagcagcgggactggct
A0A3P9ILF6_MCL1-01      gtcagtcaggagatctgcacgtacctgctgagtgagcagcggaactggct
A0A3P9ILF6_MCL1-02      gtcagtcaggagatctgcacgtacctgctgagtgagcagcggaactggct
A0A3B3IJ04_MCL1-01      gtcagtcaggagatctgcacgtacctgctgagtgagcagcggaactggct
A0A3B3IJ04_MCL1-02      gtcagtcaggagatctgcacgtacctgctgagtgagcagcggaactggct
A0A3P9L1F3_MCL1-02      gtcagtcaggagatctgcacgtacctgctgagtgagcagcggaactggct
A0A3P9L1F3_MCL1-01      gtcagtcaggagatctgcacgtacctgctgagtgagcagcggaactggct
H3AR18_MCL1-02          ttggcagtgtcgatcacagactttctggtgcagaataagggagactggat
H3AR18_MCL1-01          ttggcagtgtcgatcacagactttctggtgcagaataagggagactggat
A0A3Q2XZL8_MCL1-01      gtggccgatgagatctcttcgtatctgctgtcgcaccagcgcaactggct
A0A3B4AFB7_MCL1-01      gtgggccaagaaatttcctcatacctcctgttggaccaacgagactggct
A0A3B4AFB7_MCL1-02      gtgggccaagaaatttcctcatacctcctgttggaccaacgagactggct
A0A3B1IEV7_MCL1-01      gtcgcccaacacatctccacctacctcaacacccaccaacaccagtggct
A0A3B4CGU9_MCL1-03      gtcatacaacacatctcaacgtacctcagtacagaccagcgacagtggct
A0A3B4CGU9_MCL1-02      gtcatacaacacatctcaatgtacctcagtacagaccagcgacagtggct
W5MMB7_MCL1-01          gtgggccaggcgatctccaactacctactgcaggaccagcgcgagtggct
A0A3P8VKM5_MCL1-03      gtaggaagagagatctcctcgtacctgctgtcttaccagagagattggct
A0A3P8VKM5_MCL1-05      gtaggaagagagatctcctcgtacctgctgtcttaccagagagattggct
A0A3P8VKM5_MCL1-04      gtaggaagagagatctcctcgtacctgctgtcttaccagagagattggct
U3KKY6_MCL1-01          ctggctgggatcatcacagatgcactggtgtcctccaaacgccagtggct
A0A493U0E8_MCL1-01      ctggccaggatcatcaccgacgccctcgtctcgtccaaacgcgagtggct
G1MPY7_MCL1-01          ctggcggggatcatcacagacgctttggtctcatccaagcgcgagtggct
A0A1L1RNM6_MCL1-01      ctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggct
A0A1L1RNM6_MCL1-02      ctggcggggatcatcacggacgcattggtctcatccaaacgcgagtggct
H9GEA6_MCL1-02          ttaatagaaattatcactgatgtgctggtgacggacaagagagaatggct
H9GEA6_MCL1-01          ttaatagaaattatcactgatgtgctggtgacggacaagagagaatggct
K7FPN7_MCL1-01          ctagcagggatcatcacagatgtgcttgtctcagacaaacgagattggct
G3TVG9_MCL1-01          --agcagaatgtatcacagatgttctcctaagg---aaacggtactgctt
G3WBC5_MCL1-01          ctagcagaaagcataacagatgtcctggttaaatcgaaaagggactggct
F6ZMX1_MCL1-03          ctagcagaaagcataacagatgttctggtcaagacaaaacgggactggct
F6ZMX1_MCL1-01          ctagcagaaagcataacagatgttctggtcaagacaaaacgggactggct
F6ZMX1_MCL1-02          ctagcagaaagcataacagatgttctggtcaagacaaaacgggactggct
H0XHA5_MCL1-01          ctagaagaaaatatcgcagatgtccttgtgaggacaaaaccggactggct
G1QAV8_MCL1-01          ttagcagaagacatcacagatgttctcgtagggacagaacgaggctggct
G1PZ39_MCL1-01          ttggga---------accgctctccgctcaaaggccggaaaggtgtggga
P97287_MCL1-01          ttagcagaaactatcacagatgttcttgtaaggacgaaacgggactggct
Q9Z1P3_MCL1-01          ttagcagaaagtatcacagacgttcttgtaaggacgaagcgggactggct
A0A2K6F6N9_MCL1-01      ttagcagaaagtatcacagacattcttgtaaggacgaaacgagactggct
A0A2K5DMS4_MCL1-01      ttagcagaaagtat--cagatattctc-----------------------
A0A286Y1M5_MCL1-01      ttagcggaaagtatcacagatgctctggtgcactcaaaaagggactggct
A0A287DCH9_MCL1-02      ttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggct
A0A287DCH9_MCL1-01      ttagcagaaagtatcacagacgtgctcgtaaggacaaaacgggactggct
G1T2Q0_MCL1-02          ttagcggaaagtatcacagatgttctcgtcaggacgaaacgggactggct
G1T2Q0_MCL1-01          ttagcggaaagtatcacagatgttctcgtcaggacgaaacgggactggct
G3T756_MCL1-01          ttagcagaaagtatcacagatgttctcgtaaggacgaaaagggactggtt
A0A1S3F3I1_MCL1-01      ttagcagaaagtatcacagatgttctcgtaaggacaaaacgggactggct
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          ttagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggct
F7AVA6_MCL1-01          ttagcagaaagcatcacagatgtcctcgtaaggacaaaacgagactggct
A0A337S3J9_MCL1-01      ttagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggct
Q7YRZ9_MCL1-01          ttagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggct
A0A337S3J9_MCL1-04      ttagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggct
A0A337S3J9_MCL1-03      ttagcagaaagcatcacagatgttcttgtaaggacaaaacgagactggct
Q8HYS5_MCL1-01          ttagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggct
F1PAP1_MCL1-01          ttagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggct
F1PAP1_MCL1-02          ttagcagaaagcatcacagatgttctcgtaaggacgaaacgagactggct
M3XZZ5_MCL1-01          ttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggct
Q95KR3_MCL1-01          ttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggct
A0A287BK44_MCL1-02      ttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggct
A0A287BK44_MCL1-01      ttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggct
A0A452RHX5_MCL1-01      ttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggct
G1L3L7_MCL1-02          ttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggct
G1L3L7_MCL1-01          ttagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggct
W5QI41_MCL1-01          ctagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggat
F1MQX4_MCL1-01          ctagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggat
A5PJR2_MCL1-01          ctagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggat
A0A452GA25_MCL1-02      ctagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggat
A0A452GA25_MCL1-01      ctagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggat
G2HFR3_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5EPX0_MCL1-02      ttagcagaaagtattacagacgttctcgtaaggacaaaacgggactggct
A0A2K5EPX0_MCL1-01      ttagcagaaagtattacagacgttctcgtaaggacaaaacgggactggct
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          ttagcagaaagtatcacagacgttcttgtaaggacaaaacgggactggct
A0A2K6GI15_MCL1-03      ttagcagaaagtatcacagacgttcttgtaaggacaaaacgagactggct
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
C8YZ26_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2I2YQH7_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2I2YQH7_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
B4E3L8_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
B4DG83_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
B4DU51_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
Q07820_MCL1-04          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
B4DLY8_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2I3RTV4_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2R9BPJ5_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2I3RTV4_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2R9BPJ5_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5I9I0_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K6PPI3_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5LXU8_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5LXU8_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A0D9RZP5_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5W0W9_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K6ECR0_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5XSB2_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5XSB2_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2I3LFM0_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K6V5Y3_MCL1-03      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5R5E2_MCL1-04      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
F7GTF7_MCL1-01          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
F7GTF7_MCL1-02          ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5CFH3_MCL1-01      ttagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggct
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          gtggccgaggagatttcctcatacctcctttcagaccaacgggaatggtt
D2ITA0_MCL1-04          gtggccgaggagatttcctcatacctcctttcagaccaacgggaatggtt
A0A3P8V8T6_MCL1-01      gttggacaggagatcgcctcatacctgttgtcttatcagaaagactggct
Q4SW32_MCL1-01          gtggcccaggaaatctccacctacctgttgacggaccagcgcgactggct
A0A3B5PQ55_MCL1-01      gtgagccggaaaatatccacgtatctcctggcaaaccagcgggactggct
A0A3B5PQ55_MCL1-02      gtgagccggaaaatatccacgtatctcctggcaaaccagcgggactggct
A0A3P9Q4I8_MCL1-01      gtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggct
A0A3P9Q4I8_MCL1-02      gtgagccaggaaatatccacgtatctcctggcaaagcagcgggactggct
A0A3B3VM25_MCL1-01      gtgatccaggaaatatccacgtatctcctggaaaaccagcgggactggct
A0A087X830_MCL1-01      gtgagcaaggaaatatccacgtatctcctggaaaaccagcgggactggct
A0A3B3YCD0_MCL1-01      gtgagcaaggaaatatccacgtatctcctggaaaaccagcgggactggct
A0A3Q3VP02_MCL1-01      gtggctcatgagatctccacatacctgttgacagaccagcgggactggat
G3PJT0_MCL1-01          gtggggcaggagatctcggcctacctgctgtcggaccagcgggactggct
A0A2U9CJ81_MCL1-01      gtcgggcaggagatctccacatacctgctgacggaccagcgagactggct
A0A3Q3B4P5_MCL1-01      gtgggccaggagatttccacatacctgctgtctgagcagaaagactggct
A0A3Q3B4P5_MCL1-02      gtgggccaggagatttccacatacctgctgtctgagcagaaagactggct
A0A3Q3IZW0_MCL1-01      gtgggacaggagatctccacgtacctgctgtctcaccagcgggactggct
A0A3Q3GP42_MCL1-01      gtggggcaggagatctccacgtacctgctgtctgaccaccgggactggct
A0A3Q1GX28_MCL1-02      gtggcacaggagatctcctcatacctgctgtcagcccagcgagactggct
A0A3Q1GX28_MCL1-01      gtggcacaggagatctcctcatacctgctgtcagcccagcgagactggct
A0A3Q3M6G2_MCL1-01      gtggggcaggagatctccacctacctgctgtcagaccagcgggactggct
A0A3Q3M6G2_MCL1-02      gtggggcaggagatctccacctacctgctgtcagaccagcgggactggct
A0A3B4T8L9_MCL1-01      gtggggcaggagatctccaaatacctgctgtctgatcagcgagactggct
A0A3B4T8L9_MCL1-02      gtggggcaggagatctccaaatacctgctgtctgatcagcgagactggct
A0A3B4XKA5_MCL1-01      gtggggcaggagatctccaaatacctgctgtctgatcagcgagactggct
A0A3Q0R633_MCL1-01      gtgagccaggagatttccacatacctgctgtctgaccaacgagactggct
A0A3Q0R633_MCL1-03      gtgagccaggagatttccacatacctgctgtctgaccaacgagactggct
I3KXG5_MCL1-01          gtgagtcaagagatttctgcatacttgctgtctgaacagcgagactggat
I3JHR5_MCL1-03          gtgagccaagaggtttctgcatacctgctgtctgaacagcgagactggat
I3JHR5_MCL1-02          gtgagccaagaggtttctgcatacctgctgtctgaacagcgagactggat
I3JHR5_MCL1-01          gtgagccaagaggtttctgcatacctgctgtctgaacagcgagactggat
A0A3Q4HLQ8_MCL1-01      gttagccaagagatttctgcatacctgctgtctgagcagcgagactggat
A0A3P9BVM3_MCL1-01      gtgagccaagagatttctgcatacctgctgtctgaacagcgagactggat
A0A3P8NP63_MCL1-02      gtgagccaagagatttctgcatacctgctgtctgaacagcgagactggat
A0A3P8NP63_MCL1-01      gtgagccaagagatttctgcatacctgctgtctgaacagcgagactggat
A0A3Q2VNL8_MCL1-01      gtgagccaagagatttctgcatacctgctgtctgaacagcgagactggat
A0A3B4G4Z6_MCL1-01      gtgagccaagagatttctgcatacctgctgtctgaacagcgagactggat
A0A3B4ZKP6_MCL1-01      gtgagcgaggagatttccacatacctgctctgcgatcagcgagactggct
A0A3Q1EQB9_MCL1-01      gtcagccaggagatttccacatacctgctttctgaacagcgagactggct
A0A3Q1EQB9_MCL1-02      gtcagccaggagatttccacatacctgctttctgaacagcgagactggct
A0A3P8RQX7_MCL1-02      gtcagccaggagatttccacatacctgctttctgaacagcgagactggct
A0A3P8RQX7_MCL1-01      gtcagccaggagatttccacatacctgctttctgaacagcgagactggct
A0A3Q1BKL8_MCL1-01      gtcagccaggagatttccacatacctgctttctgaacagcgagactggct
A0A3Q1BKL8_MCL1-02      gtcagccaggagatttccacatacctgctttctgaacagcgagactggct
A0A3Q2EDX8_MCL1-01      gtgagccaagagatctccacatacctgctgcaaaatcagagggactggct
A0A3Q2P7X9_MCL1-02      gtgagccgggagatctccacatacctgctgaccaaccagcgggactggct
A0A3Q2P7X9_MCL1-01      gtgagccgggagatctccacatacctgctgaccaaccagcgggactggct
                                                                          

A0A3B3SG34_MCL1-01      actc---------aagaacaaggcctgggatggatttgtggagttctttc
A2BF68_MCL1-02          actc---------agaaacaaagcatgggatggctttgtggagttttttc
Q8UWD6_MCL1-01          actc---------agaaacaaagcatgggatggctttgtggagttttttc
A2BF68_MCL1-01          actc---------agaaacaaagcatgggatggctttgtggagttttttc
Q568W5_MCL1-01          actc---------agaaacaaagcatgggatggctttgtggagttttttc
A0A3B1K5R1_MCL1-01      ccta---------aaaaacaaagcatgggatggctttgtggagttttttc
A0A3B4C6H5_MCL1-01      actg---------aaaaataaagcatgggatggctttgtggagttttttc
A0A3B4C6H5_MCL1-03      actg---------aaaaataaagcatgggatggctttgtggagttttttc
B6V6J0_MCL1-01          aata---------caggaaaagggatgggatggctttgtggacttttttc
Q568V1_MCL1-01          cctc---------aaaaacaagagctgtcatgggttcgtggagtttttcc
Q1L8X3_MCL1-01          cctc---------aaaaacaagagctggcatgggttcgtggagtttttcc
Q9I9N3_MCL1-01          cctc---------aaaaacaagagctggcatgggtttgtggagtttttcc
J7H260_MCL1-01          cgta---------gaacacaatggctgggatggctgtgtcgaattctttc
A0A3B3R4U0_MCL1-01      aaac---------cgtaacaatggctgggagggatttacagacttcttct
A0A3Q2Y539_MCL1-01      agtg---------cagcacaacggttgggatggatttgcagaattcttca
Q0KFR9_MCL1-01          gatc---------aaaaacaatgcttggaatggatttgtagagttctttc
A0A3P8Y1W8_MCL1-02      cgtg---------aaaaacaacgcttgggatggatttgtagagttttttc
A0A3P8Y1W8_MCL1-01      cgtg---------aaaaacaacgcttgggatggatttgtagagttttttc
A0A3B3CEX1_MCL1-01      gatc---------aacaacaactcatgggatggtttcgtagagttctttc
A0A3B3CEX1_MCL1-02      gatc---------aacaacaactcatgggatggtttcgtagagttctttc
A0A3P9ILF6_MCL1-01      ggtc---------aacaacaactcctgggatggtttcgtagagttctttc
A0A3P9ILF6_MCL1-02      ggtc---------aacaacaactcctgggatggtttcgtagagttctttc
A0A3B3IJ04_MCL1-01      ggtc---------aacaacaactcctgggatggtttcgtagagttctttc
A0A3B3IJ04_MCL1-02      ggtc---------aacaacaactcctgggatggtttcgtagagttctttc
A0A3P9L1F3_MCL1-02      ggtc---------aacaacaactcctgggatggtttcgtagagttctttc
A0A3P9L1F3_MCL1-01      ggtc---------aacaacaactcctgggatggtttcgtagagttctttc
H3AR18_MCL1-02          cctc---------aagaaccaaggctggaaaggatttgttgactttttcc
H3AR18_MCL1-01          cctc---------aagaaccaaggctggaaaggatttgttgactttttcc
A0A3Q2XZL8_MCL1-01      ggtg---------aaaaacaactcttgggatggctttgtacaattctttc
A0A3B4AFB7_MCL1-01      agtc---------aggaataatgcctgggatggctttgtcgacttcttca
A0A3B4AFB7_MCL1-02      agtc---------aggaataatgcctgggatggctttgtcgacttcttca
A0A3B1IEV7_MCL1-01      catc---------aacaacaacgcctgggacggattcgtggaattcttcc
A0A3B4CGU9_MCL1-03      catc---------aacaacaaagcctggggaggttttgtggagttcttcc
A0A3B4CGU9_MCL1-02      catc---------aacaacaaagcctggggaggttttgtggagttcttcc
W5MMB7_MCL1-01          tctg---------aacaaccgaggctgggacggcttcgtggagttcttcc
A0A3P8VKM5_MCL1-03      attg---------aaaaacaactcttgggatggctttgtagagttcttca
A0A3P8VKM5_MCL1-05      attg---------aaaaacaactcttgggatggctttgtagagttcttca
A0A3P8VKM5_MCL1-04      attg---------aaaaacaactcttgggatggctttgtagagttcttca
U3KKY6_MCL1-01          ggag---------agccaggggggctgg----------------------
A0A493U0E8_MCL1-01      cgtg---------agccagggaggctgggagggtttcgtcgactttttcc
G1MPY7_MCL1-01          gatg---------agccagggaggctgggagggctttgtcgacttcttcc
A0A1L1RNM6_MCL1-01      gatg---------agccagggaggctgggagggctttgttgacttcttcc
A0A1L1RNM6_MCL1-02      gatg---------agccagggaggctgggagggctttgttgacttcttcc
H9GEA6_MCL1-02          attg---------aaacataatgcctgggagggatttgttcagttcttcc
H9GEA6_MCL1-01          attg---------aaacataatgcctggca--------------------
K7FPN7_MCL1-01          agtt---------aaccaaagaggctgggagggatttgttgaattcttcc
G3TVG9_MCL1-01          agac---------aaacgaaggggcggggatgggcttgtggagttcgtcc
G3WBC5_MCL1-01          gatg---------aagcagaagggctgggaggggtttgtggaattctttc
F6ZMX1_MCL1-03          gatt---------aagcaaaagggctgggagggatttgtggaattctttc
F6ZMX1_MCL1-01          gatt---------aagcaaaagggctggaaagg------------cctcc
F6ZMX1_MCL1-02          gatt---------aagcaaaagggctggtcag------------------
H0XHA5_MCL1-01          agtc---------aaacaacgaggctgggatggctttgtggagttcttct
G1QAV8_MCL1-01          agtc---------aaacagagaggctgggatgggtttgtggaattcttcc
G1PZ39_MCL1-01          gacctccaacacttgccatggcttcaaggatgggtttgtggaattcttcc
P97287_MCL1-01          tgtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
Q9Z1P3_MCL1-01          tgtg---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K6F6N9_MCL1-01      a------------------------------------------ttcttcc
A0A2K5DMS4_MCL1-01      -----------------------gctgggatgggtttgtggagttcttcc
A0A286Y1M5_MCL1-01      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A287DCH9_MCL1-02      ggtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A287DCH9_MCL1-01      ggtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
G1T2Q0_MCL1-02          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
G1T2Q0_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
G3T756_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A1S3F3I1_MCL1-01      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K6GI15_MCL1-01      ---------------------------ggatgggtttgtggagttcttcc
F7AVA6_MCL1-02          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
F7AVA6_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A337S3J9_MCL1-01      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
Q7YRZ9_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A337S3J9_MCL1-04      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A337S3J9_MCL1-03      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
Q8HYS5_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
F1PAP1_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
F1PAP1_MCL1-02          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
M3XZZ5_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
Q95KR3_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A287BK44_MCL1-02      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A287BK44_MCL1-01      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A452RHX5_MCL1-01      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
G1L3L7_MCL1-02          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
G1L3L7_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
W5QI41_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
F1MQX4_MCL1-01          agtc---------aaagaaagaggctgggatgggtttgtggagttcttcc
A5PJR2_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A452GA25_MCL1-02      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A452GA25_MCL1-01      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
G2HFR3_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5EPX0_MCL1-02      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5EPX0_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5C7L5_MCL1-01      ------------------------------------------gttcttcc
H0XFB7_MCL1-01          agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K6GI15_MCL1-03      agtc---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5I9I0_MCL1-02      ---------------------------ggatgggtttgtggagttcttcc
H2N5Y9_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
C8YZ26_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2I2YQH7_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2I2YQH7_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
B4E3L8_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
B4DG83_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
B4DU51_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
Q07820_MCL1-04          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
B4DLY8_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2I3RTV4_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2R9BPJ5_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2I3RTV4_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2R9BPJ5_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5I9I0_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2I3GJZ3_MCL1-01      ---------------------------ggatgggtttgtggagttcttcc
A0A2I3GJZ3_MCL1-02      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K6KRW9_MCL1-02      ---------------------------ggatgggtttgtggagttcttcc
A0A2K6PPI3_MCL1-02      ---------------------------ggatgggtttgtggagttcttcc
A0A2K6KRW9_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K6PPI3_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2I3LFM0_MCL1-01      ---------------------------ggatgggtttgtggagttcttcc
A0A2K5W0W9_MCL1-01      ---------------------------ggatgggtttgtggagttcttcc
A0A2K6ECR0_MCL1-02      ---------------------------ggatgggtttgtggagttcttcc
I7G687_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5LXU8_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5LXU8_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A0D9RZP5_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5W0W9_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K6ECR0_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5XSB2_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5XSB2_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2I3LFM0_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5R5E2_MCL1-03      ---------------------------ggatgggtttgtggagttcttcc
A0A2K6V5Y3_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K6V5Y3_MCL1-03      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5R5E2_MCL1-04      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
F7GTF7_MCL1-01          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
F7GTF7_MCL1-02          agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5CFH3_MCL1-01      agtt---------aaacaaagaggctgggatgggtttgtggagttcttcc
A0A2K5CFH3_MCL1-03      ---------------------------ggatgggtttgtggagttcttcc
D2ITA0_MCL1-03          ggtc---------aaaaacaactcatgggagggcttcgtagagttttttc
D2ITA0_MCL1-04          ggtc---------aaaaacaactcatgggagggcttcgtagagttttttc
A0A3P8V8T6_MCL1-01      cctg---------aaaaacaactcctgggatggcttcgtggaattcttcc
Q4SW32_MCL1-01          gatc---------aaaaacaacgcctgggacggatttgtggagtttttcc
A0A3B5PQ55_MCL1-01      agca---------aaaaacaactcatgggagggctttgtggagttcttta
A0A3B5PQ55_MCL1-02      agca---------aaaaacaactcatgggagggctttgtggagttcttta
A0A3P9Q4I8_MCL1-01      agca---------aaaaacaactcatgggagggctttgtggagttcttta
A0A3P9Q4I8_MCL1-02      agca---------aaaaacaactcatgggagggctttgtggagttcttta
A0A3B3VM25_MCL1-01      agca---------aaaaacaactcatgggagggctttgtggagttcttta
A0A087X830_MCL1-01      agca---------aaaaacaactcatgggagggctttgtggagttcttta
A0A3B3YCD0_MCL1-01      agca---------aaaaacaactcatgggagggctttgtggagttcttta
A0A3Q3VP02_MCL1-01      gtgt---------gtgggcg------gtgatggctttgtcgagttctttc
G3PJT0_MCL1-01          gatc---------aaaaacaacgcctgggttggcttcgttgagttctttc
A0A2U9CJ81_MCL1-01      ggtg---------aaaaacaactcctgggagggctttgtggaatttttcc
A0A3Q3B4P5_MCL1-01      gctc---------aaaaataactcctggagtggctttgtggagttctttc
A0A3Q3B4P5_MCL1-02      gctc---------aaaaataactcctggagtggctttgtggagttctttc
A0A3Q3IZW0_MCL1-01      ggtt---------aagaacaacgcttgggacggctttgaagaattttttc
A0A3Q3GP42_MCL1-01      ggtc---------aaaaacaacgcctgggacggctttgtcgagttctttc
A0A3Q1GX28_MCL1-02      ggtc---------aggaacaactcatgggatggttttgttgaattctttc
A0A3Q1GX28_MCL1-01      ggtc---------aggaacaactcatgggatggttttgttgaattctttc
A0A3Q3M6G2_MCL1-01      ggtc---------aaaaacaactcctgggatggctttgtagagttttttc
A0A3Q3M6G2_MCL1-02      ggtc---------aaaaacaactcctgggatggctttgtagagttttttc
A0A3B4T8L9_MCL1-01      ggtg---------aaaaacaactcctgggatggctttgtagcgttctttc
A0A3B4T8L9_MCL1-02      ggtg---------aaaaacaactcctgggatggctttgtagcgttctttc
A0A3B4XKA5_MCL1-01      ggtg---------aaaaacaactcctgggatggatttgtatcgttctttc
A0A3Q0R633_MCL1-01      ggtt---------aaaaacaatgcatgggatggatttgtggagttttttc
A0A3Q0R633_MCL1-03      ggtt---------aaaaacaatgcatgggatggatttgtggagttttttc
I3KXG5_MCL1-01          tatc---------aaaaacaatgcatgggatggctttgtggcgttcgttc
I3JHR5_MCL1-03          tgtc---------aaaaacaatgcatgggatggctttgtggagttctttc
I3JHR5_MCL1-02          tgtc---------aaaaacaatgcatgggatggctttgtggagttctttc
I3JHR5_MCL1-01          tgtc---------aaaaacaatgcatgggatggctttgtggagttctttc
A0A3Q4HLQ8_MCL1-01      tgtc---------aaaaacaatgcatgggatggctttgtggagttctttc
A0A3P9BVM3_MCL1-01      tgta---------aaaaacaatgcatgggatggctttgtggagttctttc
A0A3P8NP63_MCL1-02      tgta---------aaaaacaatgcatgggatggctttgtggagttctttc
A0A3P8NP63_MCL1-01      tgta---------aaaaacaatgcatgggatggctttgtggagttctttc
A0A3Q2VNL8_MCL1-01      tgta---------aaaaacaatgcatgggatggctttgtggagttctttc
A0A3B4G4Z6_MCL1-01      tgta---------aaaaacaatgcatgggatggctttgtggagttctttc
A0A3B4ZKP6_MCL1-01      ggtg---------aagaacaactcatgggatggctttgtagagtttttcc
A0A3Q1EQB9_MCL1-01      ggtc---------aaaaacaactcatgggacggttttgtggagttttttc
A0A3Q1EQB9_MCL1-02      ggtc---------aaaaacaactcatgggacggttttgtggagttttttc
A0A3P8RQX7_MCL1-02      ggtc---------aaaaacaactcatgggatggttttgtggagttttttc
A0A3P8RQX7_MCL1-01      ggtc---------aaaaacaactcatgggatggttttgtggagttttttc
A0A3Q1BKL8_MCL1-01      ggtc---------aaaaacaactcatgggatggttttgtggagttttttc
A0A3Q1BKL8_MCL1-02      ggtc---------aaaaacaactcatgggatggttttgtggagttttttc
A0A3Q2EDX8_MCL1-01      agta---------aagaacaattcatggaatggatttgtggagttcttca
A0A3Q2P7X9_MCL1-02      agcc---------aagaacaactcatgggacggctttgtggagttcttta
A0A3Q2P7X9_MCL1-01      agcc---------aagaacaactcatgggacggctttgtggagttcttta
                                                                          

A0A3B3SG34_MCL1-01      atgtagaagacactgaatcgttggtcc-------tccaga----------
A2BF68_MCL1-02          atgtcccggatacagaggcagctgtga-------gaaaca----------
Q8UWD6_MCL1-01          atgtcccggatacagaggcagctgtga-------gaaaca----------
A2BF68_MCL1-01          atgtcccggatacagaggcagctgtga-------gaaaca----------
Q568W5_MCL1-01          atgtcccggatacagaggcagctgtga-------gaaaca----------
A0A3B1K5R1_MCL1-01      gtgttcctgatcctgagtcaacgatga-------gaaatg----------
A0A3B4C6H5_MCL1-01      atgtcccggatcccgagtcaaaaatga-------ggaatg----------
A0A3B4C6H5_MCL1-03      atgtcccggatcccgagtcaaaaatga-------ggaatg----------
B6V6J0_MCL1-01          acatagaagattatgaaagtggactga-------aaactg----------
Q568V1_MCL1-01          accaggaggacgtagagtctgttgtcc-------gtcatg----------
Q1L8X3_MCL1-01          accaggaggacgtagagtctgttgtcc-------gtcatg----------
Q9I9N3_MCL1-01          accaggaggatgtagagtctgttgtcc-------gtcatg----------
J7H260_MCL1-01          acgtcgaggactatgagagtggactaa-------aaacag----------
A0A3B3R4U0_MCL1-01      atatggaagacccagagtccactgtgc-------gtaatg----------
A0A3Q2Y539_MCL1-01      aggaagacgacctggagtctacagtga-------ggaatg----------
Q0KFR9_MCL1-01          atgtacaagatcctgagtcctcagtaa-------ggaaca----------
A0A3P8Y1W8_MCL1-02      atgtagaagatccagagtcctcacc-------------------------
A0A3P8Y1W8_MCL1-01      atgtagaagatccagagtcctcagtaa-------ggaaca----------
A0A3B3CEX1_MCL1-01      acgtcccagacccagaatcaacagtca-------ggaaca----------
A0A3B3CEX1_MCL1-02      acgtcccagacccagaatcaacagtca-------ggaaca----------
A0A3P9ILF6_MCL1-01      gcgtttcagacccagaaactacagtca-------ggaaca----------
A0A3P9ILF6_MCL1-02      gcgtttcagacccagaaactacagtca-------ggaaca----------
A0A3B3IJ04_MCL1-01      gcgtttcagacccagaaacgacagtca-------ggaaca----------
A0A3B3IJ04_MCL1-02      gcgtttcagacccagaaacgacagtca-------ggaaca----------
A0A3P9L1F3_MCL1-02      gcgtttcagacccagaatctacagtca-------ggaaca----------
A0A3P9L1F3_MCL1-01      gcgtttcagacccagaatctacagtca-------ggaaca----------
H3AR18_MCL1-02          atgtagaagatgcagagggtacaatca-------aaaatg----------
H3AR18_MCL1-01          atgtagaagatgcagagggtacaatca-------aaaatg----------
A0A3Q2XZL8_MCL1-01      gggaagtggatcctgagtctacagtga-------ggaaca----------
A0A3B4AFB7_MCL1-01      gagtagaagacccagagtcagcagtga-------ggaaca----------
A0A3B4AFB7_MCL1-02      gagtagaagacccagagtcagcagtga-------ggaaca----------
A0A3B1IEV7_MCL1-01      gcgaggacgactcagaatcacgagtcc-------gaaacg----------
A0A3B4CGU9_MCL1-03      gtgaagacgactccgagtcacgcgtac-------ggaacg----------
A0A3B4CGU9_MCL1-02      gtgaagacgactccgagtcacgcgtac-------ggaacg----------
W5MMB7_MCL1-01          gcgtggaggaccccgagtcgacgatca-------ggaacg----------
A0A3P8VKM5_MCL1-03      gagtagaagacccagaggcaaccatga-------ggaaca----------
A0A3P8VKM5_MCL1-05      gagtagaagacccagaggcaaccatga-------ggaaca----------
A0A3P8VKM5_MCL1-04      gagtagaagacccagaggcaaccatga-------ggaaca----------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      gagtggaagacctggaaggcagcatca-------ggaacg----------
G1MPY7_MCL1-01          gagttgaggacctggaaagcagcatca-------ggaatg----------
A0A1L1RNM6_MCL1-01      gagttgaggacctggaaagcagcatca-------ggaatg----------
A0A1L1RNM6_MCL1-02      gagttgaggacctggaaagcagcatca-------ggaatg----------
H9GEA6_MCL1-02          atgtagaggacatagaaggtggcatca-------ggaatg----------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          gtgtagaggatctagaaggtagcatca-------ggaatg----------
G3TVG9_MCL1-01          acgtaaaggacccacagggcgactgta-------gaaatg----------
G3WBC5_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
F6ZMX1_MCL1-03          atgtacaggacctagaaggtggcatca-------gaaatg----------
F6ZMX1_MCL1-01          ttgctcaagacacggaagaagccaccc-------gaaccggcgatccctg
F6ZMX1_MCL1-02          -------------ggaaggagagagtg-------gatcca----------
H0XHA5_MCL1-01          acctggaagacctggaaagcagcgtca-------gaaacg----------
G1QAV8_MCL1-01          aggtggaggacctagaaggcggcgtca-------gaaatg----------
G1PZ39_MCL1-01          atgtagaggacctagaaggcggcatca-------gaaatg----------
P97287_MCL1-01          acgtacaggacctagaaggcggcatca-------gaaatg----------
Q9Z1P3_MCL1-01          acgtacaggacctagaaggcggcatca-------gaaatg----------
A0A2K6F6N9_MCL1-01      atgtagaagacctggaaggcagcatca-------gaaatg----------
A0A2K5DMS4_MCL1-01      gtgtagaggacttagaaggtggcatca-------gaaatg----------
A0A286Y1M5_MCL1-01      atatagaggatctagaaggcggcatca-------gaaatg----------
A0A287DCH9_MCL1-02      atgtagaggacctagaaggcggcatca-------gaaatg----------
A0A287DCH9_MCL1-01      atgtagaggacctagaaggcggcatca-------gaaatg----------
G1T2Q0_MCL1-02          atgtagaggacctagaaagcggcatca-------gaaatg----------
G1T2Q0_MCL1-01          atgtagaggacctagaaagcggcatca-------gaaatg----------
G3T756_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A1S3F3I1_MCL1-01      atgtagaggacctagaaggcagcatca-------gaaatg----------
A0A2K6GI15_MCL1-01      atgtagaggacctagaaggcggcatca-------gaaatg----------
F7AVA6_MCL1-02          atgtagaggacctagaaggtggcatca-------gaaatg----------
F7AVA6_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A337S3J9_MCL1-01      atgtagaggacctagaaggtgg----------------------------
Q7YRZ9_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A337S3J9_MCL1-04      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A337S3J9_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
Q8HYS5_MCL1-01          atgtagaggacctagaaggcggcatca-------gaaatg----------
F1PAP1_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
F1PAP1_MCL1-02          atgtagaggacctagaaggtggcatca-------gaaatg----------
M3XZZ5_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
Q95KR3_MCL1-01          atgtagaggacctagaaggcggcatca-------gaaatg----------
A0A287BK44_MCL1-02      atgtagaggacctagaaggcggcatca-------g---------------
A0A287BK44_MCL1-01      atgtagaggacctagaaggcggcatca-------gaaatg----------
A0A452RHX5_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
G1L3L7_MCL1-02          atgtagaggacctagaaggtggcatca-------gaaatg----------
G1L3L7_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
W5QI41_MCL1-01          gtgtagaggacctagaaggcggcatca-------gaaatg----------
F1MQX4_MCL1-01          atgtagaggacctagaaggcggcatca-------gaaatg----------
A5PJR2_MCL1-01          atgtagaggacctagaaggcggcatca-------gaaatg----------
A0A452GA25_MCL1-02      atgtagaggacctagaaggcggcatca-------gaaatg----------
A0A452GA25_MCL1-01      atgtagaggacctagaaggcggcatca-------gaaatg----------
G2HFR3_MCL1-01          atgtagaggacctagaaggtggcatca-------ggaatg----------
A0A2K5EPX0_MCL1-02      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5EPX0_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5C7L5_MCL1-01      atgtagaagacctagaaggtggcatca-------gaaatg----------
H0XFB7_MCL1-01          atgtagaggacctagaaggcggcatca-------gaaatg----------
A0A2K6GI15_MCL1-03      atgtagaggacctagaaggcggcatca-------gaaatg----------
A0A2K5I9I0_MCL1-02      atgtagaggacctagaaggtggcatca-------gaaatg----------
H2N5Y9_MCL1-01          atgtagaggacctagaaggaggcatca-------gaaatg----------
C8YZ26_MCL1-01          aagtagaggacctagaaggtggcatca-------ggaatg----------
A0A2I2YQH7_MCL1-01      atgtagaggacctagaaggtggcatca-------ggaatg----------
A0A2I2YQH7_MCL1-03      atgtagaggacctagaaggtggcatca-------ggaatg----------
B4E3L8_MCL1-01          atgtagaggacctagaaggtggcatca-------ggaatg----------
B4DG83_MCL1-01          atgtagaggacctagaaggtggcatca-------ggaatg----------
B4DU51_MCL1-01          atgtagaggacctagaaggtggcatca-------ggaatg----------
Q07820_MCL1-04          atgtagaggacctagaaggtggcatca-------ggaatg----------
B4DLY8_MCL1-01          atgtagaggacctagaaggtggcatca-------ggaatg----------
A0A2I3RTV4_MCL1-01      atgtagaggacctagaaggtggcatca-------ggaatg----------
A0A2R9BPJ5_MCL1-03      atgtagaggacctagaaggtggcatca-------ggaatg----------
A0A2I3RTV4_MCL1-03      atgtagaggacctagaaggtggcatca-------ggaatg----------
A0A2R9BPJ5_MCL1-01      atgtagaggacctagaaggtggcatca-------ggaatg----------
A0A2K5I9I0_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2I3GJZ3_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2I3GJZ3_MCL1-02      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K6KRW9_MCL1-02      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K6PPI3_MCL1-02      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K6KRW9_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K6PPI3_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2I3LFM0_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5W0W9_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K6ECR0_MCL1-02      atgtagaggacctagaaggtggcatca-------gaaatg----------
I7G687_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5LXU8_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5LXU8_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A0D9RZP5_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5W0W9_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K6ECR0_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5XSB2_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5XSB2_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2I3LFM0_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5R5E2_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K6V5Y3_MCL1-01      atgtagaggatctagaaggtggcatca-------gaaatg----------
A0A2K6V5Y3_MCL1-03      atgtagaggatctagaaggtggcatca-------gaaatg----------
A0A2K5R5E2_MCL1-04      atgtagaggacctagaaggtggcatca-------gaaatg----------
F7GTF7_MCL1-01          atgtagaggacctagaaggtggcatca-------gaaatg----------
F7GTF7_MCL1-02          atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5CFH3_MCL1-01      atgtagaggacctagaaggtggcatca-------gaaatg----------
A0A2K5CFH3_MCL1-03      atgtagaggacctagaaggtggcatca-------gaaatg----------
D2ITA0_MCL1-03          gagtgtcagaccctgagacgacagtga-------gaaata----------
D2ITA0_MCL1-04          gagtgtcagaccctgagacgacagtga-------gaaata----------
A0A3P8V8T6_MCL1-01      aaggacaagagccagagaaggcaatta-------gatgta----------
Q4SW32_MCL1-01          aagtgccggacccggagtcgacggtcc-------ggaccg----------
A0A3B5PQ55_MCL1-01      gagtatcggacccggagtctacagtga-------ggaaca----------
A0A3B5PQ55_MCL1-02      gagtatcggacccggagtctacagtga-------ggaaca----------
A0A3P9Q4I8_MCL1-01      gagtatcagaccctgagtctacagtga-------ggaaca----------
A0A3P9Q4I8_MCL1-02      gagtatcagaccctgagtctacagtga-------ggaaca----------
A0A3B3VM25_MCL1-01      gagtatcagatcctgagtctacagtga-------ggaaca----------
A0A087X830_MCL1-01      gagtatcagatcctgagtctacagtga-------ggaaca----------
A0A3B3YCD0_MCL1-01      gagtatcagatcctgagtctacagtga-------ggaaca----------
A0A3Q3VP02_MCL1-01      gagtagcagacccagaatccacggtga-------ggaacg----------
G3PJT0_MCL1-01          gagtagcagacccagagtctgcggtga-------ggaaca----------
A0A2U9CJ81_MCL1-01      gagtagcagacccagagacgacaatga-------ggaaca----------
A0A3Q3B4P5_MCL1-01      gaataacagaccctgaatctacagtca-------ggaaca----------
A0A3Q3B4P5_MCL1-02      gaataacagaccctgaatctacagtca-------ggaaca----------
A0A3Q3IZW0_MCL1-01      gagtagcagacccagagtctacagtga-------ggacca----------
A0A3Q3GP42_MCL1-01      gagtagcagacccagagtccacagtga-------ggacaa----------
A0A3Q1GX28_MCL1-02      gagtggcagaccctgaatccacagtga-------ggaaat----------
A0A3Q1GX28_MCL1-01      gagtggcagaccctgaatccacagtga-------ggaaat----------
A0A3Q3M6G2_MCL1-01      gagtagcagacccagagtccacggtga-------ggcaca----------
A0A3Q3M6G2_MCL1-02      gagtagcagacccagagtccacggtga-------ggcaca----------
A0A3B4T8L9_MCL1-01      gagtagcagacccagagtctaaagtga-------ggaaca----------
A0A3B4T8L9_MCL1-02      gagtagcagacccagagtctaaagtga-------ggaaca----------
A0A3B4XKA5_MCL1-01      gagtagcagacccagagtctaaagtga-------ggaaca----------
A0A3Q0R633_MCL1-01      gtgtagcagaccccgagtcaacagtga-------ggaaca----------
A0A3Q0R633_MCL1-03      gtgtagcagaccccgagtcaacagtga-------ggaaca----------
I3KXG5_MCL1-01          gagtagcagaccctgagtcgatagtca-------ggaaca----------
I3JHR5_MCL1-03          gagtagcagaccctgagtccacgacccgggaggtggaatg----------
I3JHR5_MCL1-02          gagtagcagaccctgagtccacggtca-------ggaaca----------
I3JHR5_MCL1-01          gagtagcagaccctgagtccacggtca-------ggaaca----------
A0A3Q4HLQ8_MCL1-01      gagtagcagaccctgagtcgatagtca-------ggcaca----------
A0A3P9BVM3_MCL1-01      gagtagcagaccctgagtcgatagtca-------ggcaca----------
A0A3P8NP63_MCL1-02      gagtagcagaccctgagtcgatagtca-------ggcaca----------
A0A3P8NP63_MCL1-01      gagtagcagaccctgagtcgatagtca-------ggcaca----------
A0A3Q2VNL8_MCL1-01      gagtagcagaccctgagtcgatagtca-------ggcaca----------
A0A3B4G4Z6_MCL1-01      gagtagcagaccctgagtcgatagtca-------ggcaca----------
A0A3B4ZKP6_MCL1-01      gagtggcagaccctgaactgacggtca-------ggaaca----------
A0A3Q1EQB9_MCL1-01      gagtagcagaccctgagttgacggtca-------gaaaca----------
A0A3Q1EQB9_MCL1-02      gagtagcagaccctgagttgacggtca-------gaaaca----------
A0A3P8RQX7_MCL1-02      gagtagcagaccctgagttgacggtca-------ggaaca----------
A0A3P8RQX7_MCL1-01      gagtagcagaccctgagttgacggtca-------ggaaca----------
A0A3Q1BKL8_MCL1-01      gagtagcagaccctgagttgacggtca-------ggaaca----------
A0A3Q1BKL8_MCL1-02      gagtagcagaccctgagttgacggtca-------ggaaca----------
A0A3Q2EDX8_MCL1-01      gagtagaagatcctgaagcaacaatga-------ggaaca----------
A0A3Q2P7X9_MCL1-02      aagtagaggacacagagtcgacggtga-------ggaaca----------
A0A3Q2P7X9_MCL1-01      aagtagaggacacagagtcgacggtga-------ggaaca----------
                                                                          

A0A3B3SG34_MCL1-01      ------------------------------aggttcttg-----------
A2BF68_MCL1-02          ------------------------------cacttctaa-----------
Q8UWD6_MCL1-01          ------------------------------cacttctaa-----------
A2BF68_MCL1-01          ------------------------------cacttctaa-----------
Q568W5_MCL1-01          ------------------------------cacttctaa-----------
A0A3B1K5R1_MCL1-01      ------------------------------cattaatgg-----------
A0A3B4C6H5_MCL1-01      ------------------------------cattaatgg-----------
A0A3B4C6H5_MCL1-03      ------------------------------cattaatgg-----------
B6V6J0_MCL1-01          ------------------------------ttttgatgg-----------
Q568V1_MCL1-01          ------------------------------gtctgttgg-----------
Q1L8X3_MCL1-01          ------------------------------gtctgttgg-----------
Q9I9N3_MCL1-01          ------------------------------gtcttttgg-----------
J7H260_MCL1-01          ------------------------------tcttgatgg-----------
A0A3B3R4U0_MCL1-01      ------------------------------ctcttgtgg-----------
A0A3Q2Y539_MCL1-01      ------------------------------gcctcttcg-----------
Q0KFR9_MCL1-01          ------------------------------ccctcctag-----------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      ------------------------------cccttatgg-----------
A0A3B3CEX1_MCL1-01      ------------------------------ctttggtgg-----------
A0A3B3CEX1_MCL1-02      ------------------------------ctttggtgg-----------
A0A3P9ILF6_MCL1-01      ------------------------------ctttggtgg-----------
A0A3P9ILF6_MCL1-02      ------------------------------ctttggtgg-----------
A0A3B3IJ04_MCL1-01      ------------------------------ctttggtgg-----------
A0A3B3IJ04_MCL1-02      ------------------------------ctttggtgg-----------
A0A3P9L1F3_MCL1-02      ------------------------------ctttggtgg-----------
A0A3P9L1F3_MCL1-01      ------------------------------ctttggtgg-----------
H3AR18_MCL1-02          ------------------------------tattgatga-----------
H3AR18_MCL1-01          ------------------------------tattgatga-----------
A0A3Q2XZL8_MCL1-01      ------------------------------cattaatgg-----------
A0A3B4AFB7_MCL1-01      ------------------------------cgcttatgg-----------
A0A3B4AFB7_MCL1-02      ------------------------------cgcttatgg-----------
A0A3B1IEV7_MCL1-01      ------------------------------ccctgatgg-----------
A0A3B4CGU9_MCL1-03      ------------------------------ctcttatgg-----------
A0A3B4CGU9_MCL1-02      ------------------------------ctcttatgg-----------
W5MMB7_MCL1-01          ------------------------------ccctgatgg-----------
A0A3P8VKM5_MCL1-03      ------------------------------ccctccttg-----------
A0A3P8VKM5_MCL1-05      ------------------------------ccctccttg-----------
A0A3P8VKM5_MCL1-04      ------------------------------ccctccttg-----------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ------------------------------tgctgatgg-----------
G1MPY7_MCL1-01          ------------------------------tgctgatgg-----------
A0A1L1RNM6_MCL1-01      ------------------------------tgctgatgg-----------
A0A1L1RNM6_MCL1-02      ------------------------------tgctgatgg-----------
H9GEA6_MCL1-02          ------------------------------ttctggtgg-----------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          ------------------------------ttctggtgg-----------
G3TVG9_MCL1-01          ------------------------------tgcagctgg-----------
G3WBC5_MCL1-01          ------------------------------tgctgctcg-----------
F6ZMX1_MCL1-03          ------------------------------tgctgctcg-----------
F6ZMX1_MCL1-01          cgccccctcctcggcatacctcctcctctgcgcagaacc-----------
F6ZMX1_MCL1-02          ---------------------------------agaggc-----------
H0XHA5_MCL1-01          ------------------------------tgctgctgg-----------
G1QAV8_MCL1-01          ------------------------------tgctgctgg-----------
G1PZ39_MCL1-01          ------------------------------tgctgctgg-----------
P97287_MCL1-01          ------------------------------tgctgctgg-----------
Q9Z1P3_MCL1-01          ------------------------------tgctgctgg-----------
A0A2K6F6N9_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5DMS4_MCL1-01      ------------------------------ggctgctgg-----------
A0A286Y1M5_MCL1-01      ------------------------------tgctgctgg-----------
A0A287DCH9_MCL1-02      ------------------------------tgctgctgg-----------
A0A287DCH9_MCL1-01      ------------------------------tgctgctgg-----------
G1T2Q0_MCL1-02          ------------------------------tgctgctgg-----------
G1T2Q0_MCL1-01          ------------------------------tgctgctgg-----------
G3T756_MCL1-01          ------------------------------tgctgctgg-----------
A0A1S3F3I1_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K6GI15_MCL1-01      ------------------------------tgctgctgg-----------
F7AVA6_MCL1-02          ------------------------------tgctgctgg-----------
F7AVA6_MCL1-01          ------------------------------tgctgctgg-----------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          ------------------------------tgctgctgg-----------
A0A337S3J9_MCL1-04      ------------------------------tgctgctgg-----------
A0A337S3J9_MCL1-03      ------------------------------tgctgctgg-----------
Q8HYS5_MCL1-01          ------------------------------tgctgctgg-----------
F1PAP1_MCL1-01          ------------------------------tgctgctgg-----------
F1PAP1_MCL1-02          ------------------------------tgctgctgg-----------
M3XZZ5_MCL1-01          ------------------------------tgctgctgg-----------
Q95KR3_MCL1-01          ------------------------------tgctgctgg-----------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      ------------------------------tgctgctgg-----------
A0A452RHX5_MCL1-01      ------------------------------tgctgctgg-----------
G1L3L7_MCL1-02          ------------------------------tgctgctgg-----------
G1L3L7_MCL1-01          ------------------------------tgctgctgg-----------
W5QI41_MCL1-01          ------------------------------tgctgctgg-----------
F1MQX4_MCL1-01          ------------------------------tgctgctgg-----------
A5PJR2_MCL1-01          ------------------------------tgctgctgg-----------
A0A452GA25_MCL1-02      ------------------------------tgctgctgg-----------
A0A452GA25_MCL1-01      ------------------------------tgctgctgg-----------
G2HFR3_MCL1-01          ------------------------------tgctgctgg-----------
A0A2K5EPX0_MCL1-02      ------------------------------tgctgctgg-----------
A0A2K5EPX0_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5C7L5_MCL1-01      ------------------------------tgctgctgg-----------
H0XFB7_MCL1-01          ------------------------------tgctgctgg-----------
A0A2K6GI15_MCL1-03      ------------------------------tgctgctgg-----------
A0A2K5I9I0_MCL1-02      ------------------------------tgctgctgg-----------
H2N5Y9_MCL1-01          ------------------------------tgctgctgg-----------
C8YZ26_MCL1-01          ------------------------------tgctgctgg-----------
A0A2I2YQH7_MCL1-01      ------------------------------tgctgctgg-----------
A0A2I2YQH7_MCL1-03      ------------------------------tgctgctgg-----------
B4E3L8_MCL1-01          ------------------------------tgctgctgg-----------
B4DG83_MCL1-01          ------------------------------tgctgctgg-----------
B4DU51_MCL1-01          ------------------------------tgctgctgg-----------
Q07820_MCL1-04          ------------------------------tgctgctgg-----------
B4DLY8_MCL1-01          ------------------------------tgctgctgg-----------
A0A2I3RTV4_MCL1-01      ------------------------------tgctgctgg-----------
A0A2R9BPJ5_MCL1-03      ------------------------------tgctgctgg-----------
A0A2I3RTV4_MCL1-03      ------------------------------tgctgctgg-----------
A0A2R9BPJ5_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5I9I0_MCL1-03      ------------------------------tgctgctgg-----------
A0A2I3GJZ3_MCL1-01      ------------------------------tgctgctgg-----------
A0A2I3GJZ3_MCL1-02      ------------------------------tgctgctgg-----------
A0A2K6KRW9_MCL1-02      ------------------------------tgctgctgg-----------
A0A2K6PPI3_MCL1-02      ------------------------------tgctgctgg-----------
A0A2K6KRW9_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K6PPI3_MCL1-03      ------------------------------tgctgctgg-----------
A0A2I3LFM0_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5W0W9_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K6ECR0_MCL1-02      ------------------------------tgctgctgg-----------
I7G687_MCL1-01          ------------------------------tgctgctgg-----------
A0A2K5LXU8_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5LXU8_MCL1-03      ------------------------------tgctgctgg-----------
A0A0D9RZP5_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5W0W9_MCL1-03      ------------------------------tgctgctgg-----------
A0A2K6ECR0_MCL1-03      ------------------------------tgctgctgg-----------
A0A2K5XSB2_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5XSB2_MCL1-03      ------------------------------tgctgctgg-----------
A0A2I3LFM0_MCL1-03      ------------------------------tgctgctgg-----------
A0A2K5R5E2_MCL1-03      ------------------------------tgctgctgg-----------
A0A2K6V5Y3_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K6V5Y3_MCL1-03      ------------------------------tgctgctgg-----------
A0A2K5R5E2_MCL1-04      ------------------------------tgctgctgg-----------
F7GTF7_MCL1-01          ------------------------------tgctgctgg-----------
F7GTF7_MCL1-02          ------------------------------tgctgctgg-----------
A0A2K5CFH3_MCL1-01      ------------------------------tgctgctgg-----------
A0A2K5CFH3_MCL1-03      ------------------------------tgctgctgg-----------
D2ITA0_MCL1-03          ------------------------------cactcatgg-----------
D2ITA0_MCL1-04          ------------------------------cactcatgg-----------
A0A3P8V8T6_MCL1-01      ------------------------------cacttcttg-----------
Q4SW32_MCL1-01          ------------------------------tgctgatgg-----------
A0A3B5PQ55_MCL1-01      ------------------------------cgctgatgg-----------
A0A3B5PQ55_MCL1-02      ------------------------------cgctgatgg-----------
A0A3P9Q4I8_MCL1-01      ------------------------------cgctgatgg-----------
A0A3P9Q4I8_MCL1-02      ------------------------------cgctgatgg-----------
A0A3B3VM25_MCL1-01      ------------------------------cgctgatgg-----------
A0A087X830_MCL1-01      ------------------------------cgctgatgg-----------
A0A3B3YCD0_MCL1-01      ------------------------------cgctgatgg-----------
A0A3Q3VP02_MCL1-01      ------------------------------cgctcatga-----------
G3PJT0_MCL1-01          ------------------------------ctctcatgg-----------
A0A2U9CJ81_MCL1-01      ------------------------------cactgattg-----------
A0A3Q3B4P5_MCL1-01      ------------------------------cactgatgg-----------
A0A3Q3B4P5_MCL1-02      ------------------------------cactgatgg-----------
A0A3Q3IZW0_MCL1-01      ------------------------------cacttatgg-----------
A0A3Q3GP42_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q1GX28_MCL1-02      ------------------------------cactcatgg-----------
A0A3Q1GX28_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q3M6G2_MCL1-01      ------------------------------cactgatgg-----------
A0A3Q3M6G2_MCL1-02      ------------------------------cactgatgg-----------
A0A3B4T8L9_MCL1-01      ------------------------------cactcatgg-----------
A0A3B4T8L9_MCL1-02      ------------------------------cactcatgg-----------
A0A3B4XKA5_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q0R633_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q0R633_MCL1-03      ------------------------------cactcatgg-----------
I3KXG5_MCL1-01          ------------------------------cactcatgg-----------
I3JHR5_MCL1-03          ------------------------------gacaaaaggaaaaatgtttc
I3JHR5_MCL1-02          ------------------------------cactcatgg-----------
I3JHR5_MCL1-01          ------------------------------cactcatgg-----------
A0A3Q4HLQ8_MCL1-01      ------------------------------cactcatgg-----------
A0A3P9BVM3_MCL1-01      ------------------------------cactcatgg-----------
A0A3P8NP63_MCL1-02      ------------------------------cactcatgg-----------
A0A3P8NP63_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q2VNL8_MCL1-01      ------------------------------cgctcatgg-----------
A0A3B4G4Z6_MCL1-01      ------------------------------cgctcatgg-----------
A0A3B4ZKP6_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q1EQB9_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q1EQB9_MCL1-02      ------------------------------cactcatgg-----------
A0A3P8RQX7_MCL1-02      ------------------------------cactcatgg-----------
A0A3P8RQX7_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q1BKL8_MCL1-01      ------------------------------cactcatgg-----------
A0A3Q1BKL8_MCL1-02      ------------------------------cactcatgg-----------
A0A3Q2EDX8_MCL1-01      ------------------------------ctctcatgg-----------
A0A3Q2P7X9_MCL1-02      ------------------------------cgctcatgg-----------
A0A3Q2P7X9_MCL1-01      ------------------------------cgctcatgg-----------
                                                                          

A0A3B3SG34_MCL1-01      -----tacatgtttctgagtgcggatcc-tttgaattacatga---cctt
A2BF68_MCL1-02          -----caattggtggtgtggctacatta-agtgcagcacttgc---ctat
Q8UWD6_MCL1-01          -----caattggtagtgtggctacatta-agtgcagcacttgc---ctat
A2BF68_MCL1-01          -----caattggtggtgtggctacatta-agtgcagcacttgc---ctat
Q568W5_MCL1-01          -----caattggtggtgtggctacatta-agtgcagcacttgc---ctat
A0A3B1K5R1_MCL1-01      -----cctttgttactgtggcaggtctt-ggagcctcaatagc---attt
A0A3B4C6H5_MCL1-01      -----ccttggttactgcagcaggtgtt-ggagcaggacttgt---ttta
A0A3B4C6H5_MCL1-03      -----ccttggttactgcagcaggtgtt-ggagcaggacttgt---ttta
B6V6J0_MCL1-01          -----ctttctcaagtgttgctgttctt-ggggccggtttggc---gtac
Q568V1_MCL1-01          -----cgctggtcggatgtgccggtatc-ggcgccggtctggc---cttc
Q1L8X3_MCL1-01          -----cgctggtcggatgtgccggtatc-ggtgccggtctggc---cttc
Q9I9N3_MCL1-01          -----cgctggtcggatgtgccggtatc-ggtgccggtctggc---cttc
J7H260_MCL1-01          -----ccttcgctggtgtggctggtctt-ggagcaagcctggc---gtac
A0A3B3R4U0_MCL1-01      -----catttgcaggagttgcaagcctg-ggggctggacttgc---tctg
A0A3Q2Y539_MCL1-01      -----cctttgttggtttggtcagcgtc-actgcagcgctacg---ctgt
Q0KFR9_MCL1-01          -----cctttgctggagttgctggaatt-ggggcaacactcgc---catg
A0A3P8Y1W8_MCL1-02      ------------------------gatt-gg------actatt---cctg
A0A3P8Y1W8_MCL1-01      -----cctttgcaggagttgctggaatt-ggggcaacacttgc---cctg
A0A3B3CEX1_MCL1-01      -----ccgtccttggacttgcaggcgtt-ggggctttactggc---ccag
A0A3B3CEX1_MCL1-02      -----ccgtccttggacttgcaggcgtt-ggggctttactggc---ccag
A0A3P9ILF6_MCL1-01      -----ccttccttggaattgctggcgtt-ggggctttactggc---ccag
A0A3P9ILF6_MCL1-02      -----ccttccttggaattgctggcgtt-ggggctttactggc---ccag
A0A3B3IJ04_MCL1-01      -----ccttccttggaattgctggcgtt-ggggctttactggc---ccag
A0A3B3IJ04_MCL1-02      -----ccttccttggaattgctggcgtt-ggggctttactggc---ccag
A0A3P9L1F3_MCL1-02      -----ccttccttggaattgctggcgtt-ggggctttactggc---ccag
A0A3P9L1F3_MCL1-01      -----ccttccttggaattgctggcgtt-ggggctttactggc---ccag
H3AR18_MCL1-02          -----catttgcgggcgttgctggactg-ggtgcaagtctggt---ctac
H3AR18_MCL1-01          -----catttgcgggcgttgctggactg-ggtgcaagtctggt---ctac
A0A3Q2XZL8_MCL1-01      -----cctttgctggagtggctggcatt-ggcgccacactggc---cctg
A0A3B4AFB7_MCL1-01      -----ctgtagctggattagctggtatt-ggtgcaacgctggc---catg
A0A3B4AFB7_MCL1-02      -----ctgtagctggattagctggtatt-ggtgcaacgctggc---catg
A0A3B1IEV7_MCL1-01      -----ccttcgctggatttgccgggctg-ggggcggggctagc---acta
A0A3B4CGU9_MCL1-03      -----ccttcgcgggattcgctggcctg-ggggcggggctagc---acta
A0A3B4CGU9_MCL1-02      -----ccttcgcgggattcgctggcctg-ggggcggggctagc---acta
W5MMB7_MCL1-01          -----cgtttgccggggtggcggggctg-ggcgcggggctggc---cctg
A0A3P8VKM5_MCL1-03      -----gtctttttggagttgctggactc-ggggcaacactggc---cctg
A0A3P8VKM5_MCL1-05      -----gtctttttggagttgctggactc-ggggcaacactggc---cctg
A0A3P8VKM5_MCL1-04      -----gtctttttggagttgctggactc-ggggcaacactggc---cctg
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      -----cgttcgcaggagtggctggactg-ggagcgagcttggc---ctac
G1MPY7_MCL1-01          -----cctttgcaggagtggccggcctg-ggggcgagcttggc---ctac
A0A1L1RNM6_MCL1-01      -----cctttgcaggagtggccggcctg-ggggcgagcttggc---ctac
A0A1L1RNM6_MCL1-02      -----cctttgcaggagtggccggcctg-ggggcgagcttggc---ctac
H9GEA6_MCL1-02          -----cttttgccagtgtggctggaata-ggggcaggcttggc---ctac
H9GEA6_MCL1-01          -----------caactgtgtctga--------------------------
K7FPN7_MCL1-01          -----cttttgcaggctttgctggactg-ggtgcaagcttggc---gtac
G3TVG9_MCL1-01          -----cttttgcaggt----------------------------------
G3WBC5_MCL1-01          -----cctttgccggtgttgctggagta-ggagctggtttggc---atat
F6ZMX1_MCL1-03          -----cctttgccggtgttgctggagta-ggagctggtttggc---atat
F6ZMX1_MCL1-01          -----cttgttctggtggtgccagctcacagcatcgggctgtc---atgt
F6ZMX1_MCL1-02          -----cttgt----------------------------------------
H0XHA5_MCL1-01          -----ctttcgcaggtgttgctggagta-ggagctggcttgac---ctat
G1QAV8_MCL1-01          -----cttttgcaggt---gctggagta-ggagctggtttgcc---atat
G1PZ39_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
P97287_MCL1-01          -----cttttgcgggtgttgctggagta-ggggctggtctggc---atat
Q9Z1P3_MCL1-01          -----cttttgcgggtgttgctggagta-ggggctggtctggc---atat
A0A2K6F6N9_MCL1-01      -----cttttgctggtgttgctggagta-ggagctggtttgac---ttat
A0A2K5DMS4_MCL1-01      -----ctttcgcaggtgttgctggagta-ggaactgatttggc---atat
A0A286Y1M5_MCL1-01      -----cttttgcaggtgttgctggagta-ggggctggtttggc---atat
A0A287DCH9_MCL1-02      -----ctttcgcaggtgttgctggcgta-ggagctggtttggc---atat
A0A287DCH9_MCL1-01      -----ctttcgcaggtgttgctggcgta-ggagctggtttggc---atat
G1T2Q0_MCL1-02          -----cttttgcgggtgttgccggagta-ggagcggggctggc---ttat
G1T2Q0_MCL1-01          -----cttttgcgggtgttgccggagta-ggagcggggctggc---ttat
G3T756_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A1S3F3I1_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6GI15_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
F7AVA6_MCL1-02          -----cttttgcaggtgttgctggagta-ggcgctggtttggc---atat
F7AVA6_MCL1-01          -----cttttgcaggtgttgctggagta-ggcgctggtttggc---atat
A0A337S3J9_MCL1-01      ------------agataaggcttga-------------------------
Q7YRZ9_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A337S3J9_MCL1-04      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A337S3J9_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
Q8HYS5_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
F1PAP1_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
F1PAP1_MCL1-02          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
M3XZZ5_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
Q95KR3_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A287BK44_MCL1-02      ------------------------------------------------at
A0A287BK44_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A452RHX5_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
G1L3L7_MCL1-02          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
G1L3L7_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
W5QI41_MCL1-01          -----cttttgcaggtgttgccggagta-ggagctggtttggc---atat
F1MQX4_MCL1-01          -----cttttgcaggtgttgccggagta-ggagctggtttggc---atat
A5PJR2_MCL1-01          -----cttttgcaggtgttgccggagta-ggagctggtttggc---atat
A0A452GA25_MCL1-02      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A452GA25_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
G2HFR3_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5EPX0_MCL1-02      -----cttttgcatgtgttgctggagta-ggagctggtttggc---atat
A0A2K5EPX0_MCL1-01      -----cttttgcatgtgttgctggagta-ggagctggtttggc---atat
A0A2K5C7L5_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
H0XFB7_MCL1-01          -----cttttgcgggtgttgctggagta-ggagctggtttggc---atat
A0A2K6GI15_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5I9I0_MCL1-02      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
H2N5Y9_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
C8YZ26_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I2YQH7_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I2YQH7_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
B4E3L8_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
B4DG83_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
B4DU51_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
Q07820_MCL1-04          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
B4DLY8_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I3RTV4_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2R9BPJ5_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I3RTV4_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2R9BPJ5_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5I9I0_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I3GJZ3_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I3GJZ3_MCL1-02      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6KRW9_MCL1-02      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6PPI3_MCL1-02      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6KRW9_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6PPI3_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I3LFM0_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5W0W9_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6ECR0_MCL1-02      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
I7G687_MCL1-01          -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5LXU8_MCL1-01      -----ctgttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5LXU8_MCL1-03      -----ctgttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A0D9RZP5_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5W0W9_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6ECR0_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5XSB2_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5XSB2_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2I3LFM0_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5R5E2_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6V5Y3_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K6V5Y3_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
A0A2K5R5E2_MCL1-04      -----cttttgcaggtgttgctggagta-ggagctggtttggc---atat
F7GTF7_MCL1-01          -----cttttgcgggtgttgctggagta-ggagctgggttggc---atat
F7GTF7_MCL1-02          -----cttttgcgggtgttgctggagta-ggagctgggttggc---atat
A0A2K5CFH3_MCL1-01      -----cttttgcaggtgttgctggagta-ggagctggtttggcactgtct
A0A2K5CFH3_MCL1-03      -----cttttgcaggtgttgctggagta-ggagctggtttggc-------
D2ITA0_MCL1-03          -----cctttgctggatttgctggtatt-ggtgcaacaattgc---ccta
D2ITA0_MCL1-04          -----cctttgctggatttgctggtatt-ggtgcaacaattgc---ccta
A0A3P8V8T6_MCL1-01      -----gctttgttgggtttgcaggactt-tgggcaacacttgc---ctta
Q4SW32_MCL1-01          -----ccgtggcaggagtggctgggatc-ggcgccaagctggc---gctg
A0A3B5PQ55_MCL1-01      -----ctgttgtgggggtcgctggtatt-ggggccaccttagc---cttt
A0A3B5PQ55_MCL1-02      -----ctgttgtgggggtcgctggtatt-ggggccaccttagc---cttt
A0A3P9Q4I8_MCL1-01      -----cgtttgttggggtcgctggtatt-ggggcaacattagc---cttt
A0A3P9Q4I8_MCL1-02      -----cgtttgttggggtcgctggtatt-ggggcaacattagc---cttt
A0A3B3VM25_MCL1-01      -----cgtttgttggggtcgctggtatt-ggggcaacattagc---cttt
A0A087X830_MCL1-01      -----cgtttgttggggtcgctggtatt-ggggcaacattagc---cttt
A0A3B3YCD0_MCL1-01      -----cgtttgttggggtcgctggtatt-ggggcaacattagc---cttt
A0A3Q3VP02_MCL1-01      -----ccattgctggagttgctggtatt-ggggcgacactggc---cctg
G3PJT0_MCL1-01          -----ctgtggctggattcgctagtatt-ggggcgacactggc---cctg
A0A2U9CJ81_MCL1-01      -----gccttgctggatttgctggtgtt-ggggcgacactggc---cctg
A0A3Q3B4P5_MCL1-01      -----ctgtagccggatttgctgggctt-ggggcaacactggc---ctta
A0A3Q3B4P5_MCL1-02      -----ctgtagccggatttgctgggctt-ggggcaacactggc---ctta
A0A3Q3IZW0_MCL1-01      -----cctttgctggatttgctggtatc-ggggcaactctggc---cctg
A0A3Q3GP42_MCL1-01      -----cttttgctgggttcgcaggaatt-ggggccacgttggc---cctg
A0A3Q1GX28_MCL1-02      -----cctttgcaggattggctggtatt-ggggcatcactggc---cctg
A0A3Q1GX28_MCL1-01      -----cctttgcaggattggctggtatt-ggggcatcactggc---cctg
A0A3Q3M6G2_MCL1-01      -----ctgttgctggtgttgctggtctt-ggggcaactctggc---cctg
A0A3Q3M6G2_MCL1-02      -----ctgttgctggtgttgctggtctt-ggggcaactctggc---cctg
A0A3B4T8L9_MCL1-01      -----cctttgctggatttgcgggaatc-ggcgcaacactggc---cctg
A0A3B4T8L9_MCL1-02      -----cctttgctggatttgcgggaatc-ggcgcaacactggc---cctg
A0A3B4XKA5_MCL1-01      -----cctttgctggatttgcgggaatc-ggcgcaacactggc---cctg
A0A3Q0R633_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3Q0R633_MCL1-03      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
I3KXG5_MCL1-01          -----cctttgctggatttgcttgtatt-ggggcaacactggc---actg
I3JHR5_MCL1-03          aaattacattatttaattcacagagat-----------ctatt---tttg
I3JHR5_MCL1-02          -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
I3JHR5_MCL1-01          -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3Q4HLQ8_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3P9BVM3_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3P8NP63_MCL1-02      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3P8NP63_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3Q2VNL8_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3B4G4Z6_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3B4ZKP6_MCL1-01      -----cctttgctggatttgccggtatt-ggggcgacactggc---cctg
A0A3Q1EQB9_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3Q1EQB9_MCL1-02      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3P8RQX7_MCL1-02      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3P8RQX7_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3Q1BKL8_MCL1-01      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3Q1BKL8_MCL1-02      -----cctttgctggatttgctggtatt-ggggcaacactggc---cctg
A0A3Q2EDX8_MCL1-01      -----cttttgttggagtggctggtatt-ggggcaacattggc---cttt
A0A3Q2P7X9_MCL1-02      -----cgttcgttggggtcgctgggatt-ggggcaggattggc---cttt
A0A3Q2P7X9_MCL1-01      -----cgttcgttggggtcgctgggatt-ggggcaggattggc---cttt
                                                                          

A0A3B3SG34_MCL1-01      aaagcc--------------------ttgt-----------------gc-
A2BF68_MCL1-02          --------------------------tgga-----------------ta-
Q8UWD6_MCL1-01          --------------------------tgga-----------------ta-
A2BF68_MCL1-01          --------------------------tgga-----------------ta-
Q568W5_MCL1-01          --------------------------tgga-----------------ta-
A0A3B1K5R1_MCL1-01      --------------------------ttgg-----------------ca-
A0A3B4C6H5_MCL1-01      --------------------------ttgt-----------------ca-
A0A3B4C6H5_MCL1-03      --------------------------ttgt-----------------ca-
B6V6J0_MCL1-01          --------------------------atga-----------------tc-
Q568V1_MCL1-01          --------------------------ctca-----------------tc-
Q1L8X3_MCL1-01          --------------------------ctca-----------------tc-
Q9I9N3_MCL1-01          --------------------------ctca-----------------tc-
J7H260_MCL1-01          --------------------------atga-----------------tc-
A0A3B3R4U0_MCL1-01      --------------------------ttga-----------------tg-
A0A3Q2Y539_MCL1-01      --------------------------ctga-----------------tt-
Q0KFR9_MCL1-01          --------------------------ttca-----------------tc-
A0A3P8Y1W8_MCL1-02      --------------------------caag-----------------tt-
A0A3P8Y1W8_MCL1-01      --------------------------ttaa-----------------tc-
A0A3B3CEX1_MCL1-01      --------------------------gtgc--------------------
A0A3B3CEX1_MCL1-02      --------------------------gtgt--------------------
A0A3P9ILF6_MCL1-01      --------------------------ct-t--------------------
A0A3P9ILF6_MCL1-02      --------------------------ct-t--------------------
A0A3B3IJ04_MCL1-01      --------------------------ct-t--------------------
A0A3B3IJ04_MCL1-02      --------------------------ct-t--------------------
A0A3P9L1F3_MCL1-02      --------------------------ct-t--------------------
A0A3P9L1F3_MCL1-01      --------------------------ct-t--------------------
H3AR18_MCL1-02          --------------------------ttga-----------------tg-
H3AR18_MCL1-01          --------------------------ttga-----------------tg-
A0A3Q2XZL8_MCL1-01      --------------------------ttga-----------------tc-
A0A3B4AFB7_MCL1-01      --------------------------ttga-----------------tc-
A0A3B4AFB7_MCL1-02      --------------------------ttga-----------------tc-
A0A3B1IEV7_MCL1-01      --------------------------ctga-----------------tg-
A0A3B4CGU9_MCL1-03      --------------------------ctga-----------------tg-
A0A3B4CGU9_MCL1-02      --------------------------ctga-----------------tg-
W5MMB7_MCL1-01          --------------------------ctga-----------------tc-
A0A3P8VKM5_MCL1-03      --------------------------ttga-----------------tc-
A0A3P8VKM5_MCL1-05      --------------------------ttga-----------------tc-
A0A3P8VKM5_MCL1-04      --------------------------ttga-----------------tc-
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------atga-----------------tc-
G1MPY7_MCL1-01          --------------------------atga-----------------tc-
A0A1L1RNM6_MCL1-01      --------------------------atga-----------------tc-
A0A1L1RNM6_MCL1-02      --------------------------atga-----------------tc-
H9GEA6_MCL1-02          --------------------------atga-----------------tc-
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------atga-----------------tg-
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------ctaa-----------------ta-
F6ZMX1_MCL1-03          --------------------------ctaa-----------------ta-
F6ZMX1_MCL1-01          tccggataagcccaggaatgtgcttactga-----------------gg-
F6ZMX1_MCL1-02          --------------------------ctca-----------------gg-
H0XHA5_MCL1-01          --------------------------ctaa-----------------ta-
G1QAV8_MCL1-01          --------------------------ctaa-----------------ta-
G1PZ39_MCL1-01          --------------------------ctaa-----------------ta-
P97287_MCL1-01          --------------------------ctaa-----------------ta-
Q9Z1P3_MCL1-01          --------------------------ctaa-----------------ta-
A0A2K6F6N9_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K5DMS4_MCL1-01      --------------------------ctaa-----------------ta-
A0A286Y1M5_MCL1-01      --------------------------ctaa-----------------ta-
A0A287DCH9_MCL1-02      --------------------------ctaa-----------------ta-
A0A287DCH9_MCL1-01      --------------------------ctaa-----------------ta-
G1T2Q0_MCL1-02          --------------------------ctga-----------------ta-
G1T2Q0_MCL1-01          --------------------------ctga-----------------ta-
G3T756_MCL1-01          --------------------------ctaa-----------------ta-
A0A1S3F3I1_MCL1-01      --------------------------ctca-----------------ta-
A0A2K6GI15_MCL1-01      --------------------------ctaa-----------------ta-
F7AVA6_MCL1-02          --------------------------ctaa-----------------ta-
F7AVA6_MCL1-01          --------------------------ctaa-----------------ta-
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------ctaa-----------------ta-
A0A337S3J9_MCL1-04      --------------------------ctaa-----------------ta-
A0A337S3J9_MCL1-03      --------------------------ctaa-----------------ta-
Q8HYS5_MCL1-01          --------------------------ctaa-----------------ta-
F1PAP1_MCL1-01          --------------------------ctaa-----------------ta-
F1PAP1_MCL1-02          --------------------------ctaa-----------------ta-
M3XZZ5_MCL1-01          --------------------------ctaa-----------------ta-
Q95KR3_MCL1-01          --------------------------ctaa-----------------ta-
A0A287BK44_MCL1-02      --------------------------ctaa-----------------ta-
A0A287BK44_MCL1-01      --------------------------ctaa-----------------ta-
A0A452RHX5_MCL1-01      --------------------------ctaa-----------------ta-
G1L3L7_MCL1-02          --------------------------ctaa-----------------ta-
G1L3L7_MCL1-01          --------------------------ctaa-----------------ta-
W5QI41_MCL1-01          --------------------------ctaa-----------------ta-
F1MQX4_MCL1-01          --------------------------ctaa-----------------ta-
A5PJR2_MCL1-01          --------------------------ctaa-----------------ta-
A0A452GA25_MCL1-02      --------------------------ctaa-----------------ta-
A0A452GA25_MCL1-01      --------------------------ctaa-----------------ta-
G2HFR3_MCL1-01          --------------------------ctaa-----------------ta-
A0A2K5EPX0_MCL1-02      --------------------------ctaa-----------------ta-
A0A2K5EPX0_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K5C7L5_MCL1-01      --------------------------ctaa-----------------ta-
H0XFB7_MCL1-01          --------------------------ctaa-----------------ta-
A0A2K6GI15_MCL1-03      --------------------------ctaa-----------------ta-
A0A2K5I9I0_MCL1-02      --------------------------ctaa-----------------tc-
H2N5Y9_MCL1-01          --------------------------ctaa-----------------ta-
C8YZ26_MCL1-01          --------------------------ctaa-----------------aa-
A0A2I2YQH7_MCL1-01      --------------------------ctaa-----------------ta-
A0A2I2YQH7_MCL1-03      --------------------------ctaa-----------------ta-
B4E3L8_MCL1-01          --------------------------ctaa-----------------ta-
B4DG83_MCL1-01          --------------------------ctaa-----------------ta-
B4DU51_MCL1-01          --------------------------ctaa-----------------ta-
Q07820_MCL1-04          --------------------------ctaa-----------------ta-
B4DLY8_MCL1-01          --------------------------ctaa-----------------ta-
A0A2I3RTV4_MCL1-01      --------------------------ctaa-----------------ta-
A0A2R9BPJ5_MCL1-03      --------------------------ctaa-----------------ta-
A0A2I3RTV4_MCL1-03      --------------------------ctaa-----------------ta-
A0A2R9BPJ5_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K5I9I0_MCL1-03      --------------------------ctaa-----------------tc-
A0A2I3GJZ3_MCL1-01      --------------------------ctaa-----------------ta-
A0A2I3GJZ3_MCL1-02      --------------------------ctaa-----------------ta-
A0A2K6KRW9_MCL1-02      --------------------------ctaa-----------------ta-
A0A2K6PPI3_MCL1-02      --------------------------ctaa-----------------ta-
A0A2K6KRW9_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K6PPI3_MCL1-03      --------------------------ctaa-----------------ta-
A0A2I3LFM0_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K5W0W9_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K6ECR0_MCL1-02      --------------------------ctaa-----------------ta-
I7G687_MCL1-01          --------------------------ctaa-----------------ta-
A0A2K5LXU8_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K5LXU8_MCL1-03      --------------------------ctaa-----------------ta-
A0A0D9RZP5_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K5W0W9_MCL1-03      --------------------------ctaa-----------------ta-
A0A2K6ECR0_MCL1-03      --------------------------ctaa-----------------ta-
A0A2K5XSB2_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K5XSB2_MCL1-03      --------------------------ctaa-----------------ta-
A0A2I3LFM0_MCL1-03      --------------------------ctaa-----------------ta-
A0A2K5R5E2_MCL1-03      --------------------------ctaa-----------------ta-
A0A2K6V5Y3_MCL1-01      --------------------------ctaa-----------------ta-
A0A2K6V5Y3_MCL1-03      --------------------------ctaa-----------------ta-
A0A2K5R5E2_MCL1-04      --------------------------ctaa-----------------ta-
F7GTF7_MCL1-01          --------------------------ctaa-----------------ta-
F7GTF7_MCL1-02          --------------------------ctaa-----------------ta-
A0A2K5CFH3_MCL1-01      --------------------------ctta-----------------tac
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --------------------------ctaa-----------------tc-
D2ITA0_MCL1-04          --------------------------ctaa-----------------tc-
A0A3P8V8T6_MCL1-01      --------------------------ctga-----------------tg-
Q4SW32_MCL1-01          --------------------------ctga-----------------tc-
A0A3B5PQ55_MCL1-01      --------------------------ctta-----------------tc-
A0A3B5PQ55_MCL1-02      --------------------------ctta-----------------tc-
A0A3P9Q4I8_MCL1-01      --------------------------ctca-----------------tc-
A0A3P9Q4I8_MCL1-02      --------------------------ctca-----------------tc-
A0A3B3VM25_MCL1-01      --------------------------ctca-----------------tc-
A0A087X830_MCL1-01      --------------------------ctca-----------------tc-
A0A3B3YCD0_MCL1-01      --------------------------ctca-----------------tc-
A0A3Q3VP02_MCL1-01      --------------------------ttga-----------------tc-
G3PJT0_MCL1-01          --------------------------ttga-----------------tc-
A0A2U9CJ81_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q3B4P5_MCL1-01      --------------------------ttga-----------------ta-
A0A3Q3B4P5_MCL1-02      --------------------------ttga-----------------ta-
A0A3Q3IZW0_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q3GP42_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q1GX28_MCL1-02      --------------------------ttga-----------------tc-
A0A3Q1GX28_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q3M6G2_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q3M6G2_MCL1-02      --------------------------ttga-----------------tc-
A0A3B4T8L9_MCL1-01      --------------------------ttga-----------------tc-
A0A3B4T8L9_MCL1-02      --------------------------ttga-----------------tc-
A0A3B4XKA5_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q0R633_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q0R633_MCL1-03      --------------------------ttga-----------------tc-
I3KXG5_MCL1-01          --------------------------ttga-----------------tc-
I3JHR5_MCL1-03          --------------------------ctaa------------------a-
I3JHR5_MCL1-02          --------------------------ttgatcaggacaaacactcactc-
I3JHR5_MCL1-01          --------------------------ttga-----------------tc-
A0A3Q4HLQ8_MCL1-01      --------------------------ttga-----------------tc-
A0A3P9BVM3_MCL1-01      --------------------------ttga-----------------tc-
A0A3P8NP63_MCL1-02      --------------------------ttga-----------------tc-
A0A3P8NP63_MCL1-01      --------------------------ttga-----------------tc-
A0A3Q2VNL8_MCL1-01      --------------------------ttga-----------------tc-
A0A3B4G4Z6_MCL1-01      --------------------------ttga-----------------tc-
A0A3B4ZKP6_MCL1-01      --------------------------ctga-----------------tc-
A0A3Q1EQB9_MCL1-01      --------------------------ctga-----------------tc-
A0A3Q1EQB9_MCL1-02      --------------------------ctga-----------------tc-
A0A3P8RQX7_MCL1-02      --------------------------ctga-----------------tc-
A0A3P8RQX7_MCL1-01      --------------------------ctga-----------------tc-
A0A3Q1BKL8_MCL1-01      --------------------------ctga-----------------tc-
A0A3Q1BKL8_MCL1-02      --------------------------ctga-----------------tc-
A0A3Q2EDX8_MCL1-01      --------------------------ctga-----------------tc-
A0A3Q2P7X9_MCL1-02      --------------------------ctta-----------------tc-
A0A3Q2P7X9_MCL1-01      --------------------------ctta-----------------tc-
                                                                          

A0A3B3SG34_MCL1-01      --at----------------------------------------------
A2BF68_MCL1-02          --cg----------------------------------------------
Q8UWD6_MCL1-01          --cg----------------------------------------------
A2BF68_MCL1-01          --cg----------------------------------------------
Q568W5_MCL1-01          --cg----------------------------------------------
A0A3B1K5R1_MCL1-01      --ag----------------------------------------------
A0A3B4C6H5_MCL1-01      --ag----------------------------------------------
A0A3B4C6H5_MCL1-03      --ag----------------------------------------------
B6V6J0_MCL1-01          --cg----------------------------------------------
Q568V1_MCL1-01          --cg----------------------------------------------
Q1L8X3_MCL1-01          --cg----------------------------------------------
Q9I9N3_MCL1-01          --cg----------------------------------------------
J7H260_MCL1-01          --cg----------------------------------------------
A0A3B3R4U0_MCL1-01      --ag----------------------------------------------
A0A3Q2Y539_MCL1-01      --cg----------------------------------------------
Q0KFR9_MCL1-01          --ag----------------------------------------------
A0A3P8Y1W8_MCL1-02      --tt----------------------------------------------
A0A3P8Y1W8_MCL1-01      --ag----------------------------------------------
A0A3B3CEX1_MCL1-01      --aaggtccataccgtatttggcaggatatgacatcatgtcacactaatc
A0A3B3CEX1_MCL1-02      --gtag--------------------------------------------
A0A3P9ILF6_MCL1-01      --agt---------------------------------------------
A0A3P9ILF6_MCL1-02      --aatatgatggccatttttaaaggacttcctgcttctgccagacttcac
A0A3B3IJ04_MCL1-01      --agt---------------------------------------------
A0A3B3IJ04_MCL1-02      --aatatgatggccatttttaaaggacttcctgcttctaccagacttcac
A0A3P9L1F3_MCL1-02      --aatatgatggccatttttaaaggacttcctgcttctgccagacttcac
A0A3P9L1F3_MCL1-01      --agt---------------------------------------------
H3AR18_MCL1-02          --ag----------------------------------------------
H3AR18_MCL1-01          --ag----------------------------------------------
A0A3Q2XZL8_MCL1-01      --ag----------------------------------------------
A0A3B4AFB7_MCL1-01      --ag----------------------------------------------
A0A3B4AFB7_MCL1-02      --ag----------------------------------------------
A0A3B1IEV7_MCL1-01      --cg----------------------------------------------
A0A3B4CGU9_MCL1-03      --cg----------------------------------------------
A0A3B4CGU9_MCL1-02      --cg----------------------------------------------
W5MMB7_MCL1-01          --ag----------------------------------------------
A0A3P8VKM5_MCL1-03      --ag----------------------------------------------
A0A3P8VKM5_MCL1-05      --ag----------------------------------------------
A0A3P8VKM5_MCL1-04      --ag----------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --cg----------------------------------------------
G1MPY7_MCL1-01          --cg----------------------------------------------
A0A1L1RNM6_MCL1-01      --cg----------------------------------------------
A0A1L1RNM6_MCL1-02      --cg----------------------------------------------
H9GEA6_MCL1-02          --cg----------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --cg----------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --ag----------------------------------------------
F6ZMX1_MCL1-03          --ag----------------------------------------------
F6ZMX1_MCL1-01          --ag----------------------------------------------
F6ZMX1_MCL1-02          --ag----------------------------------------------
H0XHA5_MCL1-01          --ag----------------------------------------------
G1QAV8_MCL1-01          --ag----------------------------------------------
G1PZ39_MCL1-01          --ag----------------------------------------------
P97287_MCL1-01          --ag----------------------------------------------
Q9Z1P3_MCL1-01          --ag----------------------------------------------
A0A2K6F6N9_MCL1-01      --ag----------------------------------------------
A0A2K5DMS4_MCL1-01      --ag----------------------------------------------
A0A286Y1M5_MCL1-01      --ag----------------------------------------------
A0A287DCH9_MCL1-02      --ag----------------------------------------------
A0A287DCH9_MCL1-01      --ag----------------------------------------------
G1T2Q0_MCL1-02          --ag----------------------------------------------
G1T2Q0_MCL1-01          --ag----------------------------------------------
G3T756_MCL1-01          --ag----------------------------------------------
A0A1S3F3I1_MCL1-01      --ag----------------------------------------------
A0A2K6GI15_MCL1-01      --ag----------------------------------------------
F7AVA6_MCL1-02          --ag----------------------------------------------
F7AVA6_MCL1-01          --ag----------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --ag----------------------------------------------
A0A337S3J9_MCL1-04      --ag----------------------------------------------
A0A337S3J9_MCL1-03      --ag----------------------------------------------
Q8HYS5_MCL1-01          --ag----------------------------------------------
F1PAP1_MCL1-01          --ag----------------------------------------------
F1PAP1_MCL1-02          --ag----------------------------------------------
M3XZZ5_MCL1-01          --ag----------------------------------------------
Q95KR3_MCL1-01          --ag----------------------------------------------
A0A287BK44_MCL1-02      --ag----------------------------------------------
A0A287BK44_MCL1-01      --ag----------------------------------------------
A0A452RHX5_MCL1-01      --ag----------------------------------------------
G1L3L7_MCL1-02          --ag----------------------------------------------
G1L3L7_MCL1-01          --ag----------------------------------------------
W5QI41_MCL1-01          --ag----------------------------------------------
F1MQX4_MCL1-01          --ag----------------------------------------------
A5PJR2_MCL1-01          --ag----------------------------------------------
A0A452GA25_MCL1-02      --ag----------------------------------------------
A0A452GA25_MCL1-01      --ag----------------------------------------------
G2HFR3_MCL1-01          --ag----------------------------------------------
A0A2K5EPX0_MCL1-02      --ag----------------------------------------------
A0A2K5EPX0_MCL1-01      --ag----------------------------------------------
A0A2K5C7L5_MCL1-01      --ag----------------------------------------------
H0XFB7_MCL1-01          --ag----------------------------------------------
A0A2K6GI15_MCL1-03      --ag----------------------------------------------
A0A2K5I9I0_MCL1-02      --ag----------------------------------------------
H2N5Y9_MCL1-01          --ag----------------------------------------------
C8YZ26_MCL1-01          --ag----------------------------------------------
A0A2I2YQH7_MCL1-01      --ag----------------------------------------------
A0A2I2YQH7_MCL1-03      --ag----------------------------------------------
B4E3L8_MCL1-01          --ag----------------------------------------------
B4DG83_MCL1-01          --ag----------------------------------------------
B4DU51_MCL1-01          --ag----------------------------------------------
Q07820_MCL1-04          --ag----------------------------------------------
B4DLY8_MCL1-01          --ag----------------------------------------------
A0A2I3RTV4_MCL1-01      --ag----------------------------------------------
A0A2R9BPJ5_MCL1-03      --ag----------------------------------------------
A0A2I3RTV4_MCL1-03      --ag----------------------------------------------
A0A2R9BPJ5_MCL1-01      --ag----------------------------------------------
A0A2K5I9I0_MCL1-03      --ag----------------------------------------------
A0A2I3GJZ3_MCL1-01      --ag----------------------------------------------
A0A2I3GJZ3_MCL1-02      --ag----------------------------------------------
A0A2K6KRW9_MCL1-02      --ag----------------------------------------------
A0A2K6PPI3_MCL1-02      --ag----------------------------------------------
A0A2K6KRW9_MCL1-01      --ag----------------------------------------------
A0A2K6PPI3_MCL1-03      --ag----------------------------------------------
A0A2I3LFM0_MCL1-01      --ag----------------------------------------------
A0A2K5W0W9_MCL1-01      --ag----------------------------------------------
A0A2K6ECR0_MCL1-02      --ag----------------------------------------------
I7G687_MCL1-01          --ag----------------------------------------------
A0A2K5LXU8_MCL1-01      --ag----------------------------------------------
A0A2K5LXU8_MCL1-03      --ag----------------------------------------------
A0A0D9RZP5_MCL1-01      --ag----------------------------------------------
A0A2K5W0W9_MCL1-03      --ag----------------------------------------------
A0A2K6ECR0_MCL1-03      --ag----------------------------------------------
A0A2K5XSB2_MCL1-01      --ag----------------------------------------------
A0A2K5XSB2_MCL1-03      --ag----------------------------------------------
A0A2I3LFM0_MCL1-03      --ag----------------------------------------------
A0A2K5R5E2_MCL1-03      --ag----------------------------------------------
A0A2K6V5Y3_MCL1-01      --ag----------------------------------------------
A0A2K6V5Y3_MCL1-03      --ag----------------------------------------------
A0A2K5R5E2_MCL1-04      --ag----------------------------------------------
F7GTF7_MCL1-01          --ag----------------------------------------------
F7GTF7_MCL1-02          --ag----------------------------------------------
A0A2K5CFH3_MCL1-01      acat----------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --ag----------------------------------------------
D2ITA0_MCL1-04          --ag----------------------------------------------
A0A3P8V8T6_MCL1-01      --agatattttctcaggtttgtgtg-------------------------
Q4SW32_MCL1-01          --ag----------------------------------------------
A0A3B5PQ55_MCL1-01      --aggagatgcaaagagaagt-----------------------------
A0A3B5PQ55_MCL1-02      --ag---------------ct-----------------------------
A0A3P9Q4I8_MCL1-01      --agca--------------------------------------------
A0A3P9Q4I8_MCL1-02      --ag----------------------------------------------
A0A3B3VM25_MCL1-01      --agaaagctacgatcagcgcttggtcagcaaaagctaaatacaagcctt
A0A087X830_MCL1-01      --a-----------------------------------------------
A0A3B3YCD0_MCL1-01      --a-----------------------------------------------
A0A3Q3VP02_MCL1-01      --ag----------------------------------------------
G3PJT0_MCL1-01          --agtggaccttcaaaagtgcaaaggcagcttctcaccattgaattgttg
A0A2U9CJ81_MCL1-01      --ag----------------------------------------------
A0A3Q3B4P5_MCL1-01      --agtgttt-----------------------------------------
A0A3Q3B4P5_MCL1-02      --agcacttggtcagcaaaatgtgagcacaggcctctggaaaatgaatca
A0A3Q3IZW0_MCL1-01      --aggacaaacaacacttgtggaggccttaagaggaaatggagtagagcc
A0A3Q3GP42_MCL1-01      --ag----------------------------------------------
A0A3Q1GX28_MCL1-02      --ag----tgctgtccgac-------------------------------
A0A3Q1GX28_MCL1-01      --agctcctgtagtgtgat-------------------------------
A0A3Q3M6G2_MCL1-01      --agcagaaataataaaatg------------------------------
A0A3Q3M6G2_MCL1-02      --agttactgtggtgtaatg------------------------------
A0A3B4T8L9_MCL1-01      --ag----------------------------------------------
A0A3B4T8L9_MCL1-02      --aggtgtttgtttgagcggtccaggccaaagcaggaagggaaaattgca
A0A3B4XKA5_MCL1-01      --ag----------------------------------------------
A0A3Q0R633_MCL1-01      --ag----------------------------------------------
A0A3Q0R633_MCL1-03      --ag----------------------------------------------
I3KXG5_MCL1-01          --ag----------------------------------------------
I3JHR5_MCL1-03          --agatgccataataaaaaggaaaaag-----------------------
I3JHR5_MCL1-02          --aggtctcaggaagaaatggagagtgtctcgccatggtgatgatccaca
I3JHR5_MCL1-01          --aggttctgggatgca---------------------------------
A0A3Q4HLQ8_MCL1-01      --ag----------------------------------------------
A0A3P9BVM3_MCL1-01      --agttgctgggatgca---------------------------------
A0A3P8NP63_MCL1-02      --agatctt---ctaca---------------------------------
A0A3P8NP63_MCL1-01      --agttgctgggatgca---------------------------------
A0A3Q2VNL8_MCL1-01      --agtggt------------------------------------------
A0A3B4G4Z6_MCL1-01      --agttgctgggatgca---------------------------------
A0A3B4ZKP6_MCL1-01      --ag----------------------------------------------
A0A3Q1EQB9_MCL1-01      --ag----------------------------------------------
A0A3Q1EQB9_MCL1-02      --agactggaaagtaaatttggggaaacccagaggaccgggagaggagcc
A0A3P8RQX7_MCL1-02      --ag----------------------------------------------
A0A3P8RQX7_MCL1-01      --ag----------------------------------------------
A0A3Q1BKL8_MCL1-01      --ag----------------------------------------------
A0A3Q1BKL8_MCL1-02      --agtggtcttgctgctgtaggactaacacagagcactgaaaactcttgc
A0A3Q2EDX8_MCL1-01      --ag----------------------------------------------
A0A3Q2P7X9_MCL1-02      --ag----------------------------------------------
A0A3Q2P7X9_MCL1-01      --agaaatagtatcaaaatcagctttattggacaagattgttcctgggca
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      tatccaaaaataaagttggaagatcaccaagttttgctgttgaagggcc-
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      ------ag------------------------------------------
A0A3P9ILF6_MCL1-02      aactcgag------------------------------------------
A0A3B3IJ04_MCL1-01      ------ag------------------------------------------
A0A3B3IJ04_MCL1-02      aactcgag------------------------------------------
A0A3P9L1F3_MCL1-02      aactggag------------------------------------------
A0A3P9L1F3_MCL1-01      ------ag------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
H9GEA6_MCL1-02          --------------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-02          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      ----------------------------------a---------------
A0A3B5PQ55_MCL1-02      ----------------------------------t---------------
A0A3P9Q4I8_MCL1-01      ----------------------------------a---------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      ttggaaatgagagactgcacaagtctggagccagg---------------
A0A087X830_MCL1-01      ----------------------------------g---------------
A0A3B3YCD0_MCL1-01      ----------------------------------g---------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          cagatcgtgcgctctcagaggggaggacaccggctgcagcgtgat-----
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      tgtgtatctctggcgcctgggatcagaagttgctacctaagcacaaccac
A0A3Q3IZW0_MCL1-01      tctccatg------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      ----------cgccatga---t----------------------------
A0A3B4T8L9_MCL1-02      ttttttccaatgtcatgcagtc----------------------------
A0A3B4XKA5_MCL1-01      ----------cgccatga---t----------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------acattttttttccttttttgctagtc----------------
I3JHR5_MCL1-02          gcaggcctcccctaatcttctcctgtggctaatgttatctaccacccagg
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      ggaggcaaacgatggatccaggggggccggaggaaaccacaggagaggaa
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      aaggatgcacacataagtt-------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      ttcacatctcctccgacctttcctggact---------------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
H9GEA6_MCL1-02          --------------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-02          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------gttgg-------------------------------------
A0A3Q3B4P5_MCL1-02      acatttaagttgggcagcagaaatctgggctgcaggtgtggatcaacagg
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          -------------ttttt--------------------------------
I3JHR5_MCL1-02          ttacccctgtagttaact--------------------------------
I3JHR5_MCL1-01          -------------ttatt--------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      -------------ttatt--------------------------------
A0A3P8NP63_MCL1-02      -------------atctt--------------------------------
A0A3P8NP63_MCL1-01      -------------ttatt--------------------------------
A0A3Q2VNL8_MCL1-01      ----------------tt--------------------------------
A0A3B4G4Z6_MCL1-01      -------------ttatt--------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      ccggaggagacacgatgcctgcagggaccgaggcagggggcaagggaacc
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
H9GEA6_MCL1-02          --------------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-02          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      ----------ccttga----------------------------------
A0A3Q3B4P5_MCL1-02      atgagtcaaaccttaatattgggtggatcctgcctcttcacaatgactgc
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-02          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      gacagaactggagggttccaaggagggggaaccaggagggacacggagcc
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
H9GEA6_MCL1-02          --------------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-02          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      tggagacaggcaccagctccctgcgtctctgcagggaaaaggga------
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-02          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      ggcaggggtccaagacggaagcaaggagacagactgggcaggagtggtcc
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
H9GEA6_MCL1-02          --------------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          --------------------------------------------------
F6ZMX1_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-02          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-02          --------------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      ggacagcgggatcctccaggagaggagaacagagaaaaagacgttagtct
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      ----------------g------------t----aa--------------
A2BF68_MCL1-02          ----------------g------------t----ga--------------
Q8UWD6_MCL1-01          ----------------g------------t----ga--------------
A2BF68_MCL1-01          ----------------g------------t----ga--------------
Q568W5_MCL1-01          ----------------g------------t----ga--------------
A0A3B1K5R1_MCL1-01      ----------------a------------t----aa--------------
A0A3B4C6H5_MCL1-01      ----------------a------------t----aa--------------
A0A3B4C6H5_MCL1-03      ----------------a------------t----aa--------------
B6V6J0_MCL1-01          ----------------a------------t----ga--------------
Q568V1_MCL1-01          ----------------g------------t----ga--------------
Q1L8X3_MCL1-01          ----------------g------------t----ga--------------
Q9I9N3_MCL1-01          ----------------g------------t----ga--------------
J7H260_MCL1-01          ----------------g------------t----ga--------------
A0A3B3R4U0_MCL1-01      ----------------g------------t----ga--------------
A0A3Q2Y539_MCL1-01      ----------------a------------t----ga--------------
Q0KFR9_MCL1-01          ----------------g------------t----ga--------------
A0A3P8Y1W8_MCL1-02      ----------------c------------t----ga--------------
A0A3P8Y1W8_MCL1-01      ----------------g------------t----ga--------------
A0A3B3CEX1_MCL1-01      ----------------g------------t----aa--------------
A0A3B3CEX1_MCL1-02      ----------------g------------t----ga--------------
A0A3P9ILF6_MCL1-01      ----------------g------------t----ga--------------
A0A3P9ILF6_MCL1-02      ----------------a------------t----ag--------------
A0A3B3IJ04_MCL1-01      ----------------g------------t----ga--------------
A0A3B3IJ04_MCL1-02      ----------------a------------t----ag--------------
A0A3P9L1F3_MCL1-02      ----------------a------------t----ag--------------
A0A3P9L1F3_MCL1-01      ----------------g------------t----ga--------------
H3AR18_MCL1-02          ----------------a------------t----ga--------------
H3AR18_MCL1-01          ----------------a------------t----ga--------------
A0A3Q2XZL8_MCL1-01      ----------------g------------t----ga--------------
A0A3B4AFB7_MCL1-01      ----------------g------------t----ga--------------
A0A3B4AFB7_MCL1-02      ----------------g------------t----ga--------------
A0A3B1IEV7_MCL1-01      ----------------c------------t----ga--------------
A0A3B4CGU9_MCL1-03      ----------------c------------t----ga--------------
A0A3B4CGU9_MCL1-02      ----------------c------------t----ga--------------
W5MMB7_MCL1-01          ----------------a------------t----ga--------------
A0A3P8VKM5_MCL1-03      ----------------g------------t----ga--------------
A0A3P8VKM5_MCL1-05      ----------------a------------t----ggaaatga--------
A0A3P8VKM5_MCL1-04      ----------------a------------t----aa--------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      ----------------g------------t----ga--------------
G1MPY7_MCL1-01          ----------------g---------------------------------
A0A1L1RNM6_MCL1-01      ----------------aaagtggaggagtt----ga--------------
A0A1L1RNM6_MCL1-02      ----------------g------------t----ga--------------
H9GEA6_MCL1-02          ----------------g------------t----ga--------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          ----------------a------------t----ga--------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          ----------------a------------t----ag--------------
F6ZMX1_MCL1-03          ----------------a------------t----ag--------------
F6ZMX1_MCL1-01          ----------------a------------g----aaaatgggctgcctcg
F6ZMX1_MCL1-02          ----------------g------------a----aa--------------
H0XHA5_MCL1-01          ----------------a------------t----ag--------------
G1QAV8_MCL1-01          ----------------g------------t----ag--------------
G1PZ39_MCL1-01          ----------------a------------t----ag--------------
P97287_MCL1-01          ----------------a------------t----ag--------------
Q9Z1P3_MCL1-01          ----------------g------------t----ag--------------
A0A2K6F6N9_MCL1-01      ----------------a------------t----ag--------------
A0A2K5DMS4_MCL1-01      ----------------a------------t----ag--------------
A0A286Y1M5_MCL1-01      ----------------a------------t----ag--------------
A0A287DCH9_MCL1-02      ----------------a------------t----ag--------------
A0A287DCH9_MCL1-01      ----------------a------------t----ag--------------
G1T2Q0_MCL1-02          ----------------a------------t----ag--------------
G1T2Q0_MCL1-01          ----------------a------------t----ag--------------
G3T756_MCL1-01          ----------------a------------t----ag--------------
A0A1S3F3I1_MCL1-01      ----------------a------------t----ag--------------
A0A2K6GI15_MCL1-01      ----------------a------------t----agccttgtaa------
F7AVA6_MCL1-02          ----------------a------------t----ag--------------
F7AVA6_MCL1-01          ----------------a------------t----ag--------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          ----------------a------------t----ag--------------
A0A337S3J9_MCL1-04      ----------------a------------t----ag--------------
A0A337S3J9_MCL1-03      ----------------a------------t----ag--------------
Q8HYS5_MCL1-01          ----------------a------------t----ag--------------
F1PAP1_MCL1-01          ----------------a------------t----ag--------------
F1PAP1_MCL1-02          ----------------a------------t----ag--------------
M3XZZ5_MCL1-01          ----------------a------------t----ag--------------
Q95KR3_MCL1-01          ----------------a------------t----ag--------------
A0A287BK44_MCL1-02      ----------------a------------t----agccttttaa------
A0A287BK44_MCL1-01      ----------------a------------t----ag--------------
A0A452RHX5_MCL1-01      ----------------a------------t----ag--------------
G1L3L7_MCL1-02          ----------------a---------------------------------
G1L3L7_MCL1-01          ----------------a------------t----ag--------------
W5QI41_MCL1-01          ----------------a------------t----ag--------------
F1MQX4_MCL1-01          ----------------a------------t----ag--------------
A5PJR2_MCL1-01          ----------------a------------t----ag--------------
A0A452GA25_MCL1-02      ----------------a------------t----ag--------------
A0A452GA25_MCL1-01      ----------------a------------t----ag--------------
G2HFR3_MCL1-01          ----------------a------------t----ag--------------
A0A2K5EPX0_MCL1-02      ----------------a------------t----ag--------------
A0A2K5EPX0_MCL1-01      ----------------a------------t----ag--------------
A0A2K5C7L5_MCL1-01      ----------------a------------t----agccttgtaa------
H0XFB7_MCL1-01          ----------------a------------t----ag--------------
A0A2K6GI15_MCL1-03      ----------------a------------t----ag--------------
A0A2K5I9I0_MCL1-02      ----------------a------------t----agccttactgtaa---
H2N5Y9_MCL1-01          ----------------a------------t----ag--------------
C8YZ26_MCL1-01          ----------------a------------t----ag--------------
A0A2I2YQH7_MCL1-01      ----------------a------------t----ag--------------
A0A2I2YQH7_MCL1-03      ----------------a------------t----ag--------------
B4E3L8_MCL1-01          ----------------a------------t----ag--------------
B4DG83_MCL1-01          ----------------a------------t----ag--------------
B4DU51_MCL1-01          ----------------a------------t----ag--------------
Q07820_MCL1-04          ----------------a------------t----ag--------------
B4DLY8_MCL1-01          ----------------a------------t----ag--------------
A0A2I3RTV4_MCL1-01      ----------------a------------t----ag--------------
A0A2R9BPJ5_MCL1-03      ----------------a------------t----ag--------------
A0A2I3RTV4_MCL1-03      ----------------a------------t----ag--------------
A0A2R9BPJ5_MCL1-01      ----------------a------------t----ag--------------
A0A2K5I9I0_MCL1-03      ----------------a------------t----ag--------------
A0A2I3GJZ3_MCL1-01      ----------------a------------t----agccttactgtaa---
A0A2I3GJZ3_MCL1-02      ----------------a------------t----ag--------------
A0A2K6KRW9_MCL1-02      ----------------a------------t----agccttactgtaa---
A0A2K6PPI3_MCL1-02      ----------------a------------t----agccttactgtaa---
A0A2K6KRW9_MCL1-01      ----------------a------------t----ag--------------
A0A2K6PPI3_MCL1-03      ----------------a------------t----ag--------------
A0A2I3LFM0_MCL1-01      ----------------a------------t----agccttactgtaa---
A0A2K5W0W9_MCL1-01      ----------------a------------t----agccttactgtaa---
A0A2K6ECR0_MCL1-02      ----------------a------------t----agccttactgtaa---
I7G687_MCL1-01          ----------------a------------t----ag--------------
A0A2K5LXU8_MCL1-01      ----------------a------------t----ag--------------
A0A2K5LXU8_MCL1-03      ----------------a------------t----ag--------------
A0A0D9RZP5_MCL1-01      ----------------a------------t----ag--------------
A0A2K5W0W9_MCL1-03      ----------------a------------t----ag--------------
A0A2K6ECR0_MCL1-03      ----------------a------------t----ag--------------
A0A2K5XSB2_MCL1-01      ----------------a------------t----ag--------------
A0A2K5XSB2_MCL1-03      ----------------a------------t----ag--------------
A0A2I3LFM0_MCL1-03      ----------------a------------t----ag--------------
A0A2K5R5E2_MCL1-03      ----------------a------------t----agccttgtaa------
A0A2K6V5Y3_MCL1-01      ----------------a------------t----ag--------------
A0A2K6V5Y3_MCL1-03      ----------------a------------t----ag--------------
A0A2K5R5E2_MCL1-04      ----------------a------------t----ag--------------
F7GTF7_MCL1-01          ----------------a------------t----ag--------------
F7GTF7_MCL1-02          ----------------a------------t----ag--------------
A0A2K5CFH3_MCL1-01      ----------------c------------t----ag--------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          ----------------g------------t----ga--------------
D2ITA0_MCL1-04          ----------------g------------t----ga--------------
A0A3P8V8T6_MCL1-01      ----------------g------------t----ag--------------
Q4SW32_MCL1-01          ----------------g------------t----ga--------------
A0A3B5PQ55_MCL1-01      ----------------t------------t----ga--------------
A0A3B5PQ55_MCL1-02      ----------------c------------t----ga--------------
A0A3P9Q4I8_MCL1-01      ----------------g------------t----aa--------------
A0A3P9Q4I8_MCL1-02      ----------------g------------t----ga--------------
A0A3B3VM25_MCL1-01      ----------------a------------t----aa--------------
A0A087X830_MCL1-01      ----------------g------------t----ga--------------
A0A3B3YCD0_MCL1-01      ----------------g------------t----ga--------------
A0A3Q3VP02_MCL1-01      ----------------g------------t----ga--------------
G3PJT0_MCL1-01          ----------------g------------t----gagcaccagaccttct
A0A2U9CJ81_MCL1-01      ----------------g------------t----ga--------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      ----------------g------------t----aa--------------
A0A3Q3IZW0_MCL1-01      ----------------g------------t----ga--------------
A0A3Q3GP42_MCL1-01      ----------------g------------t----ga--------------
A0A3Q1GX28_MCL1-02      ----------------t------------t----cagcctcttcacctgc
A0A3Q1GX28_MCL1-01      ----------------g------------t----ga--------------
A0A3Q3M6G2_MCL1-01      ----------------c------------t----gacttctcaaagtgcc
A0A3Q3M6G2_MCL1-02      -----------------------------t----ga--------------
A0A3B4T8L9_MCL1-01      ----------------g------------t----ga--------------
A0A3B4T8L9_MCL1-02      ----------------g------------t----gaagcccatttccata
A0A3B4XKA5_MCL1-01      ----------------g------------t----ga--------------
A0A3Q0R633_MCL1-01      ----------------g------------t----ga--------------
A0A3Q0R633_MCL1-03      ----------------g------------t----ga--------------
I3KXG5_MCL1-01          ----------------g------------t----ga--------------
I3JHR5_MCL1-03          ----------------t------------t----aa--------------
I3JHR5_MCL1-02          ----------------g------------t----gaagaacacactggta
I3JHR5_MCL1-01          ----------------g------------t----ga--------------
A0A3Q4HLQ8_MCL1-01      ----------------g------------t----ga--------------
A0A3P9BVM3_MCL1-01      ----------------g------------t----ga--------------
A0A3P8NP63_MCL1-02      ----------------t------------t----ga--------------
A0A3P8NP63_MCL1-01      ----------------g------------t----ga--------------
A0A3Q2VNL8_MCL1-01      ----------------g------------t----aa--------------
A0A3B4G4Z6_MCL1-01      ----------------g------------t----ga--------------
A0A3B4ZKP6_MCL1-01      ----------------g------------tcat-ga--------------
A0A3Q1EQB9_MCL1-01      ----------------g------------t----ga--------------
A0A3Q1EQB9_MCL1-02      cagaaatacttgtcacg------------t----aa--------------
A0A3P8RQX7_MCL1-02      ----------------g------------t----ga--------------
A0A3P8RQX7_MCL1-01      ----------------g------------t----ga--------------
A0A3Q1BKL8_MCL1-01      ----------------g------------t----ga--------------
A0A3Q1BKL8_MCL1-02      ----------------g------------ttgcaga--------------
A0A3Q2EDX8_MCL1-01      ----------------g------------t----ga--------------
A0A3Q2P7X9_MCL1-02      ----------------g------------t----ga--------------
A0A3Q2P7X9_MCL1-01      ----------------g------------t----ga--------------
                                                                          

A0A3B3SG34_MCL1-01      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-01      --------------------------------------------------
A0A3B4C6H5_MCL1-03      --------------------------------------------------
B6V6J0_MCL1-01          --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3Q2Y539_MCL1-01      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
A0A3Q2XZL8_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
A0A3P8VKM5_MCL1-03      --------------------------------------------------
A0A3P8VKM5_MCL1-05      --------------------------------------------------
A0A3P8VKM5_MCL1-04      --------------------------------------------------
U3KKY6_MCL1-01          --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A1L1RNM6_MCL1-01      --------------------------------------------------
A0A1L1RNM6_MCL1-02      --------------------------------------------------
H9GEA6_MCL1-02          --------------------------------------------------
H9GEA6_MCL1-01          --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
G3WBC5_MCL1-01          --------------------------------------------------
F6ZMX1_MCL1-03          --------------------------------------------------
F6ZMX1_MCL1-01          ctgcaacgttctcacaacaaattctccacttcaatgataactcatggact
F6ZMX1_MCL1-02          --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
P97287_MCL1-01          --------------------------------------------------
Q9Z1P3_MCL1-01          --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A1S3F3I1_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
F7AVA6_MCL1-02          --------------------------------------------------
F7AVA6_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-01          --------------------------------------------------
F1PAP1_MCL1-02          --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A287BK44_MCL1-02      --------------------------------------------------
A0A287BK44_MCL1-01      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
H2N5Y9_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
Q07820_MCL1-04          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A2I3GJZ3_MCL1-01      --------------------------------------------------
A0A2I3GJZ3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-01      --------------------------------------------------
A0A2K6ECR0_MCL1-02      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
A0A2K5W0W9_MCL1-03      --------------------------------------------------
A0A2K6ECR0_MCL1-03      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A2I3LFM0_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-03      --------------------------------------------------
A0A2K6V5Y3_MCL1-01      --------------------------------------------------
A0A2K6V5Y3_MCL1-03      --------------------------------------------------
A0A2K5R5E2_MCL1-04      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFH3_MCL1-01      --------------------------------------------------
A0A2K5CFH3_MCL1-03      --------------------------------------------------
D2ITA0_MCL1-03          --------------------------------------------------
D2ITA0_MCL1-04          --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
Q4SW32_MCL1-01          --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          ccgacatccggctctggacta-----------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q3IZW0_MCL1-01      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      attaa---------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q3M6G2_MCL1-01      atcagcgcgcctgtctcagcatag--------------------------
A0A3Q3M6G2_MCL1-02      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      gagctcattcataa------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
I3JHR5_MCL1-03          --------------------------------------------------
I3JHR5_MCL1-02          gacaatag------------------------------------------
I3JHR5_MCL1-01          --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A3Q2P7X9_MCL1-02      --------------------------------------------------
A0A3Q2P7X9_MCL1-01      --------------------------------------------------
                                                                          

A0A3B3SG34_MCL1-01      ----
A2BF68_MCL1-02          ----
Q8UWD6_MCL1-01          ----
A2BF68_MCL1-01          ----
Q568W5_MCL1-01          ----
A0A3B1K5R1_MCL1-01      ----
A0A3B4C6H5_MCL1-01      ----
A0A3B4C6H5_MCL1-03      ----
B6V6J0_MCL1-01          ----
Q568V1_MCL1-01          ----
Q1L8X3_MCL1-01          ----
Q9I9N3_MCL1-01          ----
J7H260_MCL1-01          ----
A0A3B3R4U0_MCL1-01      ----
A0A3Q2Y539_MCL1-01      ----
Q0KFR9_MCL1-01          ----
A0A3P8Y1W8_MCL1-02      ----
A0A3P8Y1W8_MCL1-01      ----
A0A3B3CEX1_MCL1-01      ----
A0A3B3CEX1_MCL1-02      ----
A0A3P9ILF6_MCL1-01      ----
A0A3P9ILF6_MCL1-02      ----
A0A3B3IJ04_MCL1-01      ----
A0A3B3IJ04_MCL1-02      ----
A0A3P9L1F3_MCL1-02      ----
A0A3P9L1F3_MCL1-01      ----
H3AR18_MCL1-02          ----
H3AR18_MCL1-01          ----
A0A3Q2XZL8_MCL1-01      ----
A0A3B4AFB7_MCL1-01      ----
A0A3B4AFB7_MCL1-02      ----
A0A3B1IEV7_MCL1-01      ----
A0A3B4CGU9_MCL1-03      ----
A0A3B4CGU9_MCL1-02      ----
W5MMB7_MCL1-01          ----
A0A3P8VKM5_MCL1-03      ----
A0A3P8VKM5_MCL1-05      ----
A0A3P8VKM5_MCL1-04      ----
U3KKY6_MCL1-01          ----
A0A493U0E8_MCL1-01      ----
G1MPY7_MCL1-01          ----
A0A1L1RNM6_MCL1-01      ----
A0A1L1RNM6_MCL1-02      ----
H9GEA6_MCL1-02          ----
H9GEA6_MCL1-01          ----
K7FPN7_MCL1-01          ----
G3TVG9_MCL1-01          ----
G3WBC5_MCL1-01          ----
F6ZMX1_MCL1-03          ----
F6ZMX1_MCL1-01          ctag
F6ZMX1_MCL1-02          ctga
H0XHA5_MCL1-01          ----
G1QAV8_MCL1-01          ----
G1PZ39_MCL1-01          ----
P97287_MCL1-01          ----
Q9Z1P3_MCL1-01          ----
A0A2K6F6N9_MCL1-01      ----
A0A2K5DMS4_MCL1-01      ----
A0A286Y1M5_MCL1-01      ----
A0A287DCH9_MCL1-02      ----
A0A287DCH9_MCL1-01      ----
G1T2Q0_MCL1-02          ----
G1T2Q0_MCL1-01          ----
G3T756_MCL1-01          ----
A0A1S3F3I1_MCL1-01      ----
A0A2K6GI15_MCL1-01      ----
F7AVA6_MCL1-02          ----
F7AVA6_MCL1-01          ----
A0A337S3J9_MCL1-01      ----
Q7YRZ9_MCL1-01          ----
A0A337S3J9_MCL1-04      ----
A0A337S3J9_MCL1-03      ----
Q8HYS5_MCL1-01          ----
F1PAP1_MCL1-01          ----
F1PAP1_MCL1-02          ----
M3XZZ5_MCL1-01          ----
Q95KR3_MCL1-01          ----
A0A287BK44_MCL1-02      ----
A0A287BK44_MCL1-01      ----
A0A452RHX5_MCL1-01      ----
G1L3L7_MCL1-02          ----
G1L3L7_MCL1-01          ----
W5QI41_MCL1-01          ----
F1MQX4_MCL1-01          ----
A5PJR2_MCL1-01          ----
A0A452GA25_MCL1-02      ----
A0A452GA25_MCL1-01      ----
G2HFR3_MCL1-01          ----
A0A2K5EPX0_MCL1-02      ----
A0A2K5EPX0_MCL1-01      ----
A0A2K5C7L5_MCL1-01      ----
H0XFB7_MCL1-01          ----
A0A2K6GI15_MCL1-03      ----
A0A2K5I9I0_MCL1-02      ----
H2N5Y9_MCL1-01          ----
C8YZ26_MCL1-01          ----
A0A2I2YQH7_MCL1-01      ----
A0A2I2YQH7_MCL1-03      ----
B4E3L8_MCL1-01          ----
B4DG83_MCL1-01          ----
B4DU51_MCL1-01          ----
Q07820_MCL1-04          ----
B4DLY8_MCL1-01          ----
A0A2I3RTV4_MCL1-01      ----
A0A2R9BPJ5_MCL1-03      ----
A0A2I3RTV4_MCL1-03      ----
A0A2R9BPJ5_MCL1-01      ----
A0A2K5I9I0_MCL1-03      ----
A0A2I3GJZ3_MCL1-01      ----
A0A2I3GJZ3_MCL1-02      ----
A0A2K6KRW9_MCL1-02      ----
A0A2K6PPI3_MCL1-02      ----
A0A2K6KRW9_MCL1-01      ----
A0A2K6PPI3_MCL1-03      ----
A0A2I3LFM0_MCL1-01      ----
A0A2K5W0W9_MCL1-01      ----
A0A2K6ECR0_MCL1-02      ----
I7G687_MCL1-01          ----
A0A2K5LXU8_MCL1-01      ----
A0A2K5LXU8_MCL1-03      ----
A0A0D9RZP5_MCL1-01      ----
A0A2K5W0W9_MCL1-03      ----
A0A2K6ECR0_MCL1-03      ----
A0A2K5XSB2_MCL1-01      ----
A0A2K5XSB2_MCL1-03      ----
A0A2I3LFM0_MCL1-03      ----
A0A2K5R5E2_MCL1-03      ----
A0A2K6V5Y3_MCL1-01      ----
A0A2K6V5Y3_MCL1-03      ----
A0A2K5R5E2_MCL1-04      ----
F7GTF7_MCL1-01          ----
F7GTF7_MCL1-02          ----
A0A2K5CFH3_MCL1-01      ----
A0A2K5CFH3_MCL1-03      ----
D2ITA0_MCL1-03          ----
D2ITA0_MCL1-04          ----
A0A3P8V8T6_MCL1-01      ----
Q4SW32_MCL1-01          ----
A0A3B5PQ55_MCL1-01      ----
A0A3B5PQ55_MCL1-02      ----
A0A3P9Q4I8_MCL1-01      ----
A0A3P9Q4I8_MCL1-02      ----
A0A3B3VM25_MCL1-01      ----
A0A087X830_MCL1-01      ----
A0A3B3YCD0_MCL1-01      ----
A0A3Q3VP02_MCL1-01      ----
G3PJT0_MCL1-01          ----
A0A2U9CJ81_MCL1-01      ----
A0A3Q3B4P5_MCL1-01      ----
A0A3Q3B4P5_MCL1-02      ----
A0A3Q3IZW0_MCL1-01      ----
A0A3Q3GP42_MCL1-01      ----
A0A3Q1GX28_MCL1-02      ----
A0A3Q1GX28_MCL1-01      ----
A0A3Q3M6G2_MCL1-01      ----
A0A3Q3M6G2_MCL1-02      ----
A0A3B4T8L9_MCL1-01      ----
A0A3B4T8L9_MCL1-02      ----
A0A3B4XKA5_MCL1-01      ----
A0A3Q0R633_MCL1-01      ----
A0A3Q0R633_MCL1-03      ----
I3KXG5_MCL1-01          ----
I3JHR5_MCL1-03          ----
I3JHR5_MCL1-02          ----
I3JHR5_MCL1-01          ----
A0A3Q4HLQ8_MCL1-01      ----
A0A3P9BVM3_MCL1-01      ----
A0A3P8NP63_MCL1-02      ----
A0A3P8NP63_MCL1-01      ----
A0A3Q2VNL8_MCL1-01      ----
A0A3B4G4Z6_MCL1-01      ----
A0A3B4ZKP6_MCL1-01      ----
A0A3Q1EQB9_MCL1-01      ----
A0A3Q1EQB9_MCL1-02      ----
A0A3P8RQX7_MCL1-02      ----
A0A3P8RQX7_MCL1-01      ----
A0A3Q1BKL8_MCL1-01      ----
A0A3Q1BKL8_MCL1-02      ----
A0A3Q2EDX8_MCL1-01      ----
A0A3Q2P7X9_MCL1-02      ----
A0A3Q2P7X9_MCL1-01      ----
                            

© 1998-2020Legal notice