Dataset for CDS MCL-1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

438 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      atggtgcgggctgcgagggctgcgaggccggtgcccgggggcgcctgctt
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      atggtgcaggctgcgagcacggcgtgcccg--------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      tgccggggggagttggggcactgcagcaccccgtggtgatggggtgggag
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      ggggtggcacgcctgggtctgaccgggctgggaggcacaagcagggcaga
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      cacaaggcaccgagcagggccaggccgggggaggcggcgtgtgcagcggg
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      gccgggggtgcccggtgtggggccgcaggaggcccggcggggtgacgcct
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------atggga
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      ctccgcgggggcggcgggggctctttcgccctttttcaccccaaaaagcc
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      ------------------------------------------------at
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      gtcaggggacgaagtgggtggtccgttttccgccgaaaaaacggaagcgg
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      ccggcctggcgaggcgtgacacccaccccccccgggccgtgccggaagcg
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      gctgaggttccaaagcgggctgctagcattccccgagttcaagttgtact
A0A674D1T7_MCL1-01      -----------------------------tcaccgaa-------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      ---------------------------------atcgctaagaagct---
A0A674HQK4_MCL1-02      aggtggaaaaaaaaaaaaaaaacaaacccaaaaatcaaaaaaaagctctc
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      gggccggaaacgcggccggaagtggaccggcgcggcctcgctccgccccc
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      -----------------------------atgtggacagcgagtagctac
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      cgaatgttgggtacgttacaatcgcaggtacaaaacattgcattatctgt
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      ------------------------------at------------------
A0A673GSK0_MCL1-03      ------------------------------ct------------------
A0A673GSK0_MCL1-01      ------------------------------atgctgaaaatacagctgcg
A0A673GSK0_MCL1-02      ------------------------------at------------------
A0A671LEY4_MCL1-01      ------------------------------at------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      ------------------------------at------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      ------------------------------at------------------
A0A673HSI2_MCL1-01      ------------------------------at------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      -------------------------------------------atgctgt
A0A8C5CE84_MCL1-03      -------------------------------------------atgctgt
A0A8C5CE84_MCL1-01      -------------------------------------------atgctgt
A0A8C5CE84_MCL1-04      -------------------------------------------atgt---
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------atgtgcacgtgcacgctaatggag
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      ----------------------cgtcaccgcgcgggggcatttataacgg
A0A8C6VLE3_MCL1-02      ----------------------cgtcaccgcgcgggggcatttataacgg
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      ----------------------atgaaaataaggggggggaaaaaaaaaa
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      ---------------------ttttccgg---------------------
A0A674HQK4_MCL1-02      gctgtcccgccctcgccccgcctctccggcgtcaccggttatataacgcg
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      gtcgtgccccgcgtcgcgtcccgtcacgtcaccgccgccatataagcggc
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          ---------------------------------------atgatgcacca
A0A8C4RFB4_MCL1-01      ---------------------------------------atgaatcctgc
A0A4W4H9I6_MCL1-01      --------------------------------atgattaatccacaagat
A0A8C9VMU9_MCL1-01      aagtgccgcgacgagacgctttctgtgaacgggttatacatgtttaataa
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      ------------------------------------------------at
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      ---------------------------------------atgaatattat
A0A3P8Y1W8_MCL1-04      ---------------------------------------atgaacc---t
A0A3P8Y1W8_MCL1-05      ---------------------------------------atgaacc---t
A0A6F9BEN5_MCL1-02      ---------------------------------------atgaatc---t
Q0KFR9_MCL1-01          ---------------------------------------atgagyc---t
A0A673VWA7_MCL1-01      ---------------------------------------atgagtc---t
A0A4W5QGT1_MCL1-01      ---------------------------------------atgagtc---t
A0A8C8LPV9_MCL1-01      ---------------------------------------atgagtc---t
A0A8C7LPD4_MCL1-01      ---------------------------------------atgagtc---t
A0A8C7H1W6_MCL1-01      ---------------------------------------atgagtctgtt
A0A8C7H1W6_MCL1-02      ---------------------------------------atgagtctgtt
A0A4W5LP06_MCL1-01      ---------------------------------------atgagtc---t
A0A4W5LP06_MCL1-02      ---------------------------------------atgagtc---t
A0A674ELG3_MCL1-03      ---------------------------------------atgagtc---t
A0A674ELG3_MCL1-01      ---------------------------------------atgagtc---t
A0A674ELG3_MCL1-02      ---------------------------------------atgagtc---t
A0A8C7PM33_MCL1-03      ---------------------------------------atgagtc---t
A0A8C7PM33_MCL1-01      ---------------------------------------atgagtc---t
A0A8C7PM33_MCL1-02      ---------------------------------------atgagtc---t
A0A8C8CMB3_MCL1-01      ---------------------------------------atgagtc---t
A0A8C8CMB3_MCL1-02      ---------------------------------------atgagtc---t
A0A8C7H400_MCL1-01      ---------------------------------------atgagtc---t
A0A8C7H400_MCL1-02      ---------------------------------------atgagtc---t
A0A1A8A7I9_MCL1-01      ---------------------------------------atg--------
A0A1A8A7I9_MCL1-03      ---------------------------------------atg--------
A0A1A8A7I9_MCL1-02      ---------------------------------------atg--------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      ---------------------------atggcatgtcctgacattggtaa
A0A8K9V051_MCL1-01      ---------------------------atggcatgtcctgacattggtaa
A0A674D165_MCL1-01      gcatcgccaccaggccaagatcattacatcgcgtgccctgagattggtaa
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      ---------------------------------------atgagag----
A0A6Q2XQM7_MCL1-02      -------------------------------------tgtctagagtgcc
A0A6Q2XXK6_MCL1-01      ---------------------------------------atgagcggagt
A0A6Q2Y9Q3_MCL1-01      ---------------------------------------atgagcggagt
A0A3P8VHY5_MCL1-04      ---------------------------------------atgaatatta-
A0A3P8VHY5_MCL1-05      ---------------------------------------atgaatatta-
A0A3P8VHY5_MCL1-02      ---------------------------------------atgaatatta-
A0A3P8VHY5_MCL1-01      ---------------------------------------atgaatatta-
A0A3P8VHY5_MCL1-03      ---------------------------------------atgaatatta-
A0A8C2Z1X1_MCL1-01      ---------------------------------------atgaatataat
G3PJT0_MCL1-01          ---------------------------------------atgaatataat
A0A3Q3S6A5_MCL1-01      ---------------------------------------atgagcttcat
A0A3Q3S6A5_MCL1-02      ---------------------------------------atgagcttcat
A0A3Q3VP02_MCL1-01      ---------------------------------------atgaacgtgtt
A0A2U9CJ81_MCL1-01      ---------------------------------------atgaatatcat
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      ---------------------------------------atgaacatcgt
A0A667YZT5_MCL1-02      ---------------------------------------atgaacatcgt
A0A3Q3B4P5_MCL1-01      ---------------------------------------atgttcc----
A0A3Q3B4P5_MCL1-02      ---------------------------------------atgttcc----
A0A3Q1GX28_MCL1-01      ---------------------------------------atgt-------
A0A3Q1GX28_MCL1-02      ---------------------------------------atgt-------
A0A3Q3GP42_MCL1-01      ---------------------------------------atggatatcat
A0A8C5H9Y5_MCL1-01      ---------------------------------------atgaatatcg-
A0A8C5H9Y5_MCL1-02      ---------------------------------------atgaatatcg-
A0A671VEU3_MCL1-02      ---------------------------------------atgtttc----
A0A671VEU3_MCL1-01      ---------------------------------------atgtttc----
A0A671VEU3_MCL1-03      ---------------------------------------atgtttc----
A0A3B4T8L9_MCL1-01      ---------------------------------------atgaatcttat
A0A3B4T8L9_MCL1-02      ---------------------------------------atgaatcttat
A0A3B4XKA5_MCL1-01      ---------------------------------------atgaatcttat
A0A4W6CDF4_MCL1-03      ---------------------------------------atgaatatcat
A0A4W6CDF4_MCL1-01      ---------------------------------------atgaatatcat
A0A4W6CDF4_MCL1-02      ---------------------------------------atgaatatcat
A0A3B4ZKP6_MCL1-01      ---------------------------------------atgaacattat
A0A3Q1EQB9_MCL1-01      ---------------------------------------atgaatatgat
A0A3Q1EQB9_MCL1-02      ---------------------------------------atgaatatgat
A0A3P8RQX7_MCL1-01      ---------------------------------------atgaatatgat
A0A3P8RQX7_MCL1-02      ---------------------------------------atgaatatgat
A0A3Q1BKL8_MCL1-01      ---------------------------------------atgaatatgat
A0A3Q1BKL8_MCL1-02      ---------------------------------------atgaatatgat
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      ---------------------------------------atgaacacgtg
A0A668SNL1_MCL1-01      ---------------------------------------at---------
I3KXG5_MCL1-01          ---------------------------------------at---------
A0A669C7T2_MCL1-03      ---------------------------------------atgaccaactt
A0A668RLC9_MCL1-01      ---------------------------------------atgaccaacta
A0A669C7T2_MCL1-01      ---------------------------------------atgaccaactt
A0A669C7T2_MCL1-02      ---------------------------------------atgaccaactt
A0A3Q4HLQ8_MCL1-01      ---------------------------------------atgaccaacta
A0A3P9BVM3_MCL1-01      ---------------------------------------atggccaacta
A0A3P8NP63_MCL1-02      ---------------------------------------atggccaacta
A0A3P8NP63_MCL1-01      ---------------------------------------atggccaacta
A0A3P8NP63_MCL1-03      ---------------------------------------atggccaacta
A0A3Q2VNL8_MCL1-01      ---------------------------------------atggccaacta
A0A3B4G4Z6_MCL1-01      ---------------------------------------atggccaacta
A0A8C9XY04_MCL1-01      ---------------------------------------atgaata---t
A0A8P4G790_MCL1-01      ---------------------------------------atgaata---t
A0A8P4G790_MCL1-02      ---------------------------------------atgaata---t
A2BF68_MCL1-02          ------------------------------------------------at
Q8UWD6_MCL1-01          ------------------------------------------------at
A2BF68_MCL1-01          ------------------------------------------------at
Q568W5_MCL1-01          ------------------------------------------------at
A0A671RQ00_MCL1-01      ------------------------------------------------at
A0A673IXK8_MCL1-01      ------------------------------------------------at
A0A672RP45_MCL1-02      ------------------------------------------------at
A0A672RP45_MCL1-01      ------------------------------------------------at
A0A672RP45_MCL1-03      ------------------------------------------------at
A0A8C1JUN1_MCL1-01      ------------------------------------------------at
A0A8C1JUN1_MCL1-02      ------------------------------------------------at
A0A671L9M9_MCL1-01      ------------------------------------------------at
A0A672KMK1_MCL1-01      ------------------------------------------------at
A0A673MXF5_MCL1-01      ------------------------------------------------at
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      ---------------atggtcaggctgttcggtgttgggttgagagtggt
A0A3B4C341_MCL1-03      ---------------atgatgatg------------agtcccaaggagat
A0A3B1K5R1_MCL1-01      ------------------------------------------------at
A0A8B9JW80_MCL1-01      ------------------------------------------------at
A0A3B3SG34_MCL1-01      ---------------------------------------------atgaa
A0A8C1YDY0_MCL1-01      ------------------------------------gactctaa------
A0A673GSK0_MCL1-03      ------------------------------------------aagcttta
A0A673GSK0_MCL1-01      catcacagaaataaattacagtttaacagatattcacatagaaaacagtt
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      ------------------------------------gactctga------
A0A672PT04_MCL1-02      -------------------------------------------gtccaga
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      ------------------------------------gtcactgagccccg
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      ------------------------------------gactctga------
A0A673HSI2_MCL1-01      ------------------------------------gactctga------
A0A4W4F1X6_MCL1-01      ---------------------------------------------atgag
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          ------------------------------------------atggctct
Q9I9N3_MCL1-01          ------------------------------------------atggctct
A0A3B3CEX1_MCL1-01      ------------------------------------------------at
A0A3B3CEX1_MCL1-02      ------------------------------------------------at
A0A8C7X109_MCL1-01      ------------------------------------------------at
A0A3P9ILF6_MCL1-01      ------------------------------------------------at
A0A3P9ILF6_MCL1-02      ------------------------------------------------at
A0A3B3IJ04_MCL1-01      ------------------------------------------------at
A0A3B3IJ04_MCL1-02      ------------------------------------------------at
A0A3P9L1F3_MCL1-01      ------------------------------------------------at
A0A3P9L1F3_MCL1-02      ------------------------------------------------at
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      ------------------------------------------------at
A0A3B4CGU9_MCL1-01      ------------------------------------------------at
A0A3B4CGU9_MCL1-02      ------------------------------------------------at
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      ------------------------------------------------at
A0A3B5PQ55_MCL1-02      ------------------------------------------------at
A0A3P9Q4I8_MCL1-01      ------------------------------------------------at
A0A3P9Q4I8_MCL1-02      ------------------------------------------------at
A0A3B3VM25_MCL1-01      ------------------------------------------------at
A0A087X830_MCL1-01      ------------------------------------------------at
A0A3B3YCD0_MCL1-01      ------------------------------------------------at
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      ---------------------------------------atgaatattat
A0A674PI93_MCL1-01      ------------------------------------------------at
J7H260_MCL1-01          ------------------------------------------------at
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      ---------------------------atgctacctgcaaaacggacaaa
A0A8C6SVR4_MCL1-01      -------------------------gtatgctacctgcaaaacggacaaa
A0A8C6SVR4_MCL1-03      ---------------------------atgctacctgcaaaacggacaaa
A0A3P8Y1W8_MCL1-01      ----ctctcttattcctacagacagaacatg-------------------
A0A3P8Y1W8_MCL1-02      ------------cttgca-------gacatg-------------------
A0A3P8Y1W8_MCL1-03      ----gaggcgtgtttgt---------acatg-------------------
A0A8C5CE84_MCL1-02      cacagaaactaacttcaaactacggaaccagcttagtccagacctgctgg
A0A8C5CE84_MCL1-03      cacagaaactaacttcaaactacggaaccagcttagtccagacctgctgg
A0A8C5CE84_MCL1-01      cacagaaactaacttcaaactacggaaccagcttagtccagacctgctgg
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          ---------------------------------------------atgag
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      ------------------------------------------------at
A0A5F8GAQ2_MCL1-01      ------------------------------------------------at
A0A5F8GAQ2_MCL1-02      ------------------------------------------------at
A0A7N4PRP1_MCL1-01      ------------------------------------------------at
A0A7N4PRP1_MCL1-02      ------------------------------------------------at
A0A7N4PRP1_MCL1-03      ------------------------------------------------at
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          ------------------------------------------------at
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      ------------------------------------------------at
A0A8I5Y8B7_MCL1-01      ------------------------------------------------aa
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      ------------------------------------------------at
A0A8C2MG79_MCL1-02      ------------------------------------------------at
A0A8C6GJU8_MCL1-01      ------------------------------------------------at
A0A8C6GJU8_MCL1-02      ------------------------------------------------at
A0A8C6GJU8_MCL1-03      ------------------------------------------------at
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      ------------------------------------------------at
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          ------------------------------------------atggcgat
G1T2Q0_MCL1-02          ------------------------------------------------at
G3T756_MCL1-01          ------------------------------------------------at
A0A8C6QA84_MCL1-01      ------------------------------------------------at
A0A8C5VC33_MCL1-01      ------------------------------------------------ct
A0A8D2KCB0_MCL1-01      ------------------------------------------------at
A0A8C9QEN4_MCL1-01      ------------------------------------------------at
A0A287DCH9_MCL1-01      ------------------------------------------------at
A0A287DCH9_MCL1-02      ------------------------------------------------at
A0A2K5C7L5_MCL1-01      ------------------------------------------------at
H0XFB7_MCL1-01          ------------------------------------------------at
A0A8C9AD42_MCL1-01      ------------------------------------------------gt
A0A8B7GKA0_MCL1-01      ------------------------------------------------at
A0A8B7GKA0_MCL1-02      ------------------------------------------------at
A0A8B7GKA0_MCL1-03      ------------------------------------------------at
A0A8C9AD42_MCL1-02      ------------------------------------------------at
A0A8C9AD42_MCL1-03      ------------------------------------------------at
A0A2K6GI15_MCL1-01      ------------------------------------------------at
A0A2K6GI15_MCL1-02      ------------------------------------------------at
A0A2K6GI15_MCL1-03      ------------------------------------------------at
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      ------------------------------------------------at
G2HFR3_MCL1-01          ------------------------------------------------at
C8YZ26_MCL1-01          ------------------------------------------------at
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      ------------------------------------------------at
A0A2I3RTV4_MCL1-02      ------------------------------------------------at
A0A087WT64_MCL1-09      ------------------------------------------------at
A0A2I2YJ87_MCL1-02      ------------------------------------------------at
A0A2I3RTV4_MCL1-01      ------------------------------------------------at
A0A2R9BPJ5_MCL1-01      ------------------------------------------------at
A0A2R9BPJ5_MCL1-03      ------------------------------------------------at
A0A2I3RTV4_MCL1-03      ------------------------------------------------at
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      ------------------------------------------------at
A0A2I2YJ87_MCL1-01      ------------------------------------------------at
B4DU51_MCL1-01          ------------------------------------------------at
B4DLY8_MCL1-01          ------------------------------------------------at
A0A087WT64_MCL1-06      ------------------------------------------------at
A0A087WT64_MCL1-03      ------------------------------------------------at
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      ------------------------------------------------at
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      ------------------------------------------------at
A0A8I5TL14_MCL1-02      ------------------------------------------------at
A0A8I5TL14_MCL1-03      ------------------------------------------------at
A0A2K5I9I0_MCL1-02      ------------------------------------------------at
A0A2K5I9I0_MCL1-01      ------------------------------------------------at
A0A2K5I9I0_MCL1-03      ------------------------------------------------at
A0A8C9I795_MCL1-01      ------------------------------------------------at
A0A8C9I795_MCL1-02      ------------------------------------------------at
A0A2K6KRW9_MCL1-02      ------------------------------------------------at
A0A2K6PPI3_MCL1-02      ------------------------------------------------at
A0A2K6KRW9_MCL1-01      ------------------------------------------------at
A0A2K6PPI3_MCL1-01      ------------------------------------------------at
A0A2K6KRW9_MCL1-03      ------------------------------------------------at
A0A2K6PPI3_MCL1-03      ------------------------------------------------at
A0A096MRS6_MCL1-04      ------------------------------------------------at
A0A096MRS6_MCL1-01      ------------------------------------------------at
A0A2I3GB35_MCL1-01      ------------------------------------------------at
A0A2I3GB35_MCL1-02      ------------------------------------------------at
A0A2I3GB35_MCL1-03      ------------------------------------------------at
A0A2K5LXU8_MCL1-02      ------------------------------------------------at
A0A2K5XSB2_MCL1-02      ------------------------------------------------at
A0A2K5W0Y7_MCL1-03      ------------------------------------------------at
A0A2K6ECQ5_MCL1-02      ------------------------------------------------at
A0A2K5LXU8_MCL1-01      ------------------------------------------------at
A0A2K5LXU8_MCL1-03      ------------------------------------------------at
A0A0D9RZP5_MCL1-01      ------------------------------------------------at
I7G687_MCL1-01          ------------------------------------------------at
A0A2K5W0Y7_MCL1-01      ------------------------------------------------at
A0A2K5W0Y7_MCL1-02      ------------------------------------------------at
A0A2K6ECQ5_MCL1-01      ------------------------------------------------at
F7HUE9_MCL1-01          ------------------------------------------------at
A0A2K6ECQ5_MCL1-03      ------------------------------------------------at
A0A8D2F160_MCL1-01      ------------------------------------------------at
A0A8D2F160_MCL1-02      ------------------------------------------------at
A0A2K5XSB2_MCL1-01      ------------------------------------------------at
A0A2K5XSB2_MCL1-03      ------------------------------------------------at
A0A096MRS6_MCL1-02      ------------------------------------------------at
A0A096MRS6_MCL1-03      ------------------------------------------------at
F7GTF7_MCL1-01          ------------------------------------------------at
A0A2K6V5X4_MCL1-02      ------------------------------------------------at
A0A2K6V5X4_MCL1-01      ------------------------------------------------at
A0A2K6V5X4_MCL1-03      ------------------------------------------------at
F7GTF7_MCL1-02          ------------------------------------------------at
A0A2K5CFB8_MCL1-03      ------------------------------------------------at
A0A2K5CFB8_MCL1-01      ------------------------------------------------at
A0A2K5CFB8_MCL1-02      ------------------------------------------------at
A0A8C0CVU0_MCL1-01      ------------------------------------------------at
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          ------------------------------------ggaatgttgccaat
A0A4W2CQV1_MCL1-01      ------------------------------------------------at
A0A4W2CQV1_MCL1-01      ------------------------------------------------at
A0A4W2G6Q5_MCL1-01      ------------------------------------------------at
A0A4W2G6Q5_MCL1-01      ------------------------------------------------at
A0A8C6E5E6_MCL1-01      ------------------------------------------------at
A0A8C6E5E6_MCL1-02      ------------------------------------------------at
A0A452GA25_MCL1-01      ------------------------------------------------at
A0A452GA25_MCL1-02      ------------------------------------------------at
A5PJR2_MCL1-01          ------------------------------------------------at
A0A8B9W7D1_MCL1-03      ------------------------------------------------at
A0A8B9W7D1_MCL1-04      ------------------------------------------------at
A0A8B9W7D1_MCL1-01      ------------------------------------------------at
A0A8B9W7D1_MCL1-02      ------------------------------------------------at
A0A671G0G2_MCL1-01      ------------------------------------------------at
A0A671G0G2_MCL1-02      ------------------------------------------------at
A0A671G0G2_MCL1-03      ------------------------------------------------at
A0A8D2AJ70_MCL1-01      ------------------------------------------------at
A0A8D2AJ70_MCL1-02      ------------------------------------------------at
A0A673TBH1_MCL1-04      ------------------------------------------------at
A0A673TBH1_MCL1-05      ------------------------------------------------at
A0A673TBH1_MCL1-03      ------------------------------------------------at
A0A673TBH1_MCL1-01      ------------------------------------------------at
A0A673TBH1_MCL1-02      ------------------------------------------------at
A0A8C4L244_MCL1-01      ------------------------------------------------at
A0A5F5Q151_MCL1-01      ------------------------------------------------at
A0A5F5Q151_MCL1-02      ------------------------------------------------at
A0A8C0DF47_MCL1-02      ------------------------------------------------at
A0A8C0DF47_MCL1-01      ------------------------------------------------at
A0A8C0DF47_MCL1-03      ------------------------------------------------at
A0A4V5P8C2_MCL1-01      ------------------------------------------------at
A0A4V5P8C2_MCL1-02      ------------------------------------------------at
A0A8C9BA52_MCL1-01      ------------------------------------------------at
A0A8C9BA52_MCL1-02      ------------------------------------------------at
A0A337S3J9_MCL1-02      ------------------------------------------------at
A0A8C9K7H4_MCL1-01      ------------------------------------------------at
A0A8C8Y0M9_MCL1-01      ------------------------------------------------at
A0A8C8Y0M9_MCL1-02      ------------------------------------------------at
A0A667GXX5_MCL1-01      ------------------------------------------------at
A0A667GXX5_MCL1-02      ------------------------------------------------at
A0A337S3J9_MCL1-01      ------------------------------------------------at
Q7YRZ9_MCL1-01          ------------------------------------------------at
A0A337S3J9_MCL1-03      ------------------------------------------------at
A0A337S3J9_MCL1-04      ------------------------------------------------at
Q8HYS5_MCL1-01          ------------------------------------------------at
A0A8C0MCZ5_MCL1-02      ------------------------------------------------at
A0A8C0L4C8_MCL1-01      ------------------------------------------------at
A0A8C0MCZ5_MCL1-01      ------------------------------------------------at
A0A8I3P430_MCL1-01      ------------------------------------------------at
A0A8I3P430_MCL1-02      ------------------------------------------------at
A0A8C3W949_MCL1-01      ------------------------------------------------at
A0A8C3W949_MCL1-02      ------------------------------------------------at
A0A8C3W949_MCL1-03      ------------------------------------------------at
Q95KR3_MCL1-01          ------------------------------------------------at
A0A8D1FTD4_MCL1-03      ------------------------------------------------at
A0A8D1G1G8_MCL1-04      ------------------------------------------------at
A0A4X1SEZ6_MCL1-01      ------------------------------------------------at
A0A4X1SFB1_MCL1-01      ------------------------------------------------at
A0A8D1FTD4_MCL1-01      ------------------------------------------------at
A0A8D1G1G8_MCL1-02      ------------------------------------------------at
A0A8D1RYD1_MCL1-01      ------------------------------------------------at
A0A4X1SEU3_MCL1-02      ------------------------------------------------at
A0A4X1SEZ6_MCL1-03      ------------------------------------------------at
A0A4X1SFB1_MCL1-02      ------------------------------------------------at
A0A8D1FTD4_MCL1-05      ------------------------------------------------at
A0A8D1G1G8_MCL1-01      ------------------------------------------------at
A0A8D1RYD1_MCL1-03      ------------------------------------------------at
A0A4X1SEU3_MCL1-01      ------------------------------------------------at
A0A8D1G1G8_MCL1-03      ------------------------------------------------at
A0A8D1FTD4_MCL1-02      ------------------------------------------------at
A0A8D1RYD1_MCL1-02      ------------------------------------------------at
A0A4X1SEZ6_MCL1-02      ------------------------------------------------at
A0A8D1FTD4_MCL1-04      ------------------------------------------------at
M3XZZ5_MCL1-01          ------------------------------------------------at
A0A8C7BMW8_MCL1-01      ------------------------------------------------at
A0A8C7BMW8_MCL1-02      ------------------------------------------------at
A0A452RHX5_MCL1-01      ------------------------------------------------at
G1L3L7_MCL1-01          ------------------------------------------------at
G1L3L7_MCL1-02          ------------------------------------------------at
A0A803T0A4_MCL1-01      ------------------------------------------------at
A0A803T0A4_MCL1-02      ------------------------------------------------at
A0A803T0A4_MCL1-03      ------------------------------------------------at
A0A670K3Y6_MCL1-01      ------------------------------------------------at
A0A8D0E7Q9_MCL1-01      ------------------------------------------------at
A0A8D0E7Q9_MCL1-02      ------------------------------------------------at
A0A8C5PJK5_MCL1-01      aggggttcaaggtgggcagggccagaccagaggggctggcttaagcgcag
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      gcgctccgggcgcgcgccactcccctcctcagaaccaagccgtgctcgag
A0A8C6VLE3_MCL1-02      gcgctccgggcgcgcgccactcccctcctcagaaccaagccgtgctcgag
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      ------------------------------------------------at
A0A6I8NSR7_MCL1-02      ------------------------------------------------at
A0A8C9NTQ6_MCL1-01      -----------------------------------atggaacaaactgca
A0A8D2MBY7_MCL1-01      -----------------------------------a----------tgca
A0A8C6YT47_MCL1-01      ------------------------------------------------at
A0A8B9BNC2_MCL1-01      gaggcaagataggggaaaaatgcaaagcccccgtgcggggtggggacggg
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      -------------------------------------ggagggtggggga
A0A8B9VGG9_MCL1-01      -------------------------------------ggagggtggggga
A0A8B9SWV2_MCL1-01      ---------------------------------------atgtt------
A0A8C3GNC2_MCL1-01      ---------------------------------------atgtt------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      gccgcgccggtcccgcccgcaccccgccggccgctcgcaccgggcgccat
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      ------------------------------------------------at
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          ------------------------------------------------at
A0A8C2TT61_MCL1-01      ------------------------------------------------at
A0A8C2TT61_MCL1-02      ------------------------------------------------at
A0A8C9EP12_MCL1-01      ------------------------------------------------at
A0A669R428_MCL1-01      ------------------------------------------------at
A0A8B9GMI8_MCL1-01      ------------------------------------------------at
A0A672UZL1_MCL1-01      ------------------------------------------------at
A0A8C4U2H6_MCL1-01      agcgacgctcaccgccgcgcagctcgccgttcgtgcgcagtggccgccat
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      ------------------------------------------------at
A0A8B9M984_MCL1-02      ------------------------------------------------at
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      ------------------------------------------------at
A0A8C8RUG9_MCL1-01      ------------------------------------------------at
A0A8C3EZ48_MCL1-01      -----------------------------------------------tgt
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      ------------------------------------------------at
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      ------------------------------------------------at
A0A8C0GRW6_MCL1-01      -----------------------------------------------cat
A0A8C4YAJ9_MCL1-01      ------------------------------------------------at
A0A8C3H9M3_MCL1-01      ------------------------------------------------at
A0A674IPL6_MCL1-01      ------------------------------------------------at
                                                                          

B6V6J0_MCL1-01          gtcagtaattgccaagcagcgcccctcgactagtttcctcattccctgcc
A0A8C4RFB4_MCL1-01      gcttgcaactatgaaccgcagccccgctaccagcctagtccag-------
A0A4W4H9I6_MCL1-01      atgtgttacagcaaggagagctccgg------------------------
A0A8C9VMU9_MCL1-01      ttcattttttccaaaaatgagtcagtcgatgatgaagcctcctcacacca
A0A8C5QRL7_MCL1-01      ----------atgaatggggccgggcattttgtggtggccgggctgtttt
A0A8C9XS62_MCL1-01      gtctttgaaactgcacgacaacatggacaaggctcccctgtttaccttga
A0A3B4AFB7_MCL1-01      ------------------ga-------------------------cacc-
A0A3B4AFB7_MCL1-02      ta---attctccgaagaggaccgcgttaaaactgt---------ccacca
A0A3P8Y1W8_MCL1-04      gtcgaaatcgcttacacgagccacaactacga------------------
A0A3P8Y1W8_MCL1-05      gtcgaaatcgcttacacgagccacaactacga------------------
A0A6F9BEN5_MCL1-02      gtcgaagtcgtttacacgagccacaactacga------------------
Q0KFR9_MCL1-01          gtcgaactcgattacacgagccacaactacga------------------
A0A673VWA7_MCL1-01      gtcgaactcgattacacgagccacaactacga------------------
A0A4W5QGT1_MCL1-01      gtcgaagtccattgcacgagccacaactacga------------------
A0A8C8LPV9_MCL1-01      gtcgaagtcgattgcacgagccacaactacga------------------
A0A8C7LPD4_MCL1-01      gtcgaagtcgattgcacgagccacaactacga------------------
A0A8C7H1W6_MCL1-01      gtcgtcgtcgattgcccgagccacaactacga------------------
A0A8C7H1W6_MCL1-02      gtcgtcgtcgattgcccgagccacaactacga------------------
A0A4W5LP06_MCL1-01      ------gtcggttacacgagccacaactacga------------------
A0A4W5LP06_MCL1-02      ------gtcggttacacgagccacaactacga------------------
A0A674ELG3_MCL1-03      ------gtcgtttacacgagccacaactacga------------------
A0A674ELG3_MCL1-01      ------gtcgtttacacgagccacaactacga------------------
A0A674ELG3_MCL1-02      ------gtcgtttacacgagccacaactacga------------------
A0A8C7PM33_MCL1-03      gtcgaagtcgattacacgagccacaactacga------------------
A0A8C7PM33_MCL1-01      gtcgaagtcgattacacgagccacaactacga------------------
A0A8C7PM33_MCL1-02      gtcgaagtcgattacacgagccacaactacga------------------
A0A8C8CMB3_MCL1-01      gtcgaagtcgattacacgagccacaactacga------------------
A0A8C8CMB3_MCL1-02      gtcgaagtcgattacacgagccacaactacga------------------
A0A8C7H400_MCL1-01      gtcgaagtcgattacacgagccacaactacga------------------
A0A8C7H400_MCL1-02      gtcgaagtcgattacacgagccacaactacga------------------
A0A1A8A7I9_MCL1-01      -----cttcaacggaaaacccccagctctg--------------tctttg
A0A1A8A7I9_MCL1-03      -----cttcaacggaaaacccccagctctg--------------tctttg
A0A1A8A7I9_MCL1-02      -----cttcaacggaaaacccccagctctg--------------tctttg
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      ccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgaca
A0A8K9V051_MCL1-01      ccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgaca
A0A674D165_MCL1-01      cctcctcaaaacaaagttgaagcatctgaaactgtcagggtctatcgaca
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      ----------------------------------------------atga
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      acgtgccctatgctgtatact-----------------------------
A0A6Q2XXK6_MCL1-01      atatccccagggatctaactttaccagccgggtaaccgttacagttaaag
A0A6Q2Y9Q3_MCL1-01      atatccccagggatctaactttaccagccgggtaaccgttacagttaaag
A0A3P8VHY5_MCL1-04      -----taaagaacaaccaagctaagttgaacgttgccaccggagtcctag
A0A3P8VHY5_MCL1-05      -----taaagaacaaccaagctaagttgaacgttgccaccggagtcctag
A0A3P8VHY5_MCL1-02      -----taaagaacaaccaagctaagttgaacgttgccaccggagtcctag
A0A3P8VHY5_MCL1-01      -----taaagaacaaccaagctaagttgaacgttgccaccggagtcctag
A0A3P8VHY5_MCL1-03      -----taaagaacaaccaagctaagttgaacgttgccaccggagtcctag
A0A8C2Z1X1_MCL1-01      ------aagcacgaaacgagccgcgttcaaga---tgactggagtcatgg
G3PJT0_MCL1-01          tc---agagaccgaaactggccgcgttaaaca---tgaccggagtcatga
A0A3Q3S6A5_MCL1-01      tc---cgtcgacgagacgagccgccctcatac------ccggagtcatga
A0A3Q3S6A5_MCL1-02      tc---cgtcgacgagacgagccgccctcatac------ccggagtcatga
A0A3Q3VP02_MCL1-01      gt------------------------------------------------
A0A2U9CJ81_MCL1-01      tc---cttccacaaagcgggccgccttcaacgttacgaccggagtcatgg
A0A8D3B2J3_MCL1-05      ----------------------------------------------atgg
A0A8D3B2J3_MCL1-03      ----------------------------------------------atgg
A0A8D3B2J3_MCL1-04      ----------------------------------------------atgg
A0A8D3B2J3_MCL1-01      ----------------------------------------------atgg
A0A8D3B2J3_MCL1-02      ----------------------------------------------atgg
A0A667YZT5_MCL1-01      tt---------cgaagcgggcaaccattggagcaa---------ttggaa
A0A667YZT5_MCL1-02      tt---------cgaagcgggcaaccattggagcaa---------ttggaa
A0A3Q3B4P5_MCL1-01      -----cgaagccgaaac------------------------------cga
A0A3Q3B4P5_MCL1-02      -----cgaagccgaaac------------------------------cga
A0A3Q1GX28_MCL1-01      -----taccgtcgggcagaacagctatgaaactagccacgggaggaatga
A0A3Q1GX28_MCL1-02      -----taccgtcgggcagaacagctatgaaactagccacgggaggaatga
A0A3Q3GP42_MCL1-01      ta------atatgaagcgggcggcggtcagcgtatctgccggagtcatga
A0A8C5H9Y5_MCL1-01      -----tgtcgacgaagtcaactagtt------------------taatga
A0A8C5H9Y5_MCL1-02      -----tgtcgacgaagtcaactagtt------------------taatga
A0A671VEU3_MCL1-02      -----------cgaaaaaggctgcaatcac------gacgggagtcatga
A0A671VEU3_MCL1-01      -----------cgaaaaaggctgcaatcac------gacgggagtcatga
A0A671VEU3_MCL1-03      -----------cgaaaaaggctgcaatcac------gacgggagtcatga
A0A3B4T8L9_MCL1-01      tc---agtcgccgaaaccgaccgcttttacgg------------ccatga
A0A3B4T8L9_MCL1-02      tc---agtcgccgaaaccgaccgcttttacgg------------ccatga
A0A3B4XKA5_MCL1-01      cc---aggcaccgaaacaggccgctttaaccg------------ccgtga
A0A4W6CDF4_MCL1-03      tc---caacaacgaagcggaccgccc------------------tcatga
A0A4W6CDF4_MCL1-01      tc---caacaacgaagcggaccgccc------------------tcatga
A0A4W6CDF4_MCL1-02      tc---caacaacgaagcggaccgccc------------------tcatga
A0A3B4ZKP6_MCL1-01      tc---cgacgacgaaacggacggcgc------------------tcatga
A0A3Q1EQB9_MCL1-01      tc------ctacgaagaggacgacgc------------------tgatga
A0A3Q1EQB9_MCL1-02      tc------ctacgaagaggacgacgc------------------tgatga
A0A3P8RQX7_MCL1-01      tccgacgacgacgaagaggacggcgt------------------tcatga
A0A3P8RQX7_MCL1-02      tccgacgacgacgaagaggacggcgt------------------tcatga
A0A3Q1BKL8_MCL1-01      tccgacgacgacgaagaggacggcgt------------------tcatga
A0A3Q1BKL8_MCL1-02      tccgacgacgacgaagaggacggcgt------------------tcatga
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      ta---ctatgaggaattgtcgaatgggctcgtataaaaatg---tcatgg
A0A668SNL1_MCL1-01      ------------------------gttctcct------------taaatt
I3KXG5_MCL1-01          ------------------------gttctcct------------taaatt
A0A669C7T2_MCL1-03      tt---tgatgtcgaaaaggaaccagtgtacct------------tcatag
A0A668RLC9_MCL1-01      tt---tgatgtcgaaaaggaaccagtttacct------------tcatag
A0A669C7T2_MCL1-01      tt---tgatgtcgaaaaggaaccagtgtacct------------tcatag
A0A669C7T2_MCL1-02      tt---tgatgtcgaaaaggaaccagtgtacct------------tcatag
A0A3Q4HLQ8_MCL1-01      ta---tgatgtcgaaaaggaaccagtgcacct------------tcatag
A0A3P9BVM3_MCL1-01      ta---tgatgttgaaaaggaaccagtgtaccc------------taatgg
A0A3P8NP63_MCL1-02      ta---tgatgttgaaaaggaaccagtgcacct------------taatgg
A0A3P8NP63_MCL1-01      ta---tgatgttgaaaaggaaccagtgcacct------------taatgg
A0A3P8NP63_MCL1-03      ta---tgatgttgaaaaggaaccagtgcacct------------taatgg
A0A3Q2VNL8_MCL1-01      ta---tgatgttgaaaaggaaccagtgcacct------------taatgg
A0A3B4G4Z6_MCL1-01      ta---tgatgttgaaaaggaaccagtgcacct------------taatgg
A0A8C9XY04_MCL1-01      ta---ttccggcgaaacggaccgcgttcaacgtaacgaccggagtcatga
A0A8P4G790_MCL1-01      aa---ttcagacaaatcgggccgcctacagcctaacgaacggaaacatga
A0A8P4G790_MCL1-02      aa---ttcagacaaatcgggccgcctacagcctaacgaacggaaacatga
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          gttcgctg------gaagaaac------aa--------------------
A2BF68_MCL1-01          gttcgctg------gaagaaac------aa--------------------
Q568W5_MCL1-01          gttcgctg------gaagaaac------aa--------------------
A0A671RQ00_MCL1-01      gttccctg------ggagtaaagttttaaa--------------------
A0A673IXK8_MCL1-01      gttccctg------ggagtaaagttttaaa--------------------
A0A672RP45_MCL1-02      gt------------ggagcgca-tttta----------------------
A0A672RP45_MCL1-01      gttccctg------ggagtaaagttttaaa--------------------
A0A672RP45_MCL1-03      gttccctg------ggagtaaagttttaaa--------------------
A0A8C1JUN1_MCL1-01      gtttcctg------ggagtaaagtttcaaa--------------------
A0A8C1JUN1_MCL1-02      gtttcctg------ggagtaaagtttcaaa--------------------
A0A671L9M9_MCL1-01      gttccctg------ggagtaaagtttcaaa--------------------
A0A672KMK1_MCL1-01      gttccctg------ggagtaaagtttcaaa--------------------
A0A673MXF5_MCL1-01      gttccctg------ggagtaaagtttcaaa--------------------
A0A3B3R4U0_MCL1-01      -atgaatctgatcaatcgtaccacggccac-cggcttgttctgccccggc
A0A3B4C341_MCL1-01      ttattttcatttgtgtgggaa------------------------tttt-
A0A3B4C341_MCL1-02      ccactatgcaaaatatccaaagactgtttt---------tccttctttg-
A0A3B4C341_MCL1-03      gtattttg------ataagaagactgtttt---------tccttctttg-
A0A3B1K5R1_MCL1-01      g-atg-------agcccacaggatatgtgttcgtataacaag--------
A0A8B9JW80_MCL1-01      gcatatttttctaagccacaacgt--------gcagaacgagact-----
A0A3B3SG34_MCL1-01      tccacaaagcttgaagagttacgcgccgat-----------------ta-
A0A8C1YDY0_MCL1-01      ---------gttttgggattaaacgaacggccgcgttgagtgtcttcgcg
A0A673GSK0_MCL1-03      accttcgacgttcagac---------------------------------
A0A673GSK0_MCL1-01      attttaaatatttagtcagaagaacggctgcggtc---------agtctg
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      ---------gtttagtcagaagaacggctgcggtg---------agtctg
A0A672PT04_MCL1-02      agccggcccgtgtg---aggggaggagtttcgggg---------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      cattaccccgtgagtcagagggtgaagcttcagtg---------ctttca
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      ---------gtttggggaatagaccgatggctgcg---------------
A0A673HSI2_MCL1-01      ---------gtttggggaatagaccgatggctgcg---------------
A0A4W4F1X6_MCL1-01      tatgacgacgatgaagcgcacgacagcgatagggctg-------------
Q568V1_MCL1-01          ----------------------------a----------tgagcttcct-
Q1L8X3_MCL1-01          gagtttggattttaggcgaacggccacga----------tgagcttctt-
Q9I9N3_MCL1-01          gagtttggattttaggcgaacggccacga----------tgagcttctt-
A0A3B3CEX1_MCL1-01      gcttcctt---tgcaaaaacacatggttaa-cagctacattacgccgag-
A0A3B3CEX1_MCL1-02      gcttcctt---tgcaaaaacacatggttaa-cagctacattacgccgag-
A0A8C7X109_MCL1-01      gtttcctt---tgcaaaaacagatggttaa-cagctacatcacgtctaa-
A0A3P9ILF6_MCL1-01      gtttcctt---tgcaaaaacagatggttaa-cagctacatcacgtctaa-
A0A3P9ILF6_MCL1-02      gtttcctt---tgcaaaaacagatggttaa-cagctacatcacgtctaa-
A0A3B3IJ04_MCL1-01      gtttcctt---tgcaaaaacagatggttaa-cagctacatcacgtctaa-
A0A3B3IJ04_MCL1-02      gtttcctt---tgcaaaaacagatggttaa-cagctacatcacgtctaa-
A0A3P9L1F3_MCL1-01      gtttcctt---tgcaaaaacagatggttaa-cagctacatcacgtctaa-
A0A3P9L1F3_MCL1-02      gtttcctt---tgcaaaaacagatggttaa-cagctacatcacgtctaa-
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      atgagtatgtcaacgatgaaccgcgtttccgctgttagtctgctctgccc
A0A3B4CGU9_MCL1-03      gga-------------------gagcgc----cgccat--cagcctgttc
A0A3B4CGU9_MCL1-01      ggaagctc--------acggtggagttcagatcaacatggcagctcatcc
A0A3B4CGU9_MCL1-02      ggaagctc--------acggtggagttcagatcaacatggcagctcatcc
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      ----------atgagcctgagcgccatgaagcgtccggcggg--------
A0A3B5PQ55_MCL1-01      gacagcta---attcgacaaacgcgttaaactatctcattttttctcaaa
A0A3B5PQ55_MCL1-02      gacagcta---attcgacaaacgcgttaaactatctcattttttctcaaa
A0A3P9Q4I8_MCL1-01      gacggcta---attcgacaaccgcgttaaactatctcattttttcacaaa
A0A3P9Q4I8_MCL1-02      gacggcta---attcgacaaccgcgttaaactatctcattttttcacaaa
A0A3B3VM25_MCL1-01      gacggcta---attcgacaaccgcgttaaactatctaattttttctcaaa
A0A087X830_MCL1-01      gacggcta---attcgacaaccgcattaaactatctaattttttctcaaa
A0A3B3YCD0_MCL1-01      gacggcta---attcgacaaccgcgttaaactatctaattttttctcaaa
A0A665TFT7_MCL1-01      atgagcctttttcaaacacacaagtcttctgccttcgggtccgcctccac
A0A672GRK8_MCL1-01      gtcgacgaacaccaaacgggccgggttatt-tggctgccttatttttcc-
A0A674PI93_MCL1-01      gaatattattgcgaatcacaccgcgttgag-----------aatcatga-
J7H260_MCL1-01          gggcggct------------------------------------ctctg-
A0A3B1IEV7_MCL1-01      ----------atgaacccaaccgcga-------------tcagcctc---
A0A8C6SVR4_MCL1-02      attcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggag
A0A8C6SVR4_MCL1-01      attcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggag
A0A8C6SVR4_MCL1-03      attcggcatccctacaacaatgttgggtatgcttatgcctcaaaatggag
A0A3P8Y1W8_MCL1-01      -----------tcaaa----aagcgacccacgggaca--tcgac------
A0A3P8Y1W8_MCL1-02      -----------tcaaa----aagcgacccacgggaca--tcgac------
A0A3P8Y1W8_MCL1-03      -----------tcaaa----aagcgacccacgggaca--tcgac------
A0A8C5CE84_MCL1-02      tttaacagccctcaaaatggaggcgaagagcgaaaca--tggacttcca-
A0A8C5CE84_MCL1-03      tttaacagccctcaaaatggaggcgaagagcgaaaca--tggacttcca-
A0A8C5CE84_MCL1-01      tttaacagccctcaaaatggaggcgaagagcgaaaca--tggacttcca-
A0A8C5CE84_MCL1-04      -----cggacccca-----------------gggaca--tagac------
W5MMB7_MCL1-01          cctctcctcgctgaagcgcacctcggccag-cgccgtgatacagctcta-
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      gttaggccctttcaagaagaacgccgtcat-cggcc---tcaaccttta-
A0A5F8GAQ2_MCL1-01      gttaggccctttcaagaagaacgccgtcat-cggcc---tcaaccttta-
A0A5F8GAQ2_MCL1-02      gttaggccctttcaagaagaacgccgtcat-cggcc---tcaaccttta-
A0A7N4PRP1_MCL1-01      gttaggcccttttaagaaaaacgccgtcat-cggcc---tcaatctgta-
A0A7N4PRP1_MCL1-02      gttaggcccttttaagaaaaacgccgtcat-cggcc---tcaatctgta-
A0A7N4PRP1_MCL1-03      gttaggcccttttaagaaaaacgccgtcat-cggcc---tcaatctgta-
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          gtttggcc---ccaaaagaaatgcattcat-cggac---tcaacctcca-
G1PZ39_MCL1-01          ---------------------------------gcc---ccgccctctc-
A0A8I5ZM43_MCL1-01      gtttggcc---tgtggagaaacactgtaat-cccct---tgaacctgaa-
A0A8I5Y8B7_MCL1-01      gtttggcc---tgcggagaaacggggtaat-gggct---tgaacctgta-
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      gtttggcc---tgcggagaaacgcggtgat-cggcc---tgaacctgta-
A0A8C2MG79_MCL1-02      gtttggcc---tgcggagaaacgcggtgat-cggcc---tgaacctgta-
A0A8C6GJU8_MCL1-01      gtttggcc---tgcggagaaacgcggtcat-cggct---tgaacctgta-
A0A8C6GJU8_MCL1-02      gtttggcc---tgcggagaaacgcggtcat-cggct---tgaacctgta-
A0A8C6GJU8_MCL1-03      gtttggcc---tgcggagaaacgcggtcat-cggct---tgaacctgta-
A0A2K6F6N9_MCL1-01      ----gatc---tgtggattaacctggggat----------------cag-
A0A2K5DMS4_MCL1-01      gtttggct---tccaa------gtggtaat-cagac---tcaacctcta-
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          gtttagcc---tgagaagaaacgcggtaat-cggac---tcaacctcta-
G1T2Q0_MCL1-02          gtttagcc---tgagaagaaacgcggtaat-cggac---tcaacctcta-
G3T756_MCL1-01          gttcggct---tcaagagaaacgcagtaat-cggac---tcaaccttta-
A0A8C6QA84_MCL1-01      gtttggcc---tgagaaggaacgcggtaat-cggcc---tcaacctgta-
A0A8C5VC33_MCL1-01      ctgtgtct---t----------------at------------atctcag-
A0A8D2KCB0_MCL1-01      gttcggct---ttaagaggaacgcggtcat-cggac---tcaacctcta-
A0A8C9QEN4_MCL1-01      gttcggcc---ttaagaggaacgcggtcat-cggac---tcaacctcta-
A0A287DCH9_MCL1-01      gttcggcc---ttaagaggaacgcggtcat-cggac---tcaacctcta-
A0A287DCH9_MCL1-02      gttcggcc---ttaagaggaacgcggtcat-cggac---tcaacctcta-
A0A2K5C7L5_MCL1-01      gtttggcc---tccaaagaaacgcgctaat-cggac---tcaacctcta-
H0XFB7_MCL1-01          gtttggcc---tcaagagaaacgcagtgat-cggac---tcaacctcta-
A0A8C9AD42_MCL1-01      g----------------------------------c---gcaactct---
A0A8B7GKA0_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8B7GKA0_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8B7GKA0_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8C9AD42_MCL1-02      gtttggcc---tcaaaagaaatgcggtaat-cggac---tcaacctcta-
A0A8C9AD42_MCL1-03      gtttggcc---tcaaaagaaatgcggtaat-cggac---tcaacctcta-
A0A2K6GI15_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6GI15_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6GI15_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      gtttggcc---tcaagagaaacgcggtaat-cggac---tcaacctcta-
G2HFR3_MCL1-01          --------------------------------ggac--------------
C8YZ26_MCL1-01          gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I3RTV4_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A087WT64_MCL1-09      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I2YJ87_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I3RTV4_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2R9BPJ5_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2R9BPJ5_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I3RTV4_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I2YJ87_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
B4DU51_MCL1-01          gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
B4DLY8_MCL1-01          gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A087WT64_MCL1-06      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A087WT64_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      gttcggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8I5TL14_MCL1-02      gttcggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8I5TL14_MCL1-03      gttcggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5I9I0_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5I9I0_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5I9I0_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8C9I795_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8C9I795_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6KRW9_MCL1-02      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6PPI3_MCL1-02      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6KRW9_MCL1-01      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6PPI3_MCL1-01      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6KRW9_MCL1-03      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6PPI3_MCL1-03      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A096MRS6_MCL1-04      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A096MRS6_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I3GB35_MCL1-01      gtttggcc---tcagaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I3GB35_MCL1-02      gtttggcc---tcagaagaaacgcggtaat-cggac---tcaacctcta-
A0A2I3GB35_MCL1-03      gtttggcc---tcagaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5LXU8_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5XSB2_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5W0Y7_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6ECQ5_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5LXU8_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5LXU8_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A0D9RZP5_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
I7G687_MCL1-01          gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5W0Y7_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5W0Y7_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6ECQ5_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
F7HUE9_MCL1-01          gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6ECQ5_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8D2F160_MCL1-01      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8D2F160_MCL1-02      gtttggct---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5XSB2_MCL1-01      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5XSB2_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A096MRS6_MCL1-02      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
A0A096MRS6_MCL1-03      gtttggcc---tcaaaagaaacgcggtaat-cggac---tcaacctcta-
F7GTF7_MCL1-01          gtttggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6V5X4_MCL1-02      gttcggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6V5X4_MCL1-01      gttcggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K6V5X4_MCL1-03      gttcggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
F7GTF7_MCL1-02          gtttggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5CFB8_MCL1-03      gtttggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5CFB8_MCL1-01      gtttggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
A0A2K5CFB8_MCL1-02      gtttggcc---tccaaagaaacgcggtaat-cggac---tcaacctcta-
A0A8C0CVU0_MCL1-01      gctcggcc---tcaagagaaacacagtaat-cggac---tcaaactcta-
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          attt----------------------------------------------
A0A4W2CQV1_MCL1-01      gtgt----------------------------------------------
A0A4W2CQV1_MCL1-01      gtgt----------------------------------------------
A0A4W2G6Q5_MCL1-01      gtgt----------------------------------------------
A0A4W2G6Q5_MCL1-01      gtgt----------------------------------------------
A0A8C6E5E6_MCL1-01      gttcggcc---tcaagagaaacgcagtaat-cggac---tgaacctcta-
A0A8C6E5E6_MCL1-02      gttcggcc---tcaagagaaacgcagtaat-cggac---tgaacctcta-
A0A452GA25_MCL1-01      gttcggcc---tcaagagaaacgcagtaat-cggac---tgaacctcta-
A0A452GA25_MCL1-02      gttcggcc---tcaagagaaacgcagtaat-cggac---tgaacctcta-
A5PJR2_MCL1-01          gttcggcc---tcaagagaaacgcagtaat-cggac---taaacctcta-
A0A8B9W7D1_MCL1-03      gttcggcc---tcaagagaaacgcagtaat-cggac---taaacctcta-
A0A8B9W7D1_MCL1-04      gttcggcc---tcaagagaaacgcagtaat-cggac---taaacctcta-
A0A8B9W7D1_MCL1-01      gttcggcc---tcaagagaaacgcagtaat-cggac---taaacctcta-
A0A8B9W7D1_MCL1-02      gttcggcc---tcaagagaaacgcagtaat-cggac---taaacctcta-
A0A671G0G2_MCL1-01      gctgggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A671G0G2_MCL1-02      gctgggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A671G0G2_MCL1-03      gctgggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A8D2AJ70_MCL1-01      gtttggcc---ttaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A8D2AJ70_MCL1-02      gtttggcc---ttaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A673TBH1_MCL1-04      gtttggcc---tcaagaggaacgccgtaat-cggac---tcaacctcta-
A0A673TBH1_MCL1-05      gtttggcc---tcaagaggaacgccgtaat-cggac---tcaacctcta-
A0A673TBH1_MCL1-03      gtttggcc---tcaagaggaacgccgtaat-cggac---tcaacctcta-
A0A673TBH1_MCL1-01      gtttggcc---tcaagaggaacgccgtaat-cggac---tcaacctcta-
A0A673TBH1_MCL1-02      gtttggcc---tcaagaggaacgccgtaat-cggac---tcaacctcta-
A0A8C4L244_MCL1-01      gtttggcc---tgaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A5F5Q151_MCL1-01      gtttggcc---tgaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A5F5Q151_MCL1-02      gtttggcc---tgaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A8C0DF47_MCL1-02      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A8C0DF47_MCL1-01      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A8C0DF47_MCL1-03      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A4V5P8C2_MCL1-01      gttcggcc---tcaagagaaacgcagtgat-cggac---tcaacctcta-
A0A4V5P8C2_MCL1-02      gttcggcc---tcaagagaaacgcagtgat-cggac---tcaacctcta-
A0A8C9BA52_MCL1-01      gttcggcc---tcaagagaaacgcagtgat-cggac---tcaacctcta-
A0A8C9BA52_MCL1-02      gttcggcc---tcaagagaaacgcagtgat-cggac---tcaacctcta-
A0A337S3J9_MCL1-02      gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
A0A8C9K7H4_MCL1-01      gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
A0A8C8Y0M9_MCL1-01      gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
A0A8C8Y0M9_MCL1-02      gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
A0A667GXX5_MCL1-01      gtttggcc---tcaaaagaaacgctgtaat-cggac---tcaacctcta-
A0A667GXX5_MCL1-02      gtttggcc---tcaaaagaaacgctgtaat-cggac---tcaacctcta-
A0A337S3J9_MCL1-01      gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
Q7YRZ9_MCL1-01          gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
A0A337S3J9_MCL1-03      gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
A0A337S3J9_MCL1-04      gtttggcc---tcaagagaaacgctgtaat-cggac---tcaacctcta-
Q8HYS5_MCL1-01          gtttggcc---tcaagagaaacgcagtaatccggac---tcaa-ctcta-
A0A8C0MCZ5_MCL1-02      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A8C0L4C8_MCL1-01      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A8C0MCZ5_MCL1-01      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A8I3P430_MCL1-01      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A8I3P430_MCL1-02      gttcggcc---tcaagagaaacgcagtaat-cggac---tcaacctcta-
A0A8C3W949_MCL1-01      gtttggct---tcaagagaaacgcagtaat-cgggc---tcaacctcta-
A0A8C3W949_MCL1-02      gtttggct---tcaagagaaacgcagtaat-cgggc---tcaacctcta-
A0A8C3W949_MCL1-03      gtttggct---tcaagagaaacgcagtaat-cgggc---tcaacctcta-
Q95KR3_MCL1-01          gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1FTD4_MCL1-03      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1G1G8_MCL1-04      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A4X1SEZ6_MCL1-01      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A4X1SFB1_MCL1-01      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1FTD4_MCL1-01      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1G1G8_MCL1-02      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1RYD1_MCL1-01      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A4X1SEU3_MCL1-02      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A4X1SEZ6_MCL1-03      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A4X1SFB1_MCL1-02      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1FTD4_MCL1-05      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1G1G8_MCL1-01      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1RYD1_MCL1-03      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A4X1SEU3_MCL1-01      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1G1G8_MCL1-03      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1FTD4_MCL1-02      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1RYD1_MCL1-02      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A4X1SEZ6_MCL1-02      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
A0A8D1FTD4_MCL1-04      gtttggcc---tccagagaaacgcagtaat-cggac---tcaacctcta-
M3XZZ5_MCL1-01          gtttggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A8C7BMW8_MCL1-01      gtttggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A8C7BMW8_MCL1-02      gtttggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A452RHX5_MCL1-01      gtttggcc---tgaagagaaacgcagtaat-cggac---tcaacctcta-
G1L3L7_MCL1-01          gtttggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
G1L3L7_MCL1-02          gtttggcc---tcaaaagaaacgcagtaat-cggac---tcaacctcta-
A0A803T0A4_MCL1-01      gtttaaca---agaaatcgatggtgctggt--------------------
A0A803T0A4_MCL1-02      gtttaaca---agaaatcgatggtgctggt--------------------
A0A803T0A4_MCL1-03      gtttaaca---agaaatcgatggtgctggt--------------------
A0A670K3Y6_MCL1-01      gtttaaca---agaagtcgg-------------------tggtgttgta-
A0A8D0E7Q9_MCL1-01      gccattgt---tgaatcggaaagcga-------------tggtgctgtg-
A0A8D0E7Q9_MCL1-02      gccattgt---tgaatcggaaagcga-------------tggtgctgtg-
A0A8C5PJK5_MCL1-01      ggccgcca---tgagagcgaagccaggcac-cctcc--ttcactcgctac
A0A670Z5Q4_MCL1-01      --------------tgtgaaa-------------------------gta-
A0A8C5WWU9_MCL1-01      -------------atgttcaacaagaagac-ga------tggttctcta-
A0A8C6VLE3_MCL1-01      gccggtcg---ccatgttcaacaagaagac-ga------tggttctgta-
A0A8C6VLE3_MCL1-02      gccggtcg---ccatgttcaacaagaagac-ga------tggttctgta-
A0A8D2IVC0_MCL1-04      -------------------aact---------------------------
A0A8D2IVC0_MCL1-01      -acgggc----ctgagcggaactcg-------------------------
A0A8D2IVC0_MCL1-02      -atggccg---ccatgttgaacacgaaggc-ga------tggtgctgta-
A0A8D2IVC0_MCL1-03      -atggccg---ccatgttgaacacgaaggc-ga------tggtgctgta-
A0A6I8NSR7_MCL1-01      gctgggcc---tgcagaagaacgccgtcat-cggcc---tcaacctcta-
A0A6I8NSR7_MCL1-02      gctgggcc---tgcagaagaacgccgtcat-cggcc---tcaacctcta-
A0A8C9NTQ6_MCL1-01      ttttgcag---agcccctggagtcccacat-cgcccattttggctctta-
A0A8D2MBY7_MCL1-01      ttctgc--------------------------------------------
A0A8C6YT47_MCL1-01      gggggtca---cagtggtgacaggcatcct-tggca----gtgctcgag-
A0A8B9BNC2_MCL1-01      gggggcac---agctccgccaccg-------cgact---t---ccccca-
A0A8B9EU67_MCL1-01      ----gctc---tt------------------cggtc---ccgccgcccc-
A0A493U0E8_MCL1-01      cggagtcc---tg--gagaaaca--------cgagc---tggccttcca-
A0A8B9VGG9_MCL1-01      cggagtcc---tg--gagaaaca--------cgagc---tggccttcca-
A0A8B9SWV2_MCL1-01      ---cgccc---tgccgcgcaacgccctcat-cggct---tcaacctcta-
A0A8C3GNC2_MCL1-01      ---cgccc---tgccgcgcaacgccctcat-cggct---tcaacctcta-
A0A8C4K2K9_MCL1-01      ------------------------------------------------c-
A0A8B9P3N9_MCL1-01      --------------tccccgtggcttttcc-cacatgctcccacgtcct-
A0A8C3UEV5_MCL1-01      --------------------atgctcggtg-ctgcagaaccgagagcga-
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      gttcgccg---tgaagccgaaagctttcat-cggct---tcaacctcta-
A0A8C0UE15_MCL1-01      --------------------atgctctgca-catcc---ctgag------
A0A8C3QRB8_MCL1-01      gttcgccg---tgaagccgaaagccgtcat-cggct---tcaacctcta-
A0A8D2NMF1_MCL1-01      ---------------------------------tcc---cggac------
A0A8D2NMF1_MCL1-02      --------------agcaggaatctctctc-catcc---ctgacac----
G1MPY7_MCL1-01          gg-----------aggtggggtccctgc-----------tctgctcatt-
A0A8C2TT61_MCL1-01      gtttgccg---tcaaacggaacgccgtcat-cggct---tcaatctcta-
A0A8C2TT61_MCL1-02      gtttgccg---tcaaacggaacgccgtcat-cggct---tcaatctcta-
A0A8C9EP12_MCL1-01      gtttgccg---tcaagcggaacgccgtcat-cggct---tcaacctcta-
A0A669R428_MCL1-01      gtttgcgg---tcaagcggaacgccgtcat-cggct---tcaacctcta-
A0A8B9GMI8_MCL1-01      gttcgcgc---tcaagcggaaagcggtcat-cggcc---tcaacctcta-
A0A672UZL1_MCL1-01      gttcgcgc---tcaagcggaacgcggtcat-cggcc---tcaacctcta-
A0A8C4U2H6_MCL1-01      gttcgctg---tgaagcggaacgccgtcat-tagct---tcaacctcta-
A0A663EQJ0_MCL1-01      --------------agcggaacgccgtcat-cggct---tcaacctcta-
A0A663EQJ0_MCL1-02      --------------agcggaacgccgtcat-cggct---tcaacctcta-
A0A8B9M984_MCL1-01      gttcgccg---tgaagcggaacgccgtcat-cggct---tcaacctcta-
A0A8B9M984_MCL1-02      gttcgccg---tgaagcggaacgccgtcat-cggct---tcaacctcta-
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      gttagcga---tgaagcgaagcgcggtgat-cggac---tcaatctcta-
A0A8C8RUG9_MCL1-01      gttggcgc---tgaagcggaacgctgtgat-cggcc---tcaacattta-
A0A8C3EZ48_MCL1-01      gctgggg-----------------ggtgct-ccccc--------------
A0A674JQC4_MCL1-01      -atggag---------------aaggtgct--------------------
A0A8C3TAL3_MCL1-01      gttggcgt---taaagcggaacgtggtgat-cagcc---tcaacctgta-
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      gttggcgt---taaagcgcaacgcggtgat-cggcc---tcaacctgta-
A0A8C0GRW6_MCL1-01      gttggcgt---taaagcggaacgcggtgat-c-gcc---tcaacttgta-
A0A8C4YAJ9_MCL1-01      gttggcgc---tgaagcggaacgcggtgat-cggcc---tcaacctgta-
A0A8C3H9M3_MCL1-01      gttggcgt---taaagcggaacgcggtgat-cggcc---tcaacctgta-
A0A674IPL6_MCL1-01      gttggcgt---taaagcggaacgcggtgat-cggcc---tcaacctgta-
                                                                          

B6V6J0_MCL1-01          agttttactgctcgggcggcggctcctcagagaagacattgagcgcgcgt
A0A8C4RFB4_MCL1-01      -------atgttatact----gctctggaccgtcgggtttgaatggcgtt
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      gttttatggacatttgc----tgtccgggaaataaagctcgaggtggagg
A0A8C5QRL7_MCL1-01      gtgatggcagagggaca----tgttgtttgagtggagctttattgcg---
A0A8C9XS62_MCL1-01      a------ccgttgggga----ctcctcgaaaccgacagtgccggagcgtg
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      t------gggcttgttt----ctgcctcaaaatggactcgcggagggg--
A0A3P8Y1W8_MCL1-04      ------------tgctc----aacgttcaaaatggagtcgtggga---tc
A0A3P8Y1W8_MCL1-05      ------------tgctc----aacgttcaaaatggagtcgtggga---tc
A0A6F9BEN5_MCL1-02      ------------tgttg----aatattcaaaatggagtcgtcggaggatc
Q0KFR9_MCL1-01          ------------tgttg----cattttcaaaat---------ggaggatc
A0A673VWA7_MCL1-01      ------------tgttg----cattttcaaaat---------ggaggatc
A0A4W5QGT1_MCL1-01      ------------tgttg----cattttcaaaat---------ggaggatc
A0A8C8LPV9_MCL1-01      ------------tgttg----cattttcaaaat---------ggaggatc
A0A8C7LPD4_MCL1-01      ------------tgttg----cattttcaaaat---------ggaggatc
A0A8C7H1W6_MCL1-01      ------------tgttg----cattttcaaaat---------ggaggatc
A0A8C7H1W6_MCL1-02      ------------tgttg----cattttcaaaat---------ggaggatc
A0A4W5LP06_MCL1-01      ------------tgtgg----cattatcaaaatggagtcttcgga---cc
A0A4W5LP06_MCL1-02      ------------tgtgg----cattatcaaaatggagtcttcgga---cc
A0A674ELG3_MCL1-03      ------------ttttg----aattttcaaaatggagtcgtcggaggctc
A0A674ELG3_MCL1-01      ------------ttttg----aattttcaaaatggagtcgtcggaggctc
A0A674ELG3_MCL1-02      ------------ttttg----aattttcaaaatggagtcgtcggaggctc
A0A8C7PM33_MCL1-03      ------------tgttg----aattttcaaaatggagtcgttggaggctc
A0A8C7PM33_MCL1-01      ------------tgttg----aattttcaaaatggagtcgttggaggctc
A0A8C7PM33_MCL1-02      ------------tgttg----aattttcaaaatggagtcgttggaggctc
A0A8C8CMB3_MCL1-01      ------------tgttg----aattttcaaaatggagtcgttggaggctc
A0A8C8CMB3_MCL1-02      ------------tgttg----aattttcaaaatggagtcgttggaggctc
A0A8C7H400_MCL1-01      ------------tgttg----aattttcaaaatggagtcgttggaggctc
A0A8C7H400_MCL1-02      ------------tgttg----aattttcaaaatggagtcgttggaggctc
A0A1A8A7I9_MCL1-01      g------ctgtcttttc----t---ctcaaaatggagtcgtggatgga--
A0A1A8A7I9_MCL1-03      g------ctgtcttttc----t---ctcaaaatggagtcgtggatgga--
A0A1A8A7I9_MCL1-02      g------ctgtcttttc----t---ctcaaaatggagtcgtggatgga--
A0A4W5KYB3_MCL1-01      -------------------------------------------atgta--
A0A4W5LZB2_MCL1-01      -------------------------------------------atgaa--
A0A4W5Q5Q2_MCL1-01      -------------------------------------------gcaga--
A0A4W5Q5Q2_MCL1-02      -------------------------------------------atgga--
A0A8C7N2B4_MCL1-01      g------cactcctttg----ttcactagcagaggacctgaacatgag--
A0A8K9V051_MCL1-01      g------cactcctttg----ttcactagcagaggacctgaacatgag--
A0A674D165_MCL1-01      g------cactcctttg----ttcactaggagaggacccggacatgag--
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      g------ttaccttatt----cttccacaaaatggagtcgtggacgga--
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      g------gtttggcata----tccgcactaaa-----gcgtagagaaa--
A0A6Q2Y9Q3_MCL1-01      g------gtttggcata----tccgcactaaa-----gcgtagagaaa--
A0A3P8VHY5_MCL1-04      g------ctgtttcatc----gtccctcaaaatggagtcgttaatgga--
A0A3P8VHY5_MCL1-05      g------ctgtttcatc----gtccctcaaaatggagtcgttaatgga--
A0A3P8VHY5_MCL1-02      g------ctgtttcatc----gtccctcaaaatggagtcgttaatgga--
A0A3P8VHY5_MCL1-01      g------ctgtttcatc----gtccctcaaaatggagtcgttaatgga--
A0A3P8VHY5_MCL1-03      g------ctgtttcatc----gtccctcaaaatggagtcgttaatgga--
A0A8C2Z1X1_MCL1-01      g------ctgtattatc----cttcctcaaaatggagtcgtggagcga--
G3PJT0_MCL1-01          g------ctgcattatt----ctccctcaaaatggagtcgcg--------
A0A3Q3S6A5_MCL1-01      ------------tcgtc----cttccccaagatggagtcctggaggga--
A0A3Q3S6A5_MCL1-02      ------------tcgtc----cttccccaagatggagtcctggaggga--
A0A3Q3VP02_MCL1-01      -------------------------ttcaaaatggagtcgtgtcggga--
A0A2U9CJ81_MCL1-01      g------ctgcctcatt----cttcctcaaaatggagtcgtggaggga--
A0A8D3B2J3_MCL1-05      g------ctgcctcatt----cttcctcaaaatggagtcgtggaggga--
A0A8D3B2J3_MCL1-03      g------ctgcctcatt----cttcctcaaaatggagtcgtggaggga--
A0A8D3B2J3_MCL1-04      g------ctgcctcatt----cttcctcaaaatggagtcgtggaggga--
A0A8D3B2J3_MCL1-01      g------ctgcctcatt----cttcctcaaaatggagtcgtggaggga--
A0A8D3B2J3_MCL1-02      g------ctgcctcatt----cttcctcaaaatggagtcgtggaggga--
A0A667YZT5_MCL1-01      g------ttgttttatt----tttcctcaaaatggagtcgtcgaggga--
A0A667YZT5_MCL1-02      g------ttgttttatt----tttcctcaaaatggagtcgtcgaggga--
A0A3Q3B4P5_MCL1-01      g------ctatattttt----tttcttcaaaatggagtcgtggacgga--
A0A3Q3B4P5_MCL1-02      g------ctatattttt----tttcttcaaaatggagtcgtggacgga--
A0A3Q1GX28_MCL1-01      g------ctgcttgatg----cttcctcaaaatggagtcgtagag-----
A0A3Q1GX28_MCL1-02      g------ctgcttgatg----cttcctcaaaatggagtcgtagag-----
A0A3Q3GP42_MCL1-01      g------ctttatgatg----c---cacaaaatggagtcgggaaggga--
A0A8C5H9Y5_MCL1-01      a------ctgcctttta----gcaacacaaaatggaggcgtagaagga--
A0A8C5H9Y5_MCL1-02      a------ctgcctttta----gcaacacaaaatggaggcgtagaagga--
A0A671VEU3_MCL1-02      g------ctactt-------------tcaaaatggagtcgtaggtgga--
A0A671VEU3_MCL1-01      g------ctactt-------------tcaaaatggagtcgtaggtgga--
A0A671VEU3_MCL1-03      g------ctactt-------------tcaaaatggagtcgtaggtgga--
A0A3B4T8L9_MCL1-01      a------ctattgcatt----tgtcgtcaaaatggaggattggaaact--
A0A3B4T8L9_MCL1-02      a------ctattgcatt----tgtcgtcaaaatggaggattggaaact--
A0A3B4XKA5_MCL1-01      a------ctattgcatt----tgtcgtcaaaatggaggattggagact--
A0A4W6CDF4_MCL1-03      a------ctgttttatt----cttcctcaaaatggagtcgcggaggga--
A0A4W6CDF4_MCL1-01      a------ctgttttatt----cttcctcaaaatggagtcgcggaggga--
A0A4W6CDF4_MCL1-02      a------ctgttttatt----cttcctcaaaatggagtcgcggaggga--
A0A3B4ZKP6_MCL1-01      g------ctgctttatt----cttcctcaaaatggagtcgttgaggga--
A0A3Q1EQB9_MCL1-01      a------ctgcttaatc----tttccgcaaaatggagtcgtggaggga--
A0A3Q1EQB9_MCL1-02      a------ctgcttaatc----tttccgcaaaatggagtcgtggaggga--
A0A3P8RQX7_MCL1-01      a------ctacttaatt----tttcctcaaaatggagtcgtggaggga--
A0A3P8RQX7_MCL1-02      a------ctacttaatt----tttcctcaaaatggagtcgtggaggga--
A0A3Q1BKL8_MCL1-01      a------ctacttaatt----tttcctcaaaatggagtcgtggaggga--
A0A3Q1BKL8_MCL1-02      a------ctacttaatt----tttcctcaaaatggagtcgtggaggga--
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      -----------tctctt----c---ctt----------------------
A0A3Q0R633_MCL1-03      a------cctttttctt----c---ctcaaaatggagtcgtggacgga--
A0A668SNL1_MCL1-01      g------ctgtctg------------tctgagtggtgtcc---aaaca--
I3KXG5_MCL1-01          g------ctgtctg------------tctgagtggtgtcc---aaaca--
A0A669C7T2_MCL1-03      a------ctatcttctt----c---ctcaaaatggagtcctggaggga--
A0A668RLC9_MCL1-01      a------ctatcttctt----c---ctcaaaatggagtcccggaggga--
A0A669C7T2_MCL1-01      a------ctatcttctt----c---ctcaaaatggagtcctggaggga--
A0A669C7T2_MCL1-02      a------ctatcttctt----c---ctcaaaatggagtcctggaggga--
A0A3Q4HLQ8_MCL1-01      a------ctatcttatt----c---ctcaaaatggagtcctagaggga--
A0A3P9BVM3_MCL1-01      a------atatcttatt----c---ctcaaaatggagtcttggaggga--
A0A3P8NP63_MCL1-02      a------atatcttatt----c---ctcaaaatggagtcttggaggga--
A0A3P8NP63_MCL1-01      a------atatcttatt----c---ctcaaaatggagtcttggaggga--
A0A3P8NP63_MCL1-03      a------atatcttatt----c---ctcaaaatggagtcttggaggga--
A0A3Q2VNL8_MCL1-01      a------atatcttatt----c---ctcaaaatggagtcttggaggga--
A0A3B4G4Z6_MCL1-01      a------atatcttatt----c---ctcaaaatggagtcttggaggga--
A0A8C9XY04_MCL1-01      g------ctgttttatt----catcctcaaaatggagtcgtggaggga--
A0A8P4G790_MCL1-01      g------c-gtatttct----ca--ctcaaaatggaggcgtcgacgga--
A0A8P4G790_MCL1-02      g------c-gtatttct----ca--ctcaaaatggaggcgtcgacgga--
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          -------cgacaacggc----ttttggccatgcactggattacaaa----
A2BF68_MCL1-01          -------cgacaacggc----ttttggccatgcactggattacaaa----
Q568W5_MCL1-01          -------cgacaacggc----ttttggccatgcactggattacaaa----
A0A671RQ00_MCL1-01      -------cgacaaaggc----ttttggccatgcattggaataacagctct
A0A673IXK8_MCL1-01      -------cgacaaaggc----ttttggccatgcattggaataacagctct
A0A672RP45_MCL1-02      ----------------------------cgtgc---ggaa--------cc
A0A672RP45_MCL1-01      -------cgacaaaggc----ttttggccatgcattggaataacagctct
A0A672RP45_MCL1-03      -------cgacaaaggc----ttttggccatgcattggaataacagctct
A0A8C1JUN1_MCL1-01      -------cgacaacggc----ctttggccatgcattggaatagcagctct
A0A8C1JUN1_MCL1-02      -------cgacaacggc----ctttggccatgcattggaatagcagctct
A0A671L9M9_MCL1-01      -------cgacagcggc----ttttggccatgcattggaatagcagctct
A0A672KMK1_MCL1-01      -------cgacagcggc----ttttggccatgcattggaatagcagctct
A0A673MXF5_MCL1-01      -------cgacagcggc----ttttggccatgcattggaatagcagctct
A0A3B3R4U0_MCL1-01      attaaaaatggcgtgaa----gcagaacggctt-----------------
A0A3B4C341_MCL1-01      -------ctag-gaaat----ggccatggaattttctttgggaa------
A0A3B4C341_MCL1-02      -------ctggcgaagc----gacc-----ttttactctgggtatatcct
A0A3B4C341_MCL1-03      -------ctggcgaagc----gacc-----ttttactctgggtatatcct
A0A3B1K5R1_MCL1-01      -------------aaga----cggc--cgacattgttccccgggtcgctg
A0A8B9JW80_MCL1-01      -------cggtttaaga----ccgt--cgacattgttccccgggtcgctg
A0A3B3SG34_MCL1-01      -------tggtgagcat----gaac--taccacagacccctgcacca---
A0A8C1YDY0_MCL1-01      caaggcgcgcacacgtc----gctt--gtacccgggcccgcgctcaaacc
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      ctcggcgcgcacacggc----gctc--gtgcccgcgcccgcactcaaacc
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      ctcggcgcgcacacggc----gctc--gtgcccgcggccgcactcaaagc
A0A672PT04_MCL1-02      ---------------------------------------aaatccgtgac
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      cacacgactaatctgag----ctca--gcgctcgctctcacagcttgcac
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      -------ctgtgtaacg----gggc--tcaacacggagtgaaggacagct
Q568V1_MCL1-01          -------cgcgcagggc----gttc--aaactccgacgctgaagacgtgc
Q1L8X3_MCL1-01          -------cgcgcagggc----gttc--aaactccgacgctaaagacgtgc
Q9I9N3_MCL1-01          -------cgcgcagggc----gttc--aaactccgacgctaaagacgtgc
A0A3B3CEX1_MCL1-01      -------ctgtggatgt----a--c--ggcac---tcttcg---gcggag
A0A3B3CEX1_MCL1-02      -------ctgtggatgt----a--c--ggcac---tcttcg---gcggag
A0A8C7X109_MCL1-01      -------ctgtggattt----a--c--gggacacatcctcg---gcagag
A0A3P9ILF6_MCL1-01      -------ctgtggattt----a--c--gggacacatcctcg---gcagag
A0A3P9ILF6_MCL1-02      -------ctgtggattt----a--c--gggacacatcctcg---gcagag
A0A3B3IJ04_MCL1-01      -------ctgtggattt----a--c--gggacacatcctcggcagcagag
A0A3B3IJ04_MCL1-02      -------ctgtggattt----a--c--gggacacatcctcggcagcagag
A0A3P9L1F3_MCL1-01      -------ctgtggattt----a--c--gggacacatcctcggcagcagag
A0A3P9L1F3_MCL1-02      -------ctgtggattt----a--c--gggacacatcctcggcagcagag
A0A3P8V8T6_MCL1-01      ------ctggatatggt----gctc--ataagcagtgtctgtttgacgct
A0A8C9WE28_MCL1-01      -------cggtgttaag----gcca--aagttttcgaccaaggcccgttc
A0A3B4CGU9_MCL1-03      tgtaacggagcggggag----gatc--ccgttcaacaaggg------ctc
A0A3B4CGU9_MCL1-01      tggag-gcagtatctgt----gctc--cggttctccatggaagttctttt
A0A3B4CGU9_MCL1-02      tggag-gcagtatctgt----gctc--cggttctccatggaagttctttt
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      -------cagcgtgatc----ggcc--tgctctgctcgcacttcgcggtt
A0A3B5PQ55_MCL1-01      atggagtcgggaatgga----caaa--cacactacgaccagggactcggt
A0A3B5PQ55_MCL1-02      atggagtcgggaatgga----caaa--cacactacgaccagggactcggt
A0A3P9Q4I8_MCL1-01      atggagtcgggaatgga----caaa--cacactacgaccaggggctcgtt
A0A3P9Q4I8_MCL1-02      atggagtcgggaatgga----caaa--cacactacgaccaggggctcgtt
A0A3B3VM25_MCL1-01      atggagtcggggatgga----caaa--cacactacgaccaggggctcgtt
A0A087X830_MCL1-01      atggagtcggggatgga----caaa--cacactacgaccaggggctcgtt
A0A3B3YCD0_MCL1-01      atggagtcggggatgga----caaa--cacactacgaccaggggctcgtt
A0A665TFT7_MCL1-01      -------ctccatgaac----ctgc--taatctgcgacccgaacgtactg
A0A672GRK8_MCL1-01      -------acaaaatgga----gtca--tgcactacggatcagaggatccc
A0A674PI93_MCL1-01      -------atgtggtgtt----c--c--aaaatggagtcgtggacggagcg
J7H260_MCL1-01          -------ccctccccgc----agtc--cgagctgg---------------
A0A3B1IEV7_MCL1-01      -------ctgtgtgacg----gaac--aagcccggttctctacagaaccg
A0A8C6SVR4_MCL1-02      -------tcgtggaggc----ggag--ggagctatgactatggacgctcg
A0A8C6SVR4_MCL1-01      -------tc-----------------------------------------
A0A8C6SVR4_MCL1-03      -------tcgtggaggc----ggag--ggagctatgactatggacgctcg
A0A3P8Y1W8_MCL1-01      --------------------------------------gaggatgccatc
A0A3P8Y1W8_MCL1-02      --------------------------------------gaggatgccatc
A0A3P8Y1W8_MCL1-03      --------------------------------------gaggatgccatc
A0A8C5CE84_MCL1-02      -------ctccgaaggt----tcac--acaccacgacagagggggccttg
A0A8C5CE84_MCL1-03      -------ctccgaaggt----tcac--acaccacgacagagggggccttg
A0A8C5CE84_MCL1-01      -------ctccgaaggt----tcac--acaccacgacagagggggccttg
A0A8C5CE84_MCL1-04      --------------------------------------gaggatgccatc
W5MMB7_MCL1-01          -------ttgc------------cc--caacgccaccaccattcaccccg
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      -------ctgtggcggg----g--c--agggatgggcgccggcggcggcg
A0A5F8GAQ2_MCL1-01      -------ctgtggcggg----g--c--agggatgggcgccggcggcggcg
A0A5F8GAQ2_MCL1-02      -------ctgtggcggg----g--c--agggatgggcgccggcggcggcg
A0A7N4PRP1_MCL1-01      -------ttgcgggggg----g--c--cggcttgggcgccggcagcggcg
A0A7N4PRP1_MCL1-02      -------ttgcgggggg----g--c--cggcttgggcgccggcagcggcg
A0A7N4PRP1_MCL1-03      -------ttgcgggggg----g--c--cggcttgggcgccggcagcggcg
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          -------ctgcgggggg----g--c--ag--ttgggggcctgtggcggca
G1PZ39_MCL1-01          -------ccattagcgg---------------------------------
A0A8I5ZM43_MCL1-01      -------ctg----------------------------------------
A0A8I5Y8B7_MCL1-01      -------ctg----------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      -------ctgcggcggc----g--c--cagcctgggcgcgggcggcggc-
A0A8C2MG79_MCL1-02      -------ctgcggcggc---------------------------------
A0A8C6GJU8_MCL1-01      -------ctgcggcggc----g--c--cagcctcggcgcgggcggcggt-
A0A8C6GJU8_MCL1-02      -------ctgcggcggc----g--c--cagcctcggcgcgggcggcggt-
A0A8C6GJU8_MCL1-03      -------ctgcggcggc----g--c--cagcctcggcgcgggcggcggt-
A0A2K6F6N9_MCL1-01      -------ctgcgggcgg----g--c--agatctagg--------------
A0A2K5DMS4_MCL1-01      -------ctgcggtg-----------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          -------cttggggggg----c--c--cgggttgggagccggtggcggcg
G1T2Q0_MCL1-02          -------cttggggggg----c--c--cgggttgggagccggtggcggcg
G3T756_MCL1-01          -------ctgtgggggg----g--c--cggcttgggggccggcggctgcg
A0A8C6QA84_MCL1-01      -------ctgcgggggc----g--c--cagcctcgcggcaggcggcagt-
A0A8C5VC33_MCL1-01      -------ttgtgggaaa---------------------------------
A0A8D2KCB0_MCL1-01      -------ctgcgggggc----g--c--cgggctgggggccagcggcagcg
A0A8C9QEN4_MCL1-01      -------ctgcggg------------------------------------
A0A287DCH9_MCL1-01      -------ctgcgggggc----g--c--cgggctgggggccagcggcggcg
A0A287DCH9_MCL1-02      -------ctgcggg------------------------------------
A0A2K5C7L5_MCL1-01      -------ctgtgagtgg----g--c--cggcttggggactggcagtggcg
H0XFB7_MCL1-01          -------ctgtgggggc----g--c--cgggctgggggctggcagcggcg
A0A8C9AD42_MCL1-01      --------------------------------------ccggaagctgcc
A0A8B7GKA0_MCL1-01      -------ctgtggaggg----g--c--cggattgggggccggcagcagcg
A0A8B7GKA0_MCL1-02      -------ctgtggaggg----g--c--cggattgggggccggcagcagcg
A0A8B7GKA0_MCL1-03      -------ctgtggaggg----g--c--cggattgggggccggcagcagcg
A0A8C9AD42_MCL1-02      -------ctgtgggggg----g--c--cggactgggagccggcagcggcg
A0A8C9AD42_MCL1-03      -------ctgtgggggg----g--c--cggactgggagccggcagcggcg
A0A2K6GI15_MCL1-01      -------ctgtgggggg----g--c--cggattgggggccggcagcagcg
A0A2K6GI15_MCL1-02      -------ctgtgggggg----g--c--cggattgggggccggcagcagcg
A0A2K6GI15_MCL1-03      -------ctgtgggggg----g--c--cggattgggggccggcagcagcg
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      -------ctgtgggggt----g--c--tgggctgggggccggtagcggcg
G2HFR3_MCL1-01          -----------------------------atttgccggctctcagcagca
C8YZ26_MCL1-01          -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I3RTV4_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A087WT64_MCL1-09      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I2YJ87_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I3RTV4_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2R9BPJ5_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2R9BPJ5_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I3RTV4_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I2YJ87_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
B4DU51_MCL1-01          -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
B4DLY8_MCL1-01          -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A087WT64_MCL1-06      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A087WT64_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      -------ctgtgggggg----g--c--cggcttgggtgctggcagcggcg
A0A8I5TL14_MCL1-02      -------ctgtgggggg----g--c--cggcttgggtgctggcagcggcg
A0A8I5TL14_MCL1-03      -------ctgtgggggg----g--c--cggcttgggtgctggcagcggcg
A0A2K5I9I0_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5I9I0_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5I9I0_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A8C9I795_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A8C9I795_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6KRW9_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6PPI3_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6KRW9_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6PPI3_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6KRW9_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6PPI3_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A096MRS6_MCL1-04      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A096MRS6_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I3GB35_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I3GB35_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2I3GB35_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggc-
A0A2K5LXU8_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5XSB2_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5W0Y7_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6ECQ5_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5LXU8_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5LXU8_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A0D9RZP5_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
I7G687_MCL1-01          -------ctgtgggggg----g--c--cggcttgggggccggcagcagcg
A0A2K5W0Y7_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5W0Y7_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6ECQ5_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
F7HUE9_MCL1-01          -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6ECQ5_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A8D2F160_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A8D2F160_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5XSB2_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5XSB2_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A096MRS6_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A096MRS6_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
F7GTF7_MCL1-01          -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6V5X4_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6V5X4_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K6V5X4_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
F7GTF7_MCL1-02          -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5CFB8_MCL1-03      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5CFB8_MCL1-01      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A2K5CFB8_MCL1-02      -------ctgtgggggg----g--c--cggcttgggggccggcagcggcg
A0A8C0CVU0_MCL1-01      -------ctg-ggggga----a--c--cggattggg--------------
W5QI41_MCL1-01          -------------ggga----g--c--cgga---------------aac-
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      -------ctgtggggga----g--c--cggactaggacagggcagcggc-
A0A8C6E5E6_MCL1-02      -------ctgtggggga----g--c--cggactaggacagggcagcggc-
A0A452GA25_MCL1-01      -------ctgtggggga----g--c--cgggttaggacagggcagcggc-
A0A452GA25_MCL1-02      -------ctgtggggga----g--c--cgggttaggacagggcagcggc-
A5PJR2_MCL1-01          -------ttgtggggga----g--c--cggattaggacagggcagcggc-
A0A8B9W7D1_MCL1-03      -------ttgtggggga----g--c--cggattaggacagggcagcggc-
A0A8B9W7D1_MCL1-04      -------ttgtggggga----g--c--cggattaggacagggcagcggc-
A0A8B9W7D1_MCL1-01      -------ttgtggggga----g--c--cggattaggacagggcagcggc-
A0A8B9W7D1_MCL1-02      -------ttgtggggga----g--c--cggattaggacagggcagcggc-
A0A671G0G2_MCL1-01      -------ctgtgggggg----t--c--cgggttaggggccggcagcggcg
A0A671G0G2_MCL1-02      -------ctgtgggggg----t--c--cgggttaggggccggcagcggcg
A0A671G0G2_MCL1-03      -------ctgtgggggg----t--c--cgggttaggggccggcagcggcg
A0A8D2AJ70_MCL1-01      -------ctgtgggggc----g--c--tgggctaggggccggtagcggcg
A0A8D2AJ70_MCL1-02      -------ctgtgggggc----g--c--tgggctaggggccggtagcggcg
A0A673TBH1_MCL1-04      -------ctgtgggggg----g--c--cgggttgggggccgggagtggcg
A0A673TBH1_MCL1-05      -------ctgtgggggg----g--c--cgggttgggggccgggagtggcg
A0A673TBH1_MCL1-03      -------ctgtgggggg----g--c--cgggttgggggccgggagtggcg
A0A673TBH1_MCL1-01      -------ctgtgggggg----g--c--cgggttgggggccgggagtggcg
A0A673TBH1_MCL1-02      -------ctgtgggggg----g--c--cgggttgggggccgggagtggcg
A0A8C4L244_MCL1-01      -------ctgtgggggg----g--c--cgggttggcggccggcggcggcg
A0A5F5Q151_MCL1-01      -------ctgtgggggg----g--c--cgggttgggggccggcggcggcg
A0A5F5Q151_MCL1-02      -------ctgtgggggg----g--c--cgggttgggggccggcggcggcg
A0A8C0DF47_MCL1-02      -------ctgtgggggg----g--c--cggattggggccggatagcggca
A0A8C0DF47_MCL1-01      -------ctgtgggggg----g--c--cggattggggccggatagcggca
A0A8C0DF47_MCL1-03      -------ctgtgggggg----g--c--cggattggggccggatagcggca
A0A4V5P8C2_MCL1-01      -------ctgtgggggg----g--c--cggattgggaccggatagcggca
A0A4V5P8C2_MCL1-02      -------ctgtgggggg----g--c--cggattgggaccggatagcggca
A0A8C9BA52_MCL1-01      -------ctgtgggggg----g--c--cggattgggaccggatagcggca
A0A8C9BA52_MCL1-02      -------ctgtgggggg----g--c--cggattgggaccggatagcggca
A0A337S3J9_MCL1-02      -------ctgtgggggg----g--c--cgggttggcggccgggagcggcg
A0A8C9K7H4_MCL1-01      -------ctgtgggggg----g--c--cgggctggcggccgggagcggcg
A0A8C8Y0M9_MCL1-01      -------ctgtgggggg----g--c--cgggctggcggccgggagcggcg
A0A8C8Y0M9_MCL1-02      -------ctgtgggggg----g--c--cgggctggcggccgggagcggcg
A0A667GXX5_MCL1-01      -------ctgtgggggg----g--c--cgggttggcggccgggagcggcg
A0A667GXX5_MCL1-02      -------ctgtgggggg----g--c--cgggttggcggccgggagcggcg
A0A337S3J9_MCL1-01      -------ctgtgggggg----g--c--cgggttggcggccgggagcggcg
Q7YRZ9_MCL1-01          -------ctgtgggggg----g--c--cgggttggcggccgggagcggcg
A0A337S3J9_MCL1-03      -------ctgtgggggg----g--c--cgggttggcggccgggagcggcg
A0A337S3J9_MCL1-04      -------ctgtgggggg----g--c--cgggttggcggccgggagcggcg
Q8HYS5_MCL1-01          -------ctgtgggggg----g--c--cgggctgggggccggcagcggcg
A0A8C0MCZ5_MCL1-02      -------ctgtgggggg----g--c--cgggctgggggccggcagcggcg
A0A8C0L4C8_MCL1-01      -------ctgtgggggg----g--c--cgggctgggggccggcagcggcg
A0A8C0MCZ5_MCL1-01      -------ctgtgggggg----g--c--cgggctgggggccggcagcggcg
A0A8I3P430_MCL1-01      -------ctgtgggggg----g--c--cgggctgggggccggcagcggcg
A0A8I3P430_MCL1-02      -------ctgtgggggg----g--c--cgggctgggggccggcagcggcg
A0A8C3W949_MCL1-01      -------ctgtgggggg----g--c--cggactggggccgggtagcggca
A0A8C3W949_MCL1-02      -------ctgtgggggg----g--c--cggactggggccgggtagcggca
A0A8C3W949_MCL1-03      -------ctgtgggggg----g--c--cggactggggccgggtagcggca
Q95KR3_MCL1-01          -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1FTD4_MCL1-03      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1G1G8_MCL1-04      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A4X1SEZ6_MCL1-01      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A4X1SFB1_MCL1-01      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1FTD4_MCL1-01      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1G1G8_MCL1-02      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1RYD1_MCL1-01      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A4X1SEU3_MCL1-02      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A4X1SEZ6_MCL1-03      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A4X1SFB1_MCL1-02      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1FTD4_MCL1-05      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1G1G8_MCL1-01      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1RYD1_MCL1-03      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A4X1SEU3_MCL1-01      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1G1G8_MCL1-03      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1FTD4_MCL1-02      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1RYD1_MCL1-02      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A4X1SEZ6_MCL1-02      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
A0A8D1FTD4_MCL1-04      -------ctgtgggggg----g--c--cggattggggcctggaagcggca
M3XZZ5_MCL1-01          -------ctgtgggggg----g--c--cgggctgggggccggcaccgggg
A0A8C7BMW8_MCL1-01      -------ctgtgggggg----g--c--cgggctgggggccggcagcgggg
A0A8C7BMW8_MCL1-02      -------ctgtgggggg----g--c--cgggctgggggccggcagcgggg
A0A452RHX5_MCL1-01      -------ctgtgggggg----g--c--cgggttgggggccggcagcggcg
G1L3L7_MCL1-01          -------ctgtgggggg----g--c--cgggttgggggccggcagcggcg
G1L3L7_MCL1-02          -------ctgtgggggg----g--c--cgggttgggggccggcagcggcg
A0A803T0A4_MCL1-01      -------ttgcgggggc----gccc--cgagcatggccccgaacacgccg
A0A803T0A4_MCL1-02      -------ttgcgggggc----gccc--cgagcatggccccgaacacgccg
A0A803T0A4_MCL1-03      -------ttgcgggggc----gccc--cgagcatggccccgaacacgccg
A0A670K3Y6_MCL1-01      -------ttgtgggggc----gcac--cgagcatggcgcccgccacgccg
A0A8D0E7Q9_MCL1-01      -------ctgtgggagc----gcct--cgggcctggccccggcggcccct
A0A8D0E7Q9_MCL1-02      -------ctgtgggagc----gcct--cgggcctggccccggcggcccct
A0A8C5PJK5_MCL1-01      gagaaggctatggatgg----attc--ccggccctgtgcttccccctgat
A0A670Z5Q4_MCL1-01      -------tca----ggc----tgca--gcagaaaggaaactgc----act
A0A8C5WWU9_MCL1-01      -------ttgcggcggc----tccc--ccggattggcaccagccgcccct
A0A8C6VLE3_MCL1-01      -------ttgcggcggc----t-cc--ccggattggcaccggccgcccct
A0A8C6VLE3_MCL1-02      -------ttgcggcggc----t-cc--ccggattggcaccggccgcccct
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      -------ccgc----gc----gcgc--cgccgccgccgccggggggagcg
A0A8D2IVC0_MCL1-02      -------ctgcggaagc----gccc--cggcgtcgccgccggtgggggcg
A0A8D2IVC0_MCL1-03      -------ctgcggaagc----gccc--cggcgtcgccgccggtgggggcg
A0A6I8NSR7_MCL1-01      -------ctgcgggggc----g-----ccggcagcggcgcgggggcctcc
A0A6I8NSR7_MCL1-02      -------ctgcgggggc----g-----ccggcagcggcgcgggggcctcc
A0A8C9NTQ6_MCL1-01      -------ccgtggcgcc----caac--gtgcggcacccttagtaggagcc
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      -------gggcagtgga----tgta--tcggggcgggggcagagtgagac
A0A8B9BNC2_MCL1-01      -------gcgcgggggg----a------ggaagcgaccgtgacgacagag
A0A8B9EU67_MCL1-01      -------ccg----------------------------------------
A0A493U0E8_MCL1-01      -------agggaccggc----g------agatctgacc------atttgg
A0A8B9VGG9_MCL1-01      -------agggaccggc----g------agatctgacc------atttgg
A0A8B9SWV2_MCL1-01      -------ctgcggcggc----g------gcaccgggccc---------gg
A0A8C3GNC2_MCL1-01      -------ctgcggcggc----g------gcaccgggcccgggggaggagg
A0A8C4K2K9_MCL1-01      -------ctgtggggag----gcct--ctggggggggtgtgtgggcct--
A0A8B9P3N9_MCL1-01      -------ttggggcggg----c-----gcgattttgcgccagccacgtgc
A0A8C3UEV5_MCL1-01      -------agctggctga----gccg--ggggaggggacacacgtggccgc
A0A674HQK4_MCL1-01      --------------gtc----ttct--cgg---tgggcccgggcggcccg
A0A674HQK4_MCL1-02      -------ctgcggcggc----tccc--cggggctgagccccgcggggccg
A0A8C0UE15_MCL1-01      ----------------------------------aggctcctgcagcttc
A0A8C3QRB8_MCL1-01      -------ctgcggcggc----gccc--cggcgctgagccccggcgggccc
A0A8D2NMF1_MCL1-01      ------------------------------------gtccatggattttt
A0A8D2NMF1_MCL1-02      --------------------------------ttgggctcctgcagcttt
G1MPY7_MCL1-01          -------ctgtggcagg----g----------------------------
A0A8C2TT61_MCL1-01      -------ttgcggcgga----g-----gaggcccgggcctggtgcccgct
A0A8C2TT61_MCL1-02      -------ttgcggcgga----g-----gaggcccgggcctggtgcccgct
A0A8C9EP12_MCL1-01      -------ctgcggcgga----g-----gaggcccgggcctggtgcccgct
A0A669R428_MCL1-01      -------ctgcggcggt----g-----gaggccc----------------
A0A8B9GMI8_MCL1-01      -------ctgcgggggc----a----------------------------
A0A672UZL1_MCL1-01      -------ctgcggcggc----agcc--ccgcgctggcccccgctcccgcc
A0A8C4U2H6_MCL1-01      -------ct---gcggt----g-----gcggcctggccctggcgcctgcc
A0A663EQJ0_MCL1-01      -------ctgcggcggc----g-----gcggcccggccctggcgcccgcc
A0A663EQJ0_MCL1-02      -------ctgcggcggc----g-----gcggcccggccctggcgcccgcc
A0A8B9M984_MCL1-01      -------ct---gcggc----g-----gcggcccggccctggcgcccgcc
A0A8B9M984_MCL1-02      -------ct---gcggc----g-----gcggcccggccctggcgcccgcc
A0A8C0ASR2_MCL1-01      --------------ggg----a-----acggactggaag-----------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      ------------gtgcc----g-----ggggacagcggc-----------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      -------ctgcgggggc----ggcc--cggccttggctccggcttcgccc
A0A8C8RUG9_MCL1-01      -------ctgcggaggg----ggcc--cggcgctggcgccctcctcgccg
A0A8C3EZ48_MCL1-01      ------------agttc----accc--agaccctgccccactccactgct
A0A674JQC4_MCL1-01      -----------------------ga--agacgct----------------
A0A8C3TAL3_MCL1-01      -------ctgtgggggc----ggcc--catcgctggcgcc----------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      -------ctgcgggggc----ggcc--cggcgctggcgccccccccgccg
A0A8C0GRW6_MCL1-01      -------ctgcgggggc----ggcc----acgctgccccc-tccgcgccg
A0A8C4YAJ9_MCL1-01      -------ctgcgggggc----ggcc--cgacgctgcccccctccgcgccg
A0A8C3H9M3_MCL1-01      -------ctgcgggggc----ggcc--cgacgctgcccccgtccccgccg
A0A674IPL6_MCL1-01      -------ctgcgggggc----ggcc--cgacgctgcccccctccccgccg
                                                                          

B6V6J0_MCL1-01          ggggcttctc----------------------------------------
A0A8C4RFB4_MCL1-01      tttaagca------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      aacgaact------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      ctccagtg------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      tttgtatt------------------------------------------
A0A3P8Y1W8_MCL1-05      tttgtatt------------------------------------------
A0A6F9BEN5_MCL1-02      ttcgtacc------------------------------------------
Q0KFR9_MCL1-01          ttcgtacc------------------------------------------
A0A673VWA7_MCL1-01      ttcgtacc------------------------------------------
A0A4W5QGT1_MCL1-01      ttcgtacc------------------------------------------
A0A8C8LPV9_MCL1-01      ttcgtacc------------------------------------------
A0A8C7LPD4_MCL1-01      ttcgtacc------------------------------------------
A0A8C7H1W6_MCL1-01      ttcgtacc------------------------------------------
A0A8C7H1W6_MCL1-02      ttcgtacc------------------------------------------
A0A4W5LP06_MCL1-01      ttcgtact------------------------------------------
A0A4W5LP06_MCL1-02      ttcgtact------------------------------------------
A0A674ELG3_MCL1-03      ttcgtacc------------------------------------------
A0A674ELG3_MCL1-01      ttcgtacc------------------------------------------
A0A674ELG3_MCL1-02      ttcgtacc------------------------------------------
A0A8C7PM33_MCL1-03      ttcgtacc------------------------------------------
A0A8C7PM33_MCL1-01      ttcgtacc------------------------------------------
A0A8C7PM33_MCL1-02      ttcgtacc------------------------------------------
A0A8C8CMB3_MCL1-01      ttcgtacc------------------------------------------
A0A8C8CMB3_MCL1-02      ttcgtacc------------------------------------------
A0A8C7H400_MCL1-01      ttcgtacc------------------------------------------
A0A8C7H400_MCL1-02      ttcgtacc------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      taacgtca------------------------------------------
A0A673IXK8_MCL1-01      taacgtca------------------------------------------
A0A672RP45_MCL1-02      tgat----------------------------------------------
A0A672RP45_MCL1-01      taatgtca------------------------------------------
A0A672RP45_MCL1-03      taatgtca------------------------------------------
A0A8C1JUN1_MCL1-01      taacgtca------------------------------------------
A0A8C1JUN1_MCL1-02      taacgtca------------------------------------------
A0A671L9M9_MCL1-01      taacgtca------------------------------------------
A0A672KMK1_MCL1-01      taacgtca------------------------------------------
A0A673MXF5_MCL1-01      taacgtca------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      ---aaact------------------------------------------
A0A3B4C341_MCL1-02      ctcaaacc------------------------------------------
A0A3B4C341_MCL1-03      ctcaaacc------------------------------------------
A0A3B1K5R1_MCL1-01      ttcg----------------------------------------------
A0A8B9JW80_MCL1-01      ttcg----------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      gcgcacgg------------------------------------------
A0A673GSK0_MCL1-03      -cgactcg------------------------------------------
A0A673GSK0_MCL1-01      gcggagcg------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      gcggagcg------------------------------------------
A0A672PT04_MCL1-02      gcagcacg------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      gcagcacg------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      tcgtcctc------------------------------------------
Q568V1_MCL1-01          gtcg----------------------------------------------
Q1L8X3_MCL1-01          gtcg----------------------------------------------
Q9I9N3_MCL1-01          gtcg----------------------------------------------
A0A3B3CEX1_MCL1-01      cgggagag------------------------------------------
A0A3B3CEX1_MCL1-02      cgggagag------------------------------------------
A0A8C7X109_MCL1-01      cgggagag------------------------------------------
A0A3P9ILF6_MCL1-01      cgggagag------------------------------------------
A0A3P9ILF6_MCL1-02      cgggagag------------------------------------------
A0A3B3IJ04_MCL1-01      cgggagag------------------------------------------
A0A3B3IJ04_MCL1-02      cgggagag------------------------------------------
A0A3P9L1F3_MCL1-01      cgggagag------------------------------------------
A0A3P9L1F3_MCL1-02      cgggagag------------------------------------------
A0A3P8V8T6_MCL1-01      gtgcacac------------------------------------------
A0A8C9WE28_MCL1-01      ccagccgc------------------------------------------
A0A3B4CGU9_MCL1-03      ggagagcc------------------------------------------
A0A3B4CGU9_MCL1-01      ggaggtcc------------------------------------------
A0A3B4CGU9_MCL1-02      ggaggtcc------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      ccatgcgc------------------------------------------
A0A3B5PQ55_MCL1-01      gtgcctga------------------------------------------
A0A3B5PQ55_MCL1-02      gtgcctga------------------------------------------
A0A3P9Q4I8_MCL1-01      gtgcctga------------------------------------------
A0A3P9Q4I8_MCL1-02      gtgcctga------------------------------------------
A0A3B3VM25_MCL1-01      gtgcctga------------------------------------------
A0A087X830_MCL1-01      gtgcctga------------------------------------------
A0A3B3YCD0_MCL1-01      gtgcctga------------------------------------------
A0A665TFT7_MCL1-01      ccgaagat------------------------------------------
A0A672GRK8_MCL1-01      acccatca------------------------------------------
A0A674PI93_MCL1-01      gggcattc------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      caacggca------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      caacggca------------------------------------------
A0A3P8Y1W8_MCL1-01      c-------------------------------------------------
A0A3P8Y1W8_MCL1-02      c-------------------------------------------------
A0A3P8Y1W8_MCL1-03      c-------------------------------------------------
A0A8C5CE84_MCL1-02      cctctaat------------------------------------------
A0A8C5CE84_MCL1-03      cctctaat------------------------------------------
A0A8C5CE84_MCL1-01      cctctaat------------------------------------------
A0A8C5CE84_MCL1-04      c-------------------------------------------------
W5MMB7_MCL1-01          gcctcgcc------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      ccagcggt----cccccgtccggcgggcgcctgctagcttctggcaaagg
A0A5F8GAQ2_MCL1-01      ccagcggt----cccccgtccggcgggcgcctgctagcttctggcaaagg
A0A5F8GAQ2_MCL1-02      ccagcggt----cccccgtccggcgggcgcctgctagcttctggcaaagg
A0A7N4PRP1_MCL1-01      ccagcgct----tccccgtccggcgggcgcctgctgactaatggcaaagg
A0A7N4PRP1_MCL1-02      ccagcgct----tccccgtccggcgggcgcctgctgactaatggcaaagg
A0A7N4PRP1_MCL1-03      ccagcgct----tccccgtccggcgggcgcctgctgactaatggcaaagg
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          gcgaagcctacatctccttcaggaaggaggtccctgcccccaagagtcag
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      ------------tctccggccggggcgcgcctcacggccg------agga
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      ------------tctccggcaggggcgcgcctggtggccg------agga
A0A8C6GJU8_MCL1-02      ------------tctccggcaggggcgcgcctggtggccg------agga
A0A8C6GJU8_MCL1-03      ------------tctccggcaggggcgcgcctggtggccg------agga
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      ------cc----atccctccaggaccgcggctttt---------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          gcg---tc----gcccctccggcagagcggcttttggctgcggagaagga
G1T2Q0_MCL1-02          gcg---tc----gcccctccggcagagcggctttt---------------
G3T756_MCL1-01          ------cc----acccctccgggagggcgacttccagctcctggaaagga
A0A8C6QA84_MCL1-01      ------------tctccggcgggagcgcgcctggtggccg------agga
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      ------cc----accccgccgggagcgcagctcttggccgccgagaagga
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      ------cc----accccgccgggagcgcagctcttagccgccgagaagga
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gca---cc----acccctccgggagggcggcttttggccacggagaagga
H0XFB7_MCL1-01          gcg---cc----acacccccgggagggcggcttttggctgcggagaagga
A0A8C9AD42_MCL1-01      gcc---ct----tttccc------------ctttt---------------
A0A8B7GKA0_MCL1-01      gcg---cc----acccccccgggagggcggcttttggctgccgagaagga
A0A8B7GKA0_MCL1-02      gcg---cc----acccccccgggagggcggcttttggctgccgagaagga
A0A8B7GKA0_MCL1-03      gcg---cc----acccccccgggagggcggctttt---------------
A0A8C9AD42_MCL1-02      gcg---cc----acccccccgggagggcggcttttggctgccgagaagga
A0A8C9AD42_MCL1-03      gcg---cc----acccccccgggagggcggctttt---------------
A0A2K6GI15_MCL1-01      gcg---cc----acccccccgggagggcggcttttggctgccgagaagga
A0A2K6GI15_MCL1-02      gcg---cc----acccccccgggagggcggcttttggctgccgagaagga
A0A2K6GI15_MCL1-03      gcg---cc----acccccccgggagggcggctttt---------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      gcgccacc----acccctccgcgagggcggcttctggccgcgga---gga
G2HFR3_MCL1-01          atg---c-------------------gtgaatttta--------------
C8YZ26_MCL1-01          gcg---cc----acccgcccgggagggcgactttt---------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      gcg---cc----acccctccgggagggcgacttttggctacggagaagga
A0A2I3RTV4_MCL1-02      gcg---cc----acccctccgggagggcgacttttggctacggagaagga
A0A087WT64_MCL1-09      gcg---cc----acccgcccgggagggcgacttttggctacggagaagga
A0A2I2YJ87_MCL1-02      gcg---cc----acccctccgggagggcgacttttagctacggagaagga
A0A2I3RTV4_MCL1-01      gcg---cc----acccctccgggagggcgacttttggctacggagaagga
A0A2R9BPJ5_MCL1-01      gcg---cc----acccctccgggagggcgacttttggctacggagaagga
A0A2R9BPJ5_MCL1-03      gcg---cc----acccctccgggagggcgactttt---------------
A0A2I3RTV4_MCL1-03      gcg---cc----acccctccgggagggcgactttt---------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      gcg---cc----acccctccgggagggcgactttt---------------
A0A2I2YJ87_MCL1-01      gcg---cc----acccctccgggagggcgacttttagctacggagaagga
B4DU51_MCL1-01          gcg---cc----acccgcccgggagggcgacttttggctacggagatgga
B4DLY8_MCL1-01          gcg---cc----acccgcccgggagggcgacttttggctacggagaagga
A0A087WT64_MCL1-06      gcg---cc----acccgcccgggagggcgactttt---------------
A0A087WT64_MCL1-03      gcg---cc----acccgcccgggagggcgacttttggctacggagaagga
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      gcg---cc----acccgcccgggagggcgacttttggctacggagaagga
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A8I5TL14_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A8I5TL14_MCL1-03      gcg---cc----acccctccgggagggcggctttt---------------
A0A2K5I9I0_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5I9I0_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5I9I0_MCL1-03      gcg---cc----acccctccgggagggcggctttt---------------
A0A8C9I795_MCL1-01      gcg---ca----acccctccgggagggcggcttttggctacggagaagga
A0A8C9I795_MCL1-02      gcg---ca----acccctccgggagggcggctttt---------------
A0A2K6KRW9_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K6PPI3_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K6KRW9_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K6PPI3_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K6KRW9_MCL1-03      gcg---cc----acccctccgggagggcggctttt---------------
A0A2K6PPI3_MCL1-03      gcg---cc----acccctccgggagggcggctttt---------------
A0A096MRS6_MCL1-04      gcg---cc----acccctccgggagggcggcttttagctacggagaagga
A0A096MRS6_MCL1-01      gcg---cc----acccctccgggagggcggcttttagctacggagaagga
A0A2I3GB35_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2I3GB35_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5XSB2_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5W0Y7_MCL1-03      gcg---cc----aca---ccgggagggcggcttttggctacggagaagga
A0A2K6ECQ5_MCL1-02      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5LXU8_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5LXU8_MCL1-03      gcg---cc----acccctccgggagggcggctttt---------------
A0A0D9RZP5_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
I7G687_MCL1-01          gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5W0Y7_MCL1-01      gcg---cc----aca---ccgggagggcggcttttggctacggagaagga
A0A2K5W0Y7_MCL1-02      gcg---cc----aca---ccgggagggcggctttt---------------
A0A2K6ECQ5_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
F7HUE9_MCL1-01          gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K6ECQ5_MCL1-03      gcg---cc----acccctccgggagggcggctttt---------------
A0A8D2F160_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A8D2F160_MCL1-02      gcg---cc----acccctccgggagggcggctttt---------------
A0A2K5XSB2_MCL1-01      gcg---cc----acccctccgggagggcggcttttggctacggagaagga
A0A2K5XSB2_MCL1-03      gcg---cc----acccctccgggagggcggctttt---------------
A0A096MRS6_MCL1-02      gcg---cc----acccctccgggagggcggcttttagctacggagaagga
A0A096MRS6_MCL1-03      gcg---cc----acccctccgggagggcggctttta--------------
F7GTF7_MCL1-01          gcg---cc----acccctccgggagggcggcttttggccacagagaagga
A0A2K6V5X4_MCL1-02      gcg---cc----acccccccgggagggcggcttctggccgcggagaagga
A0A2K6V5X4_MCL1-01      gcg---cc----acccccccgggagggcggcttctggccgcggagaagga
A0A2K6V5X4_MCL1-03      gcg---cc----acccccccgggagggcggcttct---------------
F7GTF7_MCL1-02          gcg---cc----acccctccgggagggcggctttt---------------
A0A2K5CFB8_MCL1-03      gcg---cc----acccctccgggagggcggcttttggccacggagaagga
A0A2K5CFB8_MCL1-01      gcg---cc----acccctccgggagggcggcttttggccacggagaagga
A0A2K5CFB8_MCL1-02      gcg---cc----acccctccgggagggcggctttt---------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          -----ccc----gccctgccccaggccccgcccctgcct-----------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      -----gcc----tcctctccgggggggcggcttttggttgcggggaagga
A0A8C6E5E6_MCL1-02      -----gcc----tcctctccgggggggcggctttt---------------
A0A452GA25_MCL1-01      -----gct----tcctctccgggggggcggcttttggctgcggggaagga
A0A452GA25_MCL1-02      -----gct----tcctctccgggggggcggcttttggctgcggggaagga
A5PJR2_MCL1-01          -----gcc----tcctctccgggggggcggcttttggctgcggggaagga
A0A8B9W7D1_MCL1-03      -----gcc----tcctctccgggggggcggcttttggctgcggggaagga
A0A8B9W7D1_MCL1-04      -----gcc----tcctctccgggggggcggctttt---------------
A0A8B9W7D1_MCL1-01      -----gcc----tcctctccgggggggcggcttttggctgcggggaagga
A0A8B9W7D1_MCL1-02      -----gcc----tcctctccgggggggcggcttttggctgcggggaagga
A0A671G0G2_MCL1-01      gcagcgcc----tccccttcgggagagcggcttctggccgcggggaagga
A0A671G0G2_MCL1-02      gcagcgcc----tccccttcgggagagcggcttctggccgcggggaagga
A0A671G0G2_MCL1-03      gcagcgcc----tccccttcgggagagcggcttct---------------
A0A8D2AJ70_MCL1-01      gc---gcc----actccgcctggagggcggctcttggccgcggagaagga
A0A8D2AJ70_MCL1-02      gc---gcc----actccgcctggagggcggctctt---------------
A0A673TBH1_MCL1-04      gc---gcc----tcctcttcgggaggggggcttttagccgtagggaagga
A0A673TBH1_MCL1-05      gc---gcc----tcctcttcgggaggggggctttta--------------
A0A673TBH1_MCL1-03      gc---gcc----tcctcttcgggaggggggcttttagccgtagggaagga
A0A673TBH1_MCL1-01      gc---gcc----tcctcttcgggaggggggcttttagccgtagggaagga
A0A673TBH1_MCL1-02      gc---gcc----tcctcttcgggaggggggcttttagccgtagggaagga
A0A8C4L244_MCL1-01      gc---gcc----tcgtcgccgggagggcggcttttggctgcggggaagga
A0A5F5Q151_MCL1-01      gc---gcc----tcgtcgccgggagggcggcttttggctgcggggaagga
A0A5F5Q151_MCL1-02      gc---gcc----tcgtcgccgggagggcggctttt---------------
A0A8C0DF47_MCL1-02      gcggcgcc----tccgctccaggaaggcggcttttggctgcgggaaagga
A0A8C0DF47_MCL1-01      gcggcgcc----tccgctccaggaaggcggcttttggctgcgggaaagga
A0A8C0DF47_MCL1-03      gcggcgcc----tccgctccaggaaggcggctttt---------------
A0A4V5P8C2_MCL1-01      gcggcgcc----tccgctccgggaaggcggcttttggctgcaggaaagga
A0A4V5P8C2_MCL1-02      gcggcgcc----tccgctccgggaaggcggctttt---------------
A0A8C9BA52_MCL1-01      gcggcgcc----tccgctccgggaaggcgacttttggctgcaggaaagga
A0A8C9BA52_MCL1-02      gcggcgcc----tccgctccgggaaggcgactttt---------------
A0A337S3J9_MCL1-02      gc---gcc----tcctcttcgggagggcggcttgtggctgtggggaagga
A0A8C9K7H4_MCL1-01      gc---gcc----tcc-----------------------------------
A0A8C8Y0M9_MCL1-01      gc---gcc----tcctcttcgggagggcggcttgtggctgtggggaagga
A0A8C8Y0M9_MCL1-02      gc---gcc----tcctcttcgggagggcggcttgt---------------
A0A667GXX5_MCL1-01      gc---gcc----tcctcttcgggagggcggcttgtggctgtggggaagga
A0A667GXX5_MCL1-02      gc---gcc----tcctcttcgggagggcggcttgt---------------
A0A337S3J9_MCL1-01      gc---gcc----tcctcttcgggagggcggcttgtggctgtggggaagga
Q7YRZ9_MCL1-01          gc---gcc----tcctcttcgggagggcggcttgtggctgtggggaagga
A0A337S3J9_MCL1-03      gc---gcc----tcctcttcgggagggcggcttgtggctgtggggaagga
A0A337S3J9_MCL1-04      gc---gcc----tcctcttcgggagggcggcttgt---------------
Q8HYS5_MCL1-01          gc---gcc----tcctcttcgggagggcggcttttggcttcggggaggga
A0A8C0MCZ5_MCL1-02      gc---gcc----tcctcttcgggagggcggcttttggcttcggggaagga
A0A8C0L4C8_MCL1-01      gc---gcc----tcctcttcgggagggcggcttttggcttcggggaagga
A0A8C0MCZ5_MCL1-01      gc---gcc----tcctcttcgggagggcggcttttggcttcggggaagga
A0A8I3P430_MCL1-01      gc---gcc----tcctcttcgggagggcggcttttggcttcggggaagga
A0A8I3P430_MCL1-02      gc---gcc----tcctcttcgggagggcggctttt---------------
A0A8C3W949_MCL1-01      gcagtgcc----tccgctccgggagggcgcctcttggctgcgggaaaaga
A0A8C3W949_MCL1-02      gcagtgcc----tccgctccgggagggcgcctcttggctgcgggaaaaga
A0A8C3W949_MCL1-03      gcagtgcc----tccgctccgggagggcgcctctt---------------
Q95KR3_MCL1-01          gcagcgcc----t-------------------------------------
A0A8D1FTD4_MCL1-03      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A8D1G1G8_MCL1-04      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A4X1SEZ6_MCL1-01      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A4X1SFB1_MCL1-01      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A8D1FTD4_MCL1-01      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A8D1G1G8_MCL1-02      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A8D1RYD1_MCL1-01      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A4X1SEU3_MCL1-02      gcagcgcc----tccgctccgggaggccgtctctt---------------
A0A4X1SEZ6_MCL1-03      gcagcgcc----tccgctccgggaggccgtctctt---------------
A0A4X1SFB1_MCL1-02      gcagcgcc----tccgctccgggaggccgtctctt---------------
A0A8D1FTD4_MCL1-05      gcagcgcc----tccgctccgggaggccgtctctt---------------
A0A8D1G1G8_MCL1-01      gcagcgcc----tccgctccgggaggccgtctctt---------------
A0A8D1RYD1_MCL1-03      gcagcgcc----tccgctccgggaggccgtctctt---------------
A0A4X1SEU3_MCL1-01      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A8D1G1G8_MCL1-03      gcagcgcc----tccgctccggg---------------------------
A0A8D1FTD4_MCL1-02      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A8D1RYD1_MCL1-02      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A4X1SEZ6_MCL1-02      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
A0A8D1FTD4_MCL1-04      gcagcgcc----tccgctccgggaggccgtctcttggctacgggaaaaga
M3XZZ5_MCL1-01          gc---gcc----tcctcttcgggagggcggcttttggcttcggggaagga
A0A8C7BMW8_MCL1-01      gc---gcc----tcctcttcgggagggcggcttttggcttcggggaagga
A0A8C7BMW8_MCL1-02      gc---gcc----tcctcttcgggagggcggctttt---------------
A0A452RHX5_MCL1-01      gc---gcc----gcctcatcgggagggcggcttttggcttcggggaagga
G1L3L7_MCL1-01          gc---gcc----gcctcatcgggagggcggcttttggcttcggggaagga
G1L3L7_MCL1-02          gc---gcc----gcctcatcgggagggcggctttt---------------
A0A803T0A4_MCL1-01      gcctcacc------------------------------------------
A0A803T0A4_MCL1-02      gcctcacc------------------------------------------
A0A803T0A4_MCL1-03      gcctcacc------------------------------------------
A0A670K3Y6_MCL1-01      gtctcccc------------------------------------------
A0A8D0E7Q9_MCL1-01      gtctcccc------------------------------------------
A0A8D0E7Q9_MCL1-02      gtctcccc------------------------------------------
A0A8C5PJK5_MCL1-01      cacttcaa------------------------------------------
A0A670Z5Q4_MCL1-01      ttgtactg------------------------------------------
A0A8C5WWU9_MCL1-01      cagtcccc------------------------------------------
A0A8C6VLE3_MCL1-01      cagtcccc------------------------------------------
A0A8C6VLE3_MCL1-02      cagtcccc------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      g-------------------------------------------------
A0A8D2IVC0_MCL1-02      gcgggcgg------------------------------------------
A0A8D2IVC0_MCL1-03      gcgggcgg------------------------------------------
A0A6I8NSR7_MCL1-01      ccgcccgg------------------------------------------
A0A6I8NSR7_MCL1-02      ccgcccgg------------------------------------------
A0A8C9NTQ6_MCL1-01      tgaatgag------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      cgacattg------------------------------------------
A0A8B9BNC2_MCL1-01      ggtgagaa------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      ggtcagtt------------------------------------------
A0A8B9VGG9_MCL1-01      ggtcagtt------------------------------------------
A0A8B9SWV2_MCL1-01      agggggcg------------------------------------------
A0A8C3GNC2_MCL1-01      aggaggag------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      ggggaggg------------------------------------------
A0A8C3UEV5_MCL1-01      agggatgg------------------------------------------
A0A674HQK4_MCL1-01      gggcggcg------------------------------------------
A0A674HQK4_MCL1-02      gaaccgcg------------------------------------------
A0A8C0UE15_MCL1-01      aggagctc------------------------------------------
A0A8C3QRB8_MCL1-01      ggggagcg------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      ggggagcc------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      tcaccggc------------------------------------------
A0A8C2TT61_MCL1-02      tcaccggc------------------------------------------
A0A8C9EP12_MCL1-01      tcaccagc------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      gcacc-gg------------------------------------------
A0A8C4U2H6_MCL1-01      tcgcc-cg------------------------------------------
A0A663EQJ0_MCL1-01      tcgccggg------------------------------------------
A0A663EQJ0_MCL1-02      tcgccggg------------------------------------------
A0A8B9M984_MCL1-01      tcgcc-gg------------------------------------------
A0A8B9M984_MCL1-02      tcgcc-gg------------------------------------------
A0A8C0ASR2_MCL1-01      ------tg------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      ------ac------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      gcgtctcc------------------------------------------
A0A8C8RUG9_MCL1-01      gcttctgc------------------------------------------
A0A8C3EZ48_MCL1-01      tcccccca------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --ctcccc------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      gcctcccc------------------------------------------
A0A8C0GRW6_MCL1-01      gcctcccc------------------------------------------
A0A8C4YAJ9_MCL1-01      gcctcccc------------------------------------------
A0A8C3H9M3_MCL1-01      ggctcccc------------------------------------------
A0A674IPL6_MCL1-01      ggctcccc------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      ------------------------------agaaagaggagaagctgccc
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      ccctacggttgagagtactccgccgcagcgcgatggaggggaagtggaaa
A0A5F8GAQ2_MCL1-01      ccctacggttgagagtactccgccgcagcgcgatggaggggaagtggaaa
A0A5F8GAQ2_MCL1-02      ccctacggttgagagtactccgccgcagcgcgatggaggggaagtggaaa
A0A7N4PRP1_MCL1-01      aacggcggtggagagttcgccgccgcggctggacggaggggaagtgggag
A0A7N4PRP1_MCL1-02      aacggcggtggagagttcgccgccgcggctggacggaggggaagtgggag
A0A7N4PRP1_MCL1-03      aacggcggtggagagttcgccgccgcggctggacggaggggaagtgggag
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          gg-----------------------------------gcggggagggaaa
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------gggggagtgaggag----
A0A8C2MG79_MCL1-01      ggccaagg---------------cgcggcgcgaggggggaggggaggccg
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      ggccaagg---------------cgcggcgcgaggggggaggggaggccg
A0A8C6GJU8_MCL1-02      ggccaagg---------------cgcggcgcgaggggggaggggaggccg
A0A8C6GJU8_MCL1-03      ggccaagg---------------cgcggcgcgaggggggaggggaggccg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          ggccgcgg---------------cccggctagaggtagggggaggggagg
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          ggccacgg---------------cccggcaagaggtagggggagggga--
A0A8C6QA84_MCL1-01      ggccaagg---------------cacggtgcgag---gggggaggggagg
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      ggccgcgg---------------cccggcgagaggcagggggaggggaag
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      ggccgcgg---------------cccggcgagaggcagggggagggga--
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ggcctcgg---------------cccagcgagaggtagggggaggggagg
H0XFB7_MCL1-01          ggccgcgg---------------cccggcgagaggcagggggaggggaag
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      ggccactg---------------cccggcgagaggtagggggaggggaag
A0A8B7GKA0_MCL1-02      ggccactg---------------cccggcgagaggtagggggaggggaag
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      ggccacgg---------------cccggcgagaggtagggggaggggaag
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      ggccacgg---------------cccggcgagaggtagggggaggggaag
A0A2K6GI15_MCL1-02      ggccacgg---------------cccggcgagaggtagggggaggggaag
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      ggcctcgg---------------cccggcgagaggtagggggaggggaag
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2I3RTV4_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A087WT64_MCL1-09      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2I2YJ87_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2I3RTV4_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2R9BPJ5_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
B4DU51_MCL1-01          agccccgg---------------cc-------------------------
B4DLY8_MCL1-01          ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      ggcctcgg---------------cccggcgagagatagggggaggggagg
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A8I5TL14_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5I9I0_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K6PPI3_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K6KRW9_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K6PPI3_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A096MRS6_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2I3GB35_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2I3GB35_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5XSB2_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5W0Y7_MCL1-03      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K6ECQ5_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5LXU8_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ggcctcgg---------------ctcggcgagagatagggggaggggagg
I7G687_MCL1-01          ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5W0Y7_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
F7HUE9_MCL1-01          ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      ggcctcgg---------------cccggcgagagatagggggaggggagg
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          ggcctcgg---------------cccagcgagaggtagggggaggggagg
A0A2K6V5X4_MCL1-02      ggcctcgg---------------cccagcgagaggtagggggaggggagg
A0A2K6V5X4_MCL1-01      ggcctcgg---------------cccagcgagaggtagggggaggggagg
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      ggcctcgg---------------cccagcgagaggtagggggaggggagg
A0A2K5CFB8_MCL1-01      ggcctcgg---------------cccagcgagaggtagggggaggggagg
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      ggccgcgg---------------cgcggcgagaggtagggggaggggaag
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      ggccacgg---------------cgcggcgagaggtagggggaggggaag
A0A452GA25_MCL1-02      ggccacgg---------------cgc------------------------
A5PJR2_MCL1-01          ggccacgg---------------cgcggcgagaggtagggggaggggaag
A0A8B9W7D1_MCL1-03      ggccacgg---------------cgcggcgagaggtagggggaggggaag
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      ggccacgg---------------cgcggcgagaggtagggggaggggaag
A0A8B9W7D1_MCL1-02      ggccacgg---------------cgcggcgagaggtagggggaggggaag
A0A671G0G2_MCL1-01      ggccaccg---------------cccggcgagaggcagggggaggggaag
A0A671G0G2_MCL1-02      ggccaccg---------------cccggcgagaggcagggggaggggaag
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      ggccactg---------------cacggcgagaggcagggggaggggaag
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      ggccacgg---------------cccggcgggaggtagggggaggggaag
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ggccacgg---------------cccggcgggaggtagggggaggggaag
A0A673TBH1_MCL1-01      ggccacgg---------------cccggcgggaggtagggggaggggaag
A0A673TBH1_MCL1-02      ggccacgg---------------cccggcgggaggtagggggaggggaag
A0A8C4L244_MCL1-01      ggccacgg---------------cccggcgagagggagggggaggggagg
A0A5F5Q151_MCL1-01      ggccacgg---------------cccggcgagagggagggggaggggagg
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      ggccacgg---------------ccgggcgagaggtagggggaggggaaa
A0A8C0DF47_MCL1-01      ggccacgg---------------ccgggcgagaggtagggggaggggaaa
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      ggccacgg---------------ccgggcgagaggtagggggaggggaag
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      ggccacgg---------------ccgggcgagaggtagggggaggggaag
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      ggccacgg---------------ccaggcgagaggtagggggaggggaag
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      ggccacgg---------------cccggcgagaggtagggggaggggaag
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      ggccacgg---------------ccaggcgagaggtagggggaggggaag
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      ggccacgg---------------ccaggcgagaggtagggggaggggaag
Q7YRZ9_MCL1-01          ggccacgg---------------ccaggcgagaggtagggggaggggaag
A0A337S3J9_MCL1-03      ggccacgg---------------ccaggcgagaggtagggggaggggaag
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          ggccacga---------------ccagacgggagggagggggaggggaag
A0A8C0MCZ5_MCL1-02      ggccacga---------------ccagacgggagggagggggaggggaag
A0A8C0L4C8_MCL1-01      ggccacga---------------ccagacgggagggagggggaggggaag
A0A8C0MCZ5_MCL1-01      ggccacga---------------ccagacgggagggagggggaggggaag
A0A8I3P430_MCL1-01      ggccacga---------------ccagacgggagggagggggaggggaag
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      ggccacgg---------------cccagagagaggtagggggaggggaag
A0A8C3W949_MCL1-02      ggccacgg---------------cccagagagaggtagggggaggggaag
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A8D1G1G8_MCL1-04      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A4X1SEZ6_MCL1-01      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A4X1SFB1_MCL1-01      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A8D1FTD4_MCL1-01      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A8D1G1G8_MCL1-02      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A8D1RYD1_MCL1-01      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      ggccacgg---------------ccnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A8D1RYD1_MCL1-02      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A4X1SEZ6_MCL1-02      ggccacgg---------------cccggcaagaggtagggggaggggaag
A0A8D1FTD4_MCL1-04      ggccacgg---------------cccggcaagaggtagggggaggggaag
M3XZZ5_MCL1-01          ggccacgg---------------cccggcgggaggtagggggaggggaag
A0A8C7BMW8_MCL1-01      ggccacgg---------------cccggcgggaggtagggggaggggaag
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      ggccacgg---------------cccggcgggaggtagggggaggggaag
G1L3L7_MCL1-01          ggccacgg---------------cccggagggagatagggggaggggaag
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      ------------------------------tggagccggcggaggcgtcg
A0A803T0A4_MCL1-02      ------------------------------tggagccggcggaggcgtcg
A0A803T0A4_MCL1-03      ------------------------------tggagccggcggaggcgtcg
A0A670K3Y6_MCL1-01      ------------------------------gggggccggcggaggcggca
A0A8D0E7Q9_MCL1-01      ------------------------------cggcgcgggcggcggcggcg
A0A8D0E7Q9_MCL1-02      ------------------------------cggcgcgggcggcggcggcg
A0A8C5PJK5_MCL1-01      ------------------------------taaagtttataaaaggcaac
A0A670Z5Q4_MCL1-01      ------------------------------tgggggaggggg--------
A0A8C5WWU9_MCL1-01      ------------------------------cggcggcggcggcggcggcg
A0A8C6VLE3_MCL1-01      ------------------------------cggaggcggcggaggcggca
A0A8C6VLE3_MCL1-02      ------------------------------cggaggcggcggaggcggca
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      -------------------------------gacgggacggg---ccacc
A0A8D2IVC0_MCL1-02      ------------------------------cggcggggagggagccggcc
A0A8D2IVC0_MCL1-03      ------------------------------cggcggggagggagccggcc
A0A6I8NSR7_MCL1-01      ------------------------------agggcgcctgcggcccgaca
A0A6I8NSR7_MCL1-02      ------------------------------agggcgcctgcggcccgaca
A0A8C9NTQ6_MCL1-01      ------------------------------ggatg---------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      ------------------------------ggggaccacagcagtgctat
A0A8B9BNC2_MCL1-01      ------------------------------gcagcaagagcagctccggg
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      ------------------------------ttgtggaaatcg-----gag
A0A8B9VGG9_MCL1-01      ------------------------------ttgtggaaatcg-----gag
A0A8B9SWV2_MCL1-01      ------------------------------gcggaggcggag-----ggg
A0A8C3GNC2_MCL1-01      ------------------------------gaggaggaggag-----ggg
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      ------------------------------agcgaagggcggcagggcga
A0A8C3UEV5_MCL1-01      ------------------------------g-------------------
A0A674HQK4_MCL1-01      ------------------------------g-------------------
A0A674HQK4_MCL1-02      ------------------------------gccggagcctcaccgggacc
A0A8C0UE15_MCL1-01      ------------------------------c-------------------
A0A8C3QRB8_MCL1-01      ------------------------------cccggagccc----------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      ------------------------------c-------------------
G1MPY7_MCL1-01          -------------------------------------------------c
A0A8C2TT61_MCL1-01      ------------------------------aggagaccaacccgcgccac
A0A8C2TT61_MCL1-02      ------------------------------aggagaccaacccgcgccac
A0A8C9EP12_MCL1-01      ------------------------------aggagaccaaaccccgccgc
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      ------------------------------------------------gc
A0A672UZL1_MCL1-01      ------------------------------gagggg------------gc
A0A8C4U2H6_MCL1-01      ------------------------------gggggg------------gc
A0A663EQJ0_MCL1-01      ------------------------------gggggg------------gg
A0A663EQJ0_MCL1-02      ------------------------------gggggg------------gg
A0A8B9M984_MCL1-01      ------------------------------gagggg------------gg
A0A8B9M984_MCL1-02      ------------------------------gagggg------------gg
A0A8C0ASR2_MCL1-01      ------------------------------agaact------------ga
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      ------------------------------ggcggg------------gg
A0A8C0FD84_MCL1-01      ------------------------------agggag------------aa
A0A8D0FVP8_MCL1-01      ------------------------------a-------------------
A0A8D0G5J1_MCL1-01      ------------------------------ggggggcggcggcggcgccc
A0A8C8RUG9_MCL1-01      ---------------------------------cagcggcggcggcgccc
A0A8C3EZ48_MCL1-01      ---------------------------------ggccccacctctgtccc
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      ---------------------------------gaacggcgtgggaaccc
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      ---------------------------------gagcggcgcgggaaccc
A0A8C0GRW6_MCL1-01      ----------------------------------agcggcgcggggaccc
A0A8C4YAJ9_MCL1-01      ---------------------------------cagcggcgcggggaccc
A0A8C3H9M3_MCL1-01      ---------------------------------gagcggcgccgggaccc
A0A674IPL6_MCL1-01      ---------------------------------gagcggcgcggggaccc
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      cgga----------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      ---------------------------------------tcaaagg----
A0A3P8Y1W8_MCL1-02      ---------------------------------------tcaaagg----
A0A3P8Y1W8_MCL1-03      ---------------------------------------tcaaagg----
A0A8C5CE84_MCL1-02      -------------------------------ggcgacgttcaaaagcgga
A0A8C5CE84_MCL1-03      -------------------------------ggcgacgttcaaaagcgga
A0A8C5CE84_MCL1-01      -------------------------------ggcgacgttcaaaagcgga
A0A8C5CE84_MCL1-04      ---------------------------------------tcaaaggc---
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      cagg---------------gacggcgggggcagggttgattggcggagga
A0A5F8GAQ2_MCL1-01      cagg---------------gacggcgggggcagggttgattggcggagga
A0A5F8GAQ2_MCL1-02      cagg---------------gacggcgggggcagggttgattggcggagga
A0A7N4PRP1_MCL1-01      cgagcaccacgacgacggcagcggcggcggtagggttaaggggcggaagc
A0A7N4PRP1_MCL1-02      cgagc------------------gcggcggtagggttaaggggcggaagc
A0A7N4PRP1_MCL1-03      cgagcaccacgacgacggcagcggcggcggtagggttaaggggcggaagc
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          cggg---------------------------cacggtgattggctggagc
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      g-------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      c-------------------------------------------------
A0A8C6GJU8_MCL1-02      c-------------------------------------------------
A0A8C6GJU8_MCL1-03      c-------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          ccgg---------------------------cgcggtgattggcggaagc
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          -------------------------------------------------c
A0A8C6QA84_MCL1-01      ccgg---------------------------cgcgggctcgggcggaagt
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      ccgg---------------------------cgcgct------------c
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      ccgg---------------------------cgtggtgattggcggaagc
H0XFB7_MCL1-01          ccgg---------------------------cgaggtgattggcggaagc
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A8B7GKA0_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      acgg---------------------------cacggtgattggcggaagc
A0A2K6GI15_MCL1-02      acgg---------------------------cacggtgattggcggaagc
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      ccgg---------------------------tgcggtgattggcggcagc
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      ccgg---------------------------cgcggtgattggcggaagc
A0A2I3RTV4_MCL1-02      ccgg---------------------------cgcggtgattggcggaagc
A0A087WT64_MCL1-09      ccgg---------------------------cgcggtgattggcggaagc
A0A2I2YJ87_MCL1-02      ccgg---------------------------cgcggtgattggcggaagc
A0A2I3RTV4_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A2R9BPJ5_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          ccgg---------------------------cgcggtgattggcggaagc
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      ccgg---------------------------cgcggtgattggcggaagc
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      ccgg---------------------------cgcggtgattggcggaagc
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A8I5TL14_MCL1-02      ccgg---------------------------cgcggtgattggcggaagc
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A2K5I9I0_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      ccgg---------------------------cacggtgattggcgaaagc
A0A2K6PPI3_MCL1-02      ccgg---------------------------cacggtgattggcgaaagc
A0A2K6KRW9_MCL1-01      ccgg---------------------------cacggtgattggcgaaagc
A0A2K6PPI3_MCL1-01      ccgg---------------------------cacggtgattggcgaaagc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      ccgg---------------------------cacggtgattggcggaagc
A0A096MRS6_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A2I3GB35_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A2I3GB35_MCL1-02      ccgg---------------------------cgcggtgattggcggaagc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A2K5XSB2_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A2K5W0Y7_MCL1-03      ccgg---------------------------cacggtgattggcggaagc
A0A2K6ECQ5_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A2K5LXU8_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
I7G687_MCL1-01          ccgg---------------------------cacggtgattggcggaagc
A0A2K5W0Y7_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
F7HUE9_MCL1-01          ccgg---------------------------cacggtgattggcggaagc
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      ccgg---------------------------cacggtgattggcggaacc
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          ccgg---------------------------cgcggtgactggcggaagc
A0A2K6V5X4_MCL1-02      ccgg---------------------------cgcggtgattggcggaagc
A0A2K6V5X4_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      ccgg---------------------------cgcggtgattggcggaagc
A0A2K5CFB8_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A452GA25_MCL1-02      ------------------------------------------------gc
A5PJR2_MCL1-01          ccgg---------------------------cacggtgattggcggaagc
A0A8B9W7D1_MCL1-03      ccgg---------------------------cacggtgattggcggaagc
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A8B9W7D1_MCL1-02      ccgg---------------------------cacggtgattggcggaagc
A0A671G0G2_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A671G0G2_MCL1-02      ccgg---------------------------tgcggtgattggcggaagc
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      ccgg---------------------------cacggtgattggcggaagc
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      ccgg---------------------------tgcggtgattggcggaagc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      ccgg---------------------------tgcggtgattggcggaagc
A0A673TBH1_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A673TBH1_MCL1-02      ccgg---------------------------tgcggtgattggcggaagc
A0A8C4L244_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A5F5Q151_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      ccgg---------------------------cgaggtgattggcggaagc
A0A8C0DF47_MCL1-01      ccgg---------------------------cgaggtgattggcggaagc
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      ccgg---------------------------cgaggtgattggcggaagc
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      ccgg---------------------------cgaggtgattggcggaagc
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      ccgg---------------------------tgcggtgattggcggaagc
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
Q7YRZ9_MCL1-01          ccgg---------------------------tgcggtgattggcggaagc
A0A337S3J9_MCL1-03      ccgg---------------------------tgcggtgattggcggaagc
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          ccgg---------------------------tgcggtgattggcggaagc
A0A8C0MCZ5_MCL1-02      ccgg---------------------------tgcggtgattggcggaagc
A0A8C0L4C8_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A8C0MCZ5_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A8I3P430_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      ccgg---------------------------cgcggtgattggcggaagc
A0A8C3W949_MCL1-02      ccgg---------------------------cgcggtgattggcggaagc
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      ccgg---------------------------catggtgattggcggaagc
A0A8D1G1G8_MCL1-04      ccgg---------------------------catggtgattggcggaagc
A0A4X1SEZ6_MCL1-01      ccgg---------------------------catggtgattggcggaagc
A0A4X1SFB1_MCL1-01      ccgg---------------------------catggtgattggcggaagc
A0A8D1FTD4_MCL1-01      ccgg---------------------------catggtgattggcggaagc
A0A8D1G1G8_MCL1-02      ccgg---------------------------catggtgattggcggaagc
A0A8D1RYD1_MCL1-01      ccgg---------------------------catggtgattggcggaagc
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnn---------------------------nnnnnnnnnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      ccgg---------------------------catggtgattggcggaagc
A0A8D1RYD1_MCL1-02      ccgg---------------------------catggtgattggcggaagc
A0A4X1SEZ6_MCL1-02      ccgg---------------------------catggtgattggcggaagc
A0A8D1FTD4_MCL1-04      ccgg---------------------------catggtgattggcggaagc
M3XZZ5_MCL1-01          ccgg---------------------------tgcggtgattggcggaagc
A0A8C7BMW8_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      ccgg---------------------------tgcggtgattggcggaagc
G1L3L7_MCL1-01          ccgg---------------------------tgcggtgattggcggaagc
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      gag--------------------------aaagtagcggcgggaataata
A0A803T0A4_MCL1-02      gag--------------------------aaagtagcggcgggaataata
A0A803T0A4_MCL1-03      gag--------------------------aaagtagcggcgggaataata
A0A670K3Y6_MCL1-01      gcagtagtggagccccaaccgcctcagccgcggcggccgccgtcttcacc
A0A8D0E7Q9_MCL1-01      gcg--------------------------gcggctgcggcggcccg-tta
A0A8D0E7Q9_MCL1-02      gcg--------------------------gcggctgcggcggcccg-tta
A0A8C5PJK5_MCL1-01      caa--------------------------acgccgtcttacggctgtctc
A0A670Z5Q4_MCL1-01      ---------------------------------gggcaacct--------
A0A8C5WWU9_MCL1-01      gca--------------------------gcgagggcggcctggctctcc
A0A8C6VLE3_MCL1-01      gcg--------------------------gcgagggcggcctggctctcc
A0A8C6VLE3_MCL1-02      gcg--------------------------gcgagggcggcctggctctcc
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      ctg--------------------------cgc----gctcgcgcgtccgc
A0A8D2IVC0_MCL1-02      ccg--------------------------cgc-tgagccggctccccgag
A0A8D2IVC0_MCL1-03      ccg--------------------------cgc-tgagccggctccccgag
A0A6I8NSR7_MCL1-01      agg--------------------------cgg-cggcggtcggcgagggc
A0A6I8NSR7_MCL1-02      agg--------------------------cgg-cggcggtcggcgagggc
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      agg--------------------------gcc-caacg------------
A0A8B9BNC2_MCL1-01      acg--------------------------cga-ctgcggcgtggag----
A0A8B9EU67_MCL1-01      ----------------------------------ctcg------------
A0A493U0E8_MCL1-01      gcg--------------------------agc-tctca------gggacc
A0A8B9VGG9_MCL1-01      gcg--------------------------agc-tctca------gggacc
A0A8B9SWV2_MCL1-01      gcc--------------------------cgg-cctcaccgggggggacc
A0A8C3GNC2_MCL1-01      gcc--------------------------cgg-cctcaacgggggggacc
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      agt--------------------------gca-ggaggcctggcct--cc
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      ctc--------------------------acc-gggaccctcaccgggac
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      -----------------------------------gccgccgccgccggc
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          ctg--------------------------cag-cagcagctgctct-gtc
A0A8C2TT61_MCL1-01      ccg--------------------------ccg-ccgccgccgctccggcc
A0A8C2TT61_MCL1-02      ccg--------------------------ccg-ccgccgccgctccggcc
A0A8C9EP12_MCL1-01      ccg--------------------------ccg-ccgccgcc---ccggcc
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      ccg--------------------------gcc-ccgccgccgccct--cc
A0A672UZL1_MCL1-01      ccg--------------------------gcc-ccgccgccgccct--cc
A0A8C4U2H6_MCL1-01      ccg--------------------------acg-ccgccgccgcccg--cc
A0A663EQJ0_MCL1-01      ccg--------------------------gcc-ccaccgccgccca--cc
A0A663EQJ0_MCL1-02      ccg--------------------------gcc-ccaccgccgccca--cc
A0A8B9M984_MCL1-01      ccg--------------------------gcc-ccgccgccgccgc--cc
A0A8B9M984_MCL1-02      ccg--------------------------gcc-ccgccgccgccgc--cc
A0A8C0ASR2_MCL1-01      cca--------------------------att-ttac-------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      gtg--------------------------gtg-gtgc-------------
A0A8C0FD84_MCL1-01      ctg--------------------------ttt-tgac-------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      ctc--------------------------ccg-cctcggcctcccccaac
A0A8C8RUG9_MCL1-01      ccc--------------------------ctg-ctcccac---------c
A0A8C3EZ48_MCL1-01      act--------------------------cca-tccccactccactgctg
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      ctc--------------------------ccg-c---------------c
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      ctc--------------------------ccg-cccccggcgcgcgggac
A0A8C0GRW6_MCL1-01      ctc--------------------------c--------------------
A0A8C4YAJ9_MCL1-01      ctc--------------------------ccg-c---------------c
A0A8C3H9M3_MCL1-01      ctc--------------------------cca-c---------------c
A0A674IPL6_MCL1-01      ccc--------------------------ccg-c---------------c
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      gacgaacgtaaaccaagacccac---------------------------
A0A8C5CE84_MCL1-03      gacgaacgtaaaccaagacccac---------------------------
A0A8C5CE84_MCL1-01      gacgaacgtaaaccaagacccac---------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      atccgtgcgagtcctccgaatcc-tgt-----------------------
A0A5F8GAQ2_MCL1-01      atccgtgcgagtcctccgaatcc-tgt-----------------------
A0A5F8GAQ2_MCL1-02      atccgtgcgagtcctccgaatcc-tgt-----------------------
A0A7N4PRP1_MCL1-01      ggcggcgcgaatccccccgaccc-cgt-----------------------
A0A7N4PRP1_MCL1-02      ggcggcgcgaatccccccgaccc-cgt-----------------------
A0A7N4PRP1_MCL1-03      ggcggcgcgaatccccccgaccc-cgt-----------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          gctggcgcgagcccccaagccac-tct-----------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      ------------------------cct-----------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      ------------------------cct-----------------------
A0A8C6GJU8_MCL1-02      ------------------------cct-----------------------
A0A8C6GJU8_MCL1-03      ------------------------cct-----------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          ccgggcgctagccccccggccgc-gct-----------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          gccggcgcgagccccccggccgc-tgt-----------------------
A0A8C6QA84_MCL1-01      g------tgagcggccctgcagc-cct-----------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      tcgggcggaagctccccagccgc-cca-----------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      -----------------agccgc-cca-----------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      gccggcgctagcccctcggccgc-cct-----------------------
H0XFB7_MCL1-01          cccggcgcgagttccccggcctc-cct-----------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      cccggcgcaagccccccggcctc-cct-----------------------
A0A8B7GKA0_MCL1-02      cccggcgcaagccccccggcctc-cct-----------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      cccggcgcaagccccccggcctc-cct-----------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      cccggcgcaagccccccggcctc-cct-----------------------
A0A2K6GI15_MCL1-02      cccggcgcaagccccccggcctc-cct-----------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      gcaggcgcgagccccccggccgc-cct-----------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      gccggcgcaagccccccgtccac-cct-----------------------
A0A2I3RTV4_MCL1-02      gctggcgcaagccccccgtccac-cct-----------------------
A0A087WT64_MCL1-09      gccggcgcaagccccccgtccac-cct-----------------------
A0A2I2YJ87_MCL1-02      gccggcgcaagccccccgtccac-cct-----------------------
A0A2I3RTV4_MCL1-01      gctggcgcaagccccccgtccac-cct-----------------------
A0A2R9BPJ5_MCL1-01      gccggcgcaagccccccgtccac-cct-----------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      gccggcgcaagccccccgtccac-cct-----------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          gccggcgcaagccccccgtccac-cct-----------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      gccggcgcaagccccccgtccac-cct-----------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      gccggcgcaagccccccgtccac-cct-----------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      gccggcgcaagccccccgtctac-cct-----------------------
A0A8I5TL14_MCL1-02      gccggcgcaagccccccgtctac-cct-----------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5I9I0_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K6PPI3_MCL1-02      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K6KRW9_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K6PPI3_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      gccggcgcaagccccccggccgc-cct-----------------------
A0A096MRS6_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A2I3GB35_MCL1-01      gccggcgcaagccccccgtcagt-cct-----------------------
A0A2I3GB35_MCL1-02      gccggcgcaagccccccgtcagt-cct-----------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5XSB2_MCL1-02      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5W0Y7_MCL1-03      gccggcgcaagcccccgg---gc-cct-----------------------
A0A2K6ECQ5_MCL1-02      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5LXU8_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      gctggcgcaagccccccggccgc-cct-----------------------
I7G687_MCL1-01          gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5W0Y7_MCL1-01      gccggcgcaagcccccgg---gc-cct-----------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
F7HUE9_MCL1-01          gccggcgcaagccccccggccgc-cct-----------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      gccggcgcaagccccccggccgc-cct-----------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      gccggcgcaagccccccggccgc-cct-----------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          gccggcgctagccccccggccgc-cct-----------------------
A0A2K6V5X4_MCL1-02      gccggcgctagccctccggccgc-cct-----------------------
A0A2K6V5X4_MCL1-01      gccggcgctagccctccggccgc-cct-----------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      gccggcgctagccccccggccgc-cct-----------------------
A0A2K5CFB8_MCL1-01      gccggcgctagccccccggccgc-cct-----------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          -------tgaccccgccggttaggtgc-----------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      gccggcccgagccccccggccac-tct-----------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      gccggcccgagccccccggccac-tct-----------------------
A0A452GA25_MCL1-02      gccggcccgagccccccggccac-tct-----------------------
A5PJR2_MCL1-01          gccggcccgagccccccggccac-tct-----------------------
A0A8B9W7D1_MCL1-03      gccggcccgagccccccggccac-tct-----------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gccggcccgagccccccggccac-tct-----------------------
A0A8B9W7D1_MCL1-02      gccggcccgagccccccggccac-tct-----------------------
A0A671G0G2_MCL1-01      gccggcgcgagccccccggccac-tct-----------------------
A0A671G0G2_MCL1-02      gccggcgcgagccccccggccac-tct-----------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      gccggcgcgagccccccggccgc-tca-----------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      gccggcgcgagccccccggccac-ttt-----------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      gccggcgcgagccccccggccac-ttt-----------------------
A0A673TBH1_MCL1-01      gccggcgcgagccccccggccac-ttt-----------------------
A0A673TBH1_MCL1-02      gccggcgcgagccccccggccac-ttt-----------------------
A0A8C4L244_MCL1-01      gccggcgggagcccccagaccac-cct-----------------------
A0A5F5Q151_MCL1-01      gccggcgggagcccccagaccac-cct-----------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      gccggcccgagccccccggccac-tct-----------------------
A0A8C0DF47_MCL1-01      gccggcccgagccccccggccac-tct-----------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      gccggcccgagccccccggccac-tct-----------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      gccggcccgagccccccagccac-tct-----------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      gccggcgcgagccccccagccac-tct-----------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      gccggcgcgagccccccagccac-tct-----------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      gccggcgcgagccccccagccac-tct-----------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      gccggcgcgagccccccagccac-tct-----------------------
Q7YRZ9_MCL1-01          gccggcgcgagccccccagccac-tct-----------------------
A0A337S3J9_MCL1-03      gccggcgcgagccccccagccac-tct-----------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          gccggcgcaagtcccccgaccac-tct-----------------------
A0A8C0MCZ5_MCL1-02      gccggcgcaagtcccccgaccac-tct-----------------------
A0A8C0L4C8_MCL1-01      gccggcgcaagtcccccgaccac-tct-----------------------
A0A8C0MCZ5_MCL1-01      gccggcgcaagtcccccgaccac-tct-----------------------
A0A8I3P430_MCL1-01      gccggcgcaagtcccccgaccac-tct-----------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8C3W949_MCL1-02      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8D1G1G8_MCL1-04      gccggcgcgagccccccgtccac-tcc-----------------------
A0A4X1SEZ6_MCL1-01      gccggcgcgagccccccgtccac-tcc-----------------------
A0A4X1SFB1_MCL1-01      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8D1FTD4_MCL1-01      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8D1G1G8_MCL1-02      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8D1RYD1_MCL1-01      gccggcgcgagccccccgtccac-tcc-----------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnn-nnn-----------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8D1RYD1_MCL1-02      gccggcgcgagccccccgtccac-tcc-----------------------
A0A4X1SEZ6_MCL1-02      gccggcgcgagccccccgtccac-tcc-----------------------
A0A8D1FTD4_MCL1-04      gccggcgcgagccccccgtccac-tcc-----------------------
M3XZZ5_MCL1-01          gccggcgcgagtaccccggccac-tct-----------------------
A0A8C7BMW8_MCL1-01      gccggcgcgagtaccccggccac-tct-----------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      gccggcgctagtcccccggccac-tct-----------------------
G1L3L7_MCL1-01          gccggcgctagtcccccggccac-tct-----------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      acgacggcggcggcgtctcg------------------------------
A0A803T0A4_MCL1-02      acgacggcggcggcgtctcg------------------------------
A0A803T0A4_MCL1-03      acgacggcggcggcgtctcg------------------------------
A0A670K3Y6_MCL1-01      gccaacggccgctctgagggcgccggcccgtt------------------
A0A8D0E7Q9_MCL1-01      acggccctggcgtcgccgttctcggcgccgcgcatcggcggc--------
A0A8D0E7Q9_MCL1-02      acggccctggcgtcgccgttctcggcgccgcgcatcggcggc--------
A0A8C5PJK5_MCL1-01      accaatgtcgtgaaagggcagcttttacagcagcagag------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      ttcccggcggcgttcgaggaggcctgggcgggggt---------------
A0A8C6VLE3_MCL1-01      ttcccggcggcgttcgaggaggcctgggcgggggg---------------
A0A8C6VLE3_MCL1-02      ttcccggcggcgttcgaggaggcctgggcgggggg---------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      ggccaatccgcgcgccggcgctgccaggct--------------------
A0A8D2IVC0_MCL1-02      ggcc--tcggcgcgc--gcgcgggccggctccccnnnnnnnnnnnnnnnn
A0A8D2IVC0_MCL1-03      ggcc--tcggcgcgc--gcgcgggccggctccccnnnnnnnnnnnnnnnn
A0A6I8NSR7_MCL1-01      ccggcggcggcggcggcggcggcggcccggcgcgcgggcggg--------
A0A6I8NSR7_MCL1-02      ccggcggcggcggcggcggcggcggcccggcgcgcgggcggg--------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      cc------------------------------------------------
A0A8C3GNC2_MCL1-01      ccggccccgccgcccccctcccctcacgccgccgcccccccc--------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      gctggggatcgccgtgtggatccctggaaagtccgcagagat--------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      cccgcggagcctcaccgggaa-----------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      gcctcagagcagccccgcgac-----------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          acagctttcagaccccaggtacagaggct---------------------
A0A8C2TT61_MCL1-01      gccgccaccggctctgaggtaccgcggcctctgattggctca--------
A0A8C2TT61_MCL1-02      gccgccaccggctctgaggtaccgcggcctctgattggctca--------
A0A8C9EP12_MCL1-01      gccgccaccgccgctgaggtaccgcggccgctgattggctcc--------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      ccggc---------------------------------------------
A0A672UZL1_MCL1-01      gcggcccccgcg--------------------------------------
A0A8C4U2H6_MCL1-01      ---gtcgtccccgccacggccgccg---------ccgccgcc--------
A0A663EQJ0_MCL1-01      gcagccgccgccgctgaggtacccgggaccctgattggctcc--------
A0A663EQJ0_MCL1-02      gcagccgccgccgctgaggtacccgggaccctgattggctcc--------
A0A8B9M984_MCL1-01      ---gccgccgccgctgaggtacccgggaccctgattggctcc--------
A0A8B9M984_MCL1-02      ---gccgccgccgctgaggtacccgggaccctgattggctcc--------
A0A8C0ASR2_MCL1-01      ----------------------------------ctggtttt--------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      ----------------------------------tggggtgt--------
A0A8C0FD84_MCL1-01      ----------------------------------ctggtttt--------
A0A8D0FVP8_MCL1-01      -----------------------------------------t--------
A0A8D0G5J1_MCL1-01      ggcccggctgaggcggggggcgcgcggc---cgccgctgatt--------
A0A8C8RUG9_MCL1-01      ggcccttcttccacggagggcgttcggccggcgacgctgatt--------
A0A8C3EZ48_MCL1-01      ccctgcctcttcccgtc---------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      ccc-----------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      cccggcccttcggcggagggcgcccggccggcgacgctgatt--------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      cccgggcctgcggcggagggcgtccggccggcgacgctgatt--------
A0A8C3H9M3_MCL1-01      ccggg---c-----------------------------------------
A0A674IPL6_MCL1-01      cccgg---cgcgcgggaccccggccctccggcgacgctgatt--------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      --------------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      --------------------------------------------------
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D2IVC0_MCL1-03      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A6I8NSR7_MCL1-01      --------------------------------------------------
A0A6I8NSR7_MCL1-02      --------------------------------------------------
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      --------------------------------------------------
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      --------------------------------------------------
A0A8C2TT61_MCL1-02      --------------------------------------------------
A0A8C9EP12_MCL1-01      --------------------------------------------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      --------------------------------------------------
A0A8C8RUG9_MCL1-01      --------------------------------------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      --------------------------------------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      --------------------------------------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      --------------------------------------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      ------------------------------------------------at
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      ------------------------------------------ctggtgc-
A0A3P8Y1W8_MCL1-05      ------------------------------------------ctggtgc-
A0A6F9BEN5_MCL1-02      ---------------------------------------ctgctggtgct
Q0KFR9_MCL1-01          ------------------------------------tagctgatgatgct
A0A673VWA7_MCL1-01      ------------------------------------tagctgatgatgct
A0A4W5QGT1_MCL1-01      ------------------------------------ttgctaatgatgct
A0A8C8LPV9_MCL1-01      ------------------------------------tagctgatgatgct
A0A8C7LPD4_MCL1-01      ------------------------------------tagctgatgatgct
A0A8C7H1W6_MCL1-01      ------------------------------------tagctgatgatgct
A0A8C7H1W6_MCL1-02      ------------------------------------tagctgatgatgct
A0A4W5LP06_MCL1-01      ---------------------------------------ctgctggtgct
A0A4W5LP06_MCL1-02      ---------------------------------------ctgctggtgct
A0A674ELG3_MCL1-03      ---------------------------------------ctgctggtac-
A0A674ELG3_MCL1-01      ---------------------------------------ctgctggtac-
A0A674ELG3_MCL1-02      ---------------------------------------ctgctggtac-
A0A8C7PM33_MCL1-03      ---------------------------------------ctgctggtac-
A0A8C7PM33_MCL1-01      ---------------------------------------ctgctggtac-
A0A8C7PM33_MCL1-02      ---------------------------------------ctgctggtac-
A0A8C8CMB3_MCL1-01      ---------------------------------------ctgctggtac-
A0A8C8CMB3_MCL1-02      ---------------------------------------ctgctggtac-
A0A8C7H400_MCL1-01      ---------------------------------------ctgctggtac-
A0A8C7H400_MCL1-02      ---------------------------------------ctgctggtac-
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      --------------------------------------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      --------------------------------------------------
A0A3B4CGU9_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-02      --------------------------------------------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      -------------------------------------------------g
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      --------------------------------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      --------------------------------------------------
A0A8C5CE84_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-01      --------------------------------------------------
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          --------------------------------------------------
A0A5F8GAQ2_MCL1-03      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-01      --------------------------------------------------
A0A7N4PRP1_MCL1-02      --------------------------------------------------
A0A7N4PRP1_MCL1-03      --------------------------------------------------
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          --------------------------------------------------
G1PZ39_MCL1-01          --------------------------------------------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-01      --------------------------------------------------
A0A8C6GJU8_MCL1-02      --------------------------------------------------
A0A8C6GJU8_MCL1-03      --------------------------------------------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          --------------------------------------------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          --------------------------------------------------
A0A8C6QA84_MCL1-01      --------------------------------------------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      --------------------------------------------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-02      --------------------------------------------------
A0A2K5C7L5_MCL1-01      --------------------------------------------------
H0XFB7_MCL1-01          --------------------------------------------------
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-02      --------------------------------------------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      --------------------------------------------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      --------------------------------------------------
A0A2K6GI15_MCL1-02      --------------------------------------------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      --------------------------------------------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-02      --------------------------------------------------
A0A087WT64_MCL1-09      --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I3RTV4_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-01      --------------------------------------------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      --------------------------------------------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      --------------------------------------------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      --------------------------------------------------
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      --------------------------------------------------
A0A8I5TL14_MCL1-02      --------------------------------------------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      --------------------------------------------------
A0A2K5I9I0_MCL1-01      --------------------------------------------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      --------------------------------------------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      --------------------------------------------------
A0A096MRS6_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-01      --------------------------------------------------
A0A2I3GB35_MCL1-02      --------------------------------------------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-02      --------------------------------------------------
A0A2K5W0Y7_MCL1-03      --------------------------------------------------
A0A2K6ECQ5_MCL1-02      --------------------------------------------------
A0A2K5LXU8_MCL1-01      --------------------------------------------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      --------------------------------------------------
I7G687_MCL1-01          --------------------------------------------------
A0A2K5W0Y7_MCL1-01      --------------------------------------------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      --------------------------------------------------
F7HUE9_MCL1-01          --------------------------------------------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      --------------------------------------------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      --------------------------------------------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      --------------------------------------------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          --------------------------------------------------
A0A2K6V5X4_MCL1-02      --------------------------------------------------
A0A2K6V5X4_MCL1-01      --------------------------------------------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      --------------------------------------------------
A0A2K5CFB8_MCL1-01      --------------------------------------------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      --------------------------------------------------
A0A452GA25_MCL1-02      --------------------------------------------------
A5PJR2_MCL1-01          --------------------------------------------------
A0A8B9W7D1_MCL1-03      --------------------------------------------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      --------------------------------------------------
A0A8B9W7D1_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-01      --------------------------------------------------
A0A671G0G2_MCL1-02      --------------------------------------------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      --------------------------------------------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      --------------------------------------------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      --------------------------------------------------
A0A673TBH1_MCL1-01      --------------------------------------------------
A0A673TBH1_MCL1-02      --------------------------------------------------
A0A8C4L244_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-01      --------------------------------------------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-01      --------------------------------------------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      --------------------------------------------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      --------------------------------------------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      --------------------------------------------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      --------------------------------------------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      --------------------------------------------------
Q7YRZ9_MCL1-01          --------------------------------------------------
A0A337S3J9_MCL1-03      --------------------------------------------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          --------------------------------------------------
A0A8C0MCZ5_MCL1-02      --------------------------------------------------
A0A8C0L4C8_MCL1-01      --------------------------------------------------
A0A8C0MCZ5_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-01      --------------------------------------------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      --------------------------------------------------
A0A8C3W949_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      --------------------------------------------------
A0A8D1G1G8_MCL1-04      --------------------------------------------------
A0A4X1SEZ6_MCL1-01      --------------------------------------------------
A0A4X1SFB1_MCL1-01      --------------------------------------------------
A0A8D1FTD4_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-01      --------------------------------------------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      --------------------------------------------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      --------------------------------------------------
A0A8D1RYD1_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-04      --------------------------------------------------
M3XZZ5_MCL1-01          --------------------------------------------------
A0A8C7BMW8_MCL1-01      --------------------------------------------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      --------------------------------------------------
G1L3L7_MCL1-01          --------------------------------------------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      --------------------------------------------------
A0A803T0A4_MCL1-02      --------------------------------------------------
A0A803T0A4_MCL1-03      --------------------------------------------------
A0A670K3Y6_MCL1-01      ----------------------------------ctcgcctcggattggg
A0A8D0E7Q9_MCL1-01      --------------------------------------------------
A0A8D0E7Q9_MCL1-02      --------------------------------------------------
A0A8C5PJK5_MCL1-01      ----------------------------------agagacgccgcacgct
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-01      --------------------------------------------------
A0A8C6VLE3_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      ----------------------------------ggcggccccgcg--gg
A0A8D2IVC0_MCL1-02      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgcggatcggcggagg
A0A8D2IVC0_MCL1-03      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncgcggatcggcggagg
A0A6I8NSR7_MCL1-01      ----------------------------------ggaggggaggccgcgg
A0A6I8NSR7_MCL1-02      ----------------------------------ggaggggaggccgcgg
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      ----------------------------------cctccgttcccggcgg
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      ----------------------------------gggaaaccgcaa----
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      ----------------------------------gcg-------------
A0A8C2TT61_MCL1-02      ----------------------------------gcg-------------
A0A8C9EP12_MCL1-01      ----------------------------------gcg-------------
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      ----------------------------------gag-------------
A0A663EQJ0_MCL1-01      ----------------------------------gtg-------------
A0A663EQJ0_MCL1-02      ----------------------------------gtg-------------
A0A8B9M984_MCL1-01      ----------------------------------gtg-------------
A0A8B9M984_MCL1-02      ----------------------------------gtg-------------
A0A8C0ASR2_MCL1-01      ----------------------------------gtgtagct--------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      ----------------------------------gtgtagctgcacgggg
A0A8C0FD84_MCL1-01      ----------------------------------gtgtaact--------
A0A8D0FVP8_MCL1-01      ----------------------------------gtgt------------
A0A8D0G5J1_MCL1-01      ----------------------------------ggcgga----------
A0A8C8RUG9_MCL1-01      ----------------------------------ggcgga----------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      ----------------------------------ggcgga----------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      ----------------------------------ggcgga----------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      ----------------------------------ggcgga----------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      -------cgatgccctgcatcttgcgaagggggctgactttacgggaagc
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      caggacggctcagacaaagcgccccaggtggctctggcctctgaggtgga
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      -----acttccgcatactgggaccgcaagcaaacatgcactacattcatg
A0A3B4AFB7_MCL1-01      ---acat----gcctacagg---gtgtgctaactccaccgct----tgg-
A0A3B4AFB7_MCL1-02      --gacat----gcactgtgg---ggctgcagattcttccgcg----caga
A0A3P8Y1W8_MCL1-04      --ccctttgtgctattttagcccgacagggcccttatgtcc-----tgcg
A0A3P8Y1W8_MCL1-05      --ccctttgtgctattttagcccgacagggcccttatgtcc-----tgcg
A0A6F9BEN5_MCL1-02      agccctttgtactatttcggcgcgaatggggccgtatgtgc-----tggg
Q0KFR9_MCL1-01          aggccgttgtactatttccagggggctggggccatatgtgc-----tggg
A0A673VWA7_MCL1-01      aggccgttgtactatttccacggggctggggccatatgtgc-----tggg
A0A4W5QGT1_MCL1-01      agccctttgtgctatttcaac------ggg---------gc-----tggg
A0A8C8LPV9_MCL1-01      agccctttgtactatttcgac------ggggccgtatgtgc-----tggg
A0A8C7LPD4_MCL1-01      agccctttgtactatttcgac------ggggccgtatgtgc-----tgcg
A0A8C7H1W6_MCL1-01      agccctttgtactatatcgac------ggggccgtatgtgc-----tggg
A0A8C7H1W6_MCL1-02      agccctttgtactatatcgac------ggggccgtatgtgc-----tggg
A0A4W5LP06_MCL1-01      agccctttgtgctattt---cgcgactggggccgtatgtcc-----tggg
A0A4W5LP06_MCL1-02      agccctttgtgctattt---cgcgactggggccgtatgtcc-----tggg
A0A674ELG3_MCL1-03      --ccctttgtgctatttcggcgaga------ctgtatgtgc-----tggg
A0A674ELG3_MCL1-01      --ccctttgtgctatttcggcgaga------ctgtatgtgc-----tggg
A0A674ELG3_MCL1-02      --ccctttgtgctatttcggcgaga------ctgtatgtgc-----tggg
A0A8C7PM33_MCL1-03      --ctctttgtactatttcggcgagactggggctgtacgtgc-----tggg
A0A8C7PM33_MCL1-01      --ctctttgtactatttcggcgagactggggctgtacgtgc-----tggg
A0A8C7PM33_MCL1-02      --ctctttgtactatttcggcgagactggggctgtacgtgc-----tggg
A0A8C8CMB3_MCL1-01      --ctctttgtactatttcggcgagactggggctgtacgtgc-----tggg
A0A8C8CMB3_MCL1-02      --ctctttgtactatttcggcgagactggggctgtacgtgc-----tggg
A0A8C7H400_MCL1-01      --ccctttgtgctatttcggcgagactggggctgtacgtgc-----tggg
A0A8C7H400_MCL1-02      --ccctttgtgctatttcggcgagactggggctgtacgtgc-----tggg
A0A1A8A7I9_MCL1-01      --ccatt----acactacgg---accgggagattcccctcct----caca
A0A1A8A7I9_MCL1-03      --ccatt----acactacgg---accgggagattcccctcct----caca
A0A1A8A7I9_MCL1-02      --ccatt----acactacgg---accgggagattcccctcct----caca
A0A4W5KYB3_MCL1-01      --ccacg----------------tt-------------------------
A0A4W5LZB2_MCL1-01      --taaca-------------------------------------------
A0A4W5Q5Q2_MCL1-01      --taaag----------------tc-------------------------
A0A4W5Q5Q2_MCL1-02      --aacag----------------ccaagcggaaaacgctcct--gagtct
A0A8C7N2B4_MCL1-01      --tacag----------------at--ggggagacctcgaaa--cggata
A0A8K9V051_MCL1-01      --tacag----------------at--ggggagacctcgaaa--cggata
A0A674D165_MCL1-01      --tacag----------------ct--ggggaggcctcgaac--ccgata
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --caaac----gcactacag---cccggagattgcagcacca----gaaa
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --gtggtcagtacgaatcac---ctgaggggttgaaatcccataccggac
A0A6Q2Y9Q3_MCL1-01      --gtggtcagtacgaatcac---ctgaggggttgaaatcccataccggac
A0A3P8VHY5_MCL1-04      --accat----gcactatgg---cactggaaactccacgcct-------a
A0A3P8VHY5_MCL1-05      --accat----gcactatgg---cactggaaactccacgcct-------a
A0A3P8VHY5_MCL1-02      --accat----gcactatgg---cactggaaactccacgcct-------a
A0A3P8VHY5_MCL1-01      --accat----gcactatgg---cactggaaactccacgcct-------a
A0A3P8VHY5_MCL1-03      --accat----gcactatgg---cactggaaactccacgcct-------a
A0A8C2Z1X1_MCL1-01      --cccgt----gcactacgg---ctcgggagagtcctccccg----ctgg
G3PJT0_MCL1-01          --cccat----gcg--acag---c--------------------------
A0A3Q3S6A5_MCL1-01      --cccgt----gcactacga---ctccagagatccctccaca----cagt
A0A3Q3S6A5_MCL1-02      --cccgt----gcactacga---ctccagagatccctccaca----cagt
A0A3Q3VP02_MCL1-01      --ccgac----gcgtt---------------------cctcg----caaa
A0A2U9CJ81_MCL1-01      --gcgat----gcactacgg---ctcaggaaattccttgccg----caga
A0A8D3B2J3_MCL1-05      --gcgat----gcactacgg---ctcaggaaattccttgccg----caga
A0A8D3B2J3_MCL1-03      --gcgat----gcactacgg---ctcaggaaattccttgccg----caga
A0A8D3B2J3_MCL1-04      --gcgat----gcactacgg---ctcaggaaattccttgccg----caga
A0A8D3B2J3_MCL1-01      --gcgat----gcactacgg---ctcaggaaattccttgccg----caga
A0A8D3B2J3_MCL1-02      --gcgat----gcactacgg---ctcaggaaattccttgccg----caga
A0A667YZT5_MCL1-01      --caaat----gtactacgg---ctctggagattcctcccct----caga
A0A667YZT5_MCL1-02      --caaat----gtactacgg---ctctggagattcctcccct----caga
A0A3Q3B4P5_MCL1-01      --tt-------------------acacagagacacctctccc----cagg
A0A3Q3B4P5_MCL1-02      --tt-------------------acacagagacacctctccc----cagg
A0A3Q1GX28_MCL1-01      ---------------tacag---ctcgggagtcaactcgcca----caga
A0A3Q1GX28_MCL1-02      ---------------tacag---ctcgggagtcaactcgcca----caga
A0A3Q3GP42_MCL1-01      --cagat----gcactacgg---cccggaagcgtcctctcca----caaa
A0A8C5H9Y5_MCL1-01      --cgaat----caactacc----agcagaaggatccgcctcgggatcacc
A0A8C5H9Y5_MCL1-02      --cgaat----caactacc----agcagaaggatccgcctcgggatcacc
A0A671VEU3_MCL1-02      --acgat----gcactacga---ctcaagagattccgctccg----gaga
A0A671VEU3_MCL1-01      --acgat----gcactacga---ctcaagagattccgctccg----gaga
A0A671VEU3_MCL1-03      --acgat----gcactacga---ctcaagagattccgctccg----gaga
A0A3B4T8L9_MCL1-01      --tggac-------cgacgg---ctccggagactcctcgccg----gaga
A0A3B4T8L9_MCL1-02      --tggac-------cgacgg---ctccggagactcctcgccg----gaga
A0A3B4XKA5_MCL1-01      --tggag-------ggacag---ctccggagactcctcgccg----gaga
A0A4W6CDF4_MCL1-03      --ct-------gcactacag---ctcaggagattcctcacca----caga
A0A4W6CDF4_MCL1-01      --ct-------gcactacag---ctcaggagattcctcacca----caga
A0A4W6CDF4_MCL1-02      --ct-------gcactacag---ctcaggagattcctcacca----caga
A0A3B4ZKP6_MCL1-01      --cagat----gcactacgg---atcaggagatccctccgca----caga
A0A3Q1EQB9_MCL1-01      --ccgat----gcactatgg---atccggagattcctccccg----caga
A0A3Q1EQB9_MCL1-02      --ccgat----gcactatgg---atccggagattcctccccg----caga
A0A3P8RQX7_MCL1-01      --ccgat----gcactatgg---atccggagattcctccccg----caga
A0A3P8RQX7_MCL1-02      --ccgat----gcactatgg---atccggagattcctccccg----caga
A0A3Q1BKL8_MCL1-01      --ccgat----gcactatgg---atccggagattcctccccg----caga
A0A3Q1BKL8_MCL1-02      --ccgat----gcactatgg---atccggagattcctccccg----caga
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --acaat----gcactatgg---atcggggaattcctctccg----caag
A0A668SNL1_MCL1-01      --acgatgtgggctttatagataattgggaaa---ccctctg----tagg
I3KXG5_MCL1-01          --acgatgtgggctttatagataattgggaaa---ccctctg----tagg
A0A669C7T2_MCL1-03      --ccaat----gcactatgg---atcggggaaatcctctccg----caga
A0A668RLC9_MCL1-01      --ccaat----gcactatgg---atcggggaaatcctctccg----caga
A0A669C7T2_MCL1-01      --ccaat----gcactatgg---atcggggaaatcctctccg----caga
A0A669C7T2_MCL1-02      --ccaat----gcactatgg---atcggggaaatcctctccg----caga
A0A3Q4HLQ8_MCL1-01      --ccaat----gcactatgg---atcgggaaattcctcaccg----caga
A0A3P9BVM3_MCL1-01      --ccaat----gcactacgg---atctggaaattcctctccg----caga
A0A3P8NP63_MCL1-02      --ccaat----gcactacgg---atcgggaaattcctctccg----caga
A0A3P8NP63_MCL1-01      --ccaat----gcactacgg---atcgggaaattcctctccg----caga
A0A3P8NP63_MCL1-03      --ccaat----gcactacgg---atcgggaaattcctctccg----caga
A0A3Q2VNL8_MCL1-01      --ccaat----gcactacgg---atcgggaaattcctctccg----caga
A0A3B4G4Z6_MCL1-01      --ccaat----gcactacgg---atcgggaaattcctctccg----caga
A0A8C9XY04_MCL1-01      --ccaat----tctctacgg---ctcagggaattcctccccg----caga
A0A8P4G790_MCL1-01      --cacat----gcactacgg---accaggagattcatcccct----caga
A0A8P4G790_MCL1-02      --cacat----gcactacgg---accaggagattcatcccct----caga
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      -------------------------ctacagctttgtatcggcgtctctg
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      ---------------------------------------tggcgtcctgg
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      -----------------------ggggtgcgtcccacaatggcggcgg--
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      ----------------agatccgcgcgcgtgcctctgacctccgccacgg
A0A3B3CEX1_MCL1-02      ----------------agatccgcgcgcgtgcctctgacctccgccacgg
A0A8C7X109_MCL1-01      ----------------atgtccgcgcgcgtgcctctgccgtccacattgg
A0A3P9ILF6_MCL1-01      ----------------atgtccgcgcgcgtgcctctgccgtccacattgg
A0A3P9ILF6_MCL1-02      ----------------atgtccgcgcgcgtgcctctgccgtccacattgg
A0A3B3IJ04_MCL1-01      ----------------atgtccgcgcgcgtgcctctgccgtccacattag
A0A3B3IJ04_MCL1-02      ----------------atgtccgcgcgcgtgcctctgccgtccacattag
A0A3P9L1F3_MCL1-01      ----------------atgtccgcgcgcgtccctctgccgtccacattag
A0A3P9L1F3_MCL1-02      ----------------atgtccgcgcgcgtccctctgccgtccacattag
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      ------------------agctggaccg------------cccgga----
A0A3B4CGU9_MCL1-01      ------------------agtcacactgatatacctcatacacggaggtc
A0A3B4CGU9_MCL1-02      ------------------agtcacactgatatacctcatacacggaggtc
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      ------------------------------------------------gg
A0A3B5PQ55_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-02      --------------------------------------------------
A0A3P9Q4I8_MCL1-01      --------------------------------------------------
A0A3P9Q4I8_MCL1-02      --------------------------------------------------
A0A3B3VM25_MCL1-01      --------------------------------------------------
A0A087X830_MCL1-01      --------------------------------------------------
A0A3B3YCD0_MCL1-01      --------------------------------------------------
A0A665TFT7_MCL1-01      tggaccggcggggccggggcctcctccgtggactctccgatccggagcga
A0A672GRK8_MCL1-01      -----gctccccatgggcgccggtgtggacactcttcacggtcacgtaga
A0A674PI93_MCL1-01      ---------ctccccgctgatcccgatggcttccagaggctccctcagcg
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      ---------------acggctctctcagtcactgccacccgcaacagcag
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      ---------------acggctctctcagtcactgccacccgcaacagcag
A0A3P8Y1W8_MCL1-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-03      --------------------------------------------------
A0A8C5CE84_MCL1-02      ggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaag
A0A8C5CE84_MCL1-03      ggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaag
A0A8C5CE84_MCL1-01      ggaactaggaaggggcaggctggtgaacaaatcgcaagacgaccaagaag
A0A8C5CE84_MCL1-04      --------------------------------------------------
W5MMB7_MCL1-01          -agcctggggccctgtccgggcgggtccgccgcccgcacggctgtcctgg
G3TVG9_MCL1-01          ----------------------------------------ggagcccagg
A0A5F8GAQ2_MCL1-03      ctcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggagg
A0A5F8GAQ2_MCL1-01      ctcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggagg
A0A5F8GAQ2_MCL1-02      ctcgccgggcgcccggggggtcgcgcggcccgcacccattggcgcggagg
A0A7N4PRP1_MCL1-01      ggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggagg
A0A7N4PRP1_MCL1-02      ggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggagg
A0A7N4PRP1_MCL1-03      ggtgccgggcgtccggggggtcgcgcggcccgcgcccattggcgcggagg
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          cgcgagggatcctgggagggtcgctcgcccctcgcccatgggcacggagg
G1PZ39_MCL1-01          --------------------------------------------ccgagg
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      --------------------------------------------------
A0A8C2MG79_MCL1-01      gctgcccggcgcgcgggtggccgtgcggccgccgcccgtgggcgccgagg
A0A8C2MG79_MCL1-02      -------------------------------------------------g
A0A8C6GJU8_MCL1-01      gctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagg
A0A8C6GJU8_MCL1-02      gctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagg
A0A8C6GJU8_MCL1-03      gctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagg
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          ggcgccggacgcccggagggtcgcgcggccggcgcccattggcgccgagc
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          cgctccggacggccggagggtcgtgcggccggcgcccattggcgccgagg
A0A8C6QA84_MCL1-01      gctgccagacgcgcggagggtcgcgcggccgccgcccattggcgccgaag
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      ggcgcaggacgcccgcagggtcgcgcggccggtgcccattggcgccgagg
A0A8C9QEN4_MCL1-01      ----------------------------------------ggcgcc----
A0A287DCH9_MCL1-01      gccgcccagcgcccgcagggtcgcgcggccggtgcccattggcgccgagg
A0A287DCH9_MCL1-02      ----------------------------------------ggcgccgagg
A0A2K5C7L5_MCL1-01      cacgcctgacgcccgg-gggtcgtgcggccgctgc---------------
H0XFB7_MCL1-01          cacgccagacgcccggagggtcgcgcggccgccgcccattggtgccgaag
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      cacgccagacgcccggagggtcgcgcggccggcgcccattggtgccgagg
A0A8B7GKA0_MCL1-02      cacgccagacgcccggagggtcgcgcggccggcgcccattggtgccgagg
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      ctcgccagacgcccggagggtcgcgcggccggcgcccattggtgccgagg
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      cacgccagaagcccggagggtcgcgcggccggctcccattggtgccgaag
A0A2K6GI15_MCL1-02      cacgccagaagcccggagggtcgcgcggccggctcccattggtgccgaag
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      ggcgcaggacgcccgaagggtcgcgcggccggcgcccattggcgccgaga
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2I3RTV4_MCL1-02      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A087WT64_MCL1-09      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2I2YJ87_MCL1-02      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2I3RTV4_MCL1-01      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2R9BPJ5_MCL1-01      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          cacgccagactcccggagggtcgcgc------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A8I5TL14_MCL1-02      cacgccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2K5I9I0_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2K6PPI3_MCL1-02      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2K6KRW9_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2K6PPI3_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A096MRS6_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2I3GB35_MCL1-01      cacaccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2I3GB35_MCL1-02      cacaccagactcccggagggtcgcgcggccgccgcccattggcgccgagg
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K5XSB2_MCL1-02      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K5W0Y7_MCL1-03      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K6ECQ5_MCL1-02      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K5LXU8_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
I7G687_MCL1-01          cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K5W0Y7_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
F7HUE9_MCL1-01          cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      cacgccagacgcccggagggtcgcgcggccgccgcccattggcgcggagg
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          cacgcctgacgcccgaagggtcgtgcggccgccgcccattggcgccgagg
A0A2K6V5X4_MCL1-02      gacgcctgacgcccggagggtcgtgcggccgccgcccattggcgccgagg
A0A2K6V5X4_MCL1-01      gacgcctgacgcccggagggtcgtgcggccgccgcccattggcgccgagg
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      cgtgcctgacgcccggagggtcgtgcggccgccgcccattggcgccgagg
A0A2K5CFB8_MCL1-01      cgtgcctgacgcccggagggtcgtgcggccgccgcccattggcgccgagg
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          cgtgcgcaaccgccggaagctttcgctgccttccccattta---------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      tgggcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A452GA25_MCL1-02      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A5PJR2_MCL1-01          tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8B9W7D1_MCL1-03      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8B9W7D1_MCL1-02      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A671G0G2_MCL1-01      cgcgccggacgcccggagggtcgcgcggccctcgcccattggcgccgaga
A0A671G0G2_MCL1-02      cgcgccggacgcccggagggtcgcgcggccctcgcccattggcgccgaga
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      ggcgcaagacgcccgaagggtcgcgcggccggtgcccattggcgccgagg
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A673TBH1_MCL1-01      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A673TBH1_MCL1-02      tgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C4L244_MCL1-01      cgcgccggactccctgagggtcgcgcggccctcccccattggcgccgagg
A0A5F5Q151_MCL1-01      cgcgccggactccctgagggtcgcgcggccctcccccattggcgccgagg
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C0DF47_MCL1-01      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      cgcggccgacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggtgccgagg
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggtgccgagg
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggtgccgagg
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggtgccgagg
Q7YRZ9_MCL1-01          cgcgcccgacgcccggagggtcgcgcggccctcgcccattggtgccgagg
A0A337S3J9_MCL1-03      cgcgcccgacgcccggagggtcgcgcggccctcgcccattggtgccgagg
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          ggcgccggacgcccggagggtcgcgcggccctcacccattggcgctgagg
A0A8C0MCZ5_MCL1-02      ggcgccggacgcccggagggtcgcgcggccctcacccattggcgctgagg
A0A8C0L4C8_MCL1-01      ggcgccggacgcccggagggtcgcgcggccctcacccattggcgctgagg
A0A8C0MCZ5_MCL1-01      ggcgccggacgcccggagggtcgcgcggccctcacccattggcgctgagg
A0A8I3P430_MCL1-01      ggcgccggacgcccggagggtcgcgcggccctcacccattggcgctgagg
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      tgcgccagatgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C3W949_MCL1-02      tgcgccagatgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8D1G1G8_MCL1-04      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A4X1SEZ6_MCL1-01      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A4X1SFB1_MCL1-01      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8D1FTD4_MCL1-01      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8D1G1G8_MCL1-02      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8D1RYD1_MCL1-01      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8D1RYD1_MCL1-02      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A4X1SEZ6_MCL1-02      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8D1FTD4_MCL1-04      tgcgccagacgcccggagggtcgcgcggccctcgcccattggcgccgagg
M3XZZ5_MCL1-01          cgcgccggacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C7BMW8_MCL1-01      cgcgccggacgcccggagggtcgcgcggccctcgcccattggcgccgagg
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      cgcgccggacgcccggagggtcgcgcggccctcgcccattggcgccgagg
G1L3L7_MCL1-01          cgcgccggacgcccggagggtcgcgcggccctcgcccattggcgccgagg
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      gttccgaaggcctcaggtcttttctcagagaggccgcgccctctgattgg
A0A803T0A4_MCL1-02      gttccgaaggcctcaggtcttttctcagagaggccgcgccctctgattgg
A0A803T0A4_MCL1-03      gttccgaaggcctcaggtcttttctcagagaggccgcgccctctgattgg
A0A670K3Y6_MCL1-01      cgcggctggggggccagcgtcttccctgaggggcccttgccgcggattgg
A0A8D0E7Q9_MCL1-01      ttcccctggccgcgcccgggcctggcggagggggcgccgctggggctgta
A0A8D0E7Q9_MCL1-02      ttcccctggccgcgcccgggcctggcggagggggcgccgctggggctgta
A0A8C5PJK5_MCL1-01      gcctctcgctttgcggccactccctcgcacgcccggccactcccccgcgc
A0A670Z5Q4_MCL1-01      --------------------------------------------------
A0A8C5WWU9_MCL1-01      ctgtgctggcctcccgccggctgcgctgaggggcctcgagcgctgattgg
A0A8C6VLE3_MCL1-01      ctctgctggcctcccgccggctgcgctgaggggcctcgagcgctgattgg
A0A8C6VLE3_MCL1-02      ctctgctggcctcccgccggctgcgctgaggggcctcgagcgctgattgg
A0A8D2IVC0_MCL1-04      --------tcctgttag---------------------------------
A0A8D2IVC0_MCL1-01      ggccctggccctgctcgggcccctggagggggcgccgcgcctgccggagc
A0A8D2IVC0_MCL1-02      ggccctggccctgctcgggcccctggagggggcgccgcgcctgccggagc
A0A8D2IVC0_MCL1-03      ggccctggccctgctcgggcccctggagggggcgccgcgcctgccggagc
A0A6I8NSR7_MCL1-01      cgccgctgattggcggaggcgccggcgcgagcccctcggcggcggccggc
A0A6I8NSR7_MCL1-02      cgccgctgattggcggaggcgccggcgcgagcccctcggcggcggccggc
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      ccgccgggggcgggtgcaggct----------------------------
A0A8B9BNC2_MCL1-01      -----cggggtcacgtacccctgtgggggtgcccaggggcttttt-----
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      -----agcaagaattgaccattttgggtcagttccatgga----------
A0A8B9VGG9_MCL1-01      -----agcaagaattgaccattttgggtcagttccatgga----------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      ctcgcggcgccccctgctcgctgctgattggctccgccgccgctccgcgc
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      gggccgttggcagggggatcccaaagagaaaccccccccgctgcagctgg
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      caccgcggggccaccggcggcagcgccgaccccccccgcgcgctgattgg
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      cgctccggggccgcccccgcccgcgccgagccgccccgcgcgctgattgg
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      gggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattgg
A0A8C2TT61_MCL1-02      gggctgtgggcctccaccggcctcgccgaagccccccgcgatcctattgg
A0A8C9EP12_MCL1-01      gggttgtgggccgccgccggccgcgccgaagccccccacgctcccattgg
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --ggcctgggccgcggggtg------------------------------
A0A672UZL1_MCL1-01      ggggcttgggccgccgggcg------------------------------
A0A8C4U2H6_MCL1-01      gtgccctgggccgccgccagtcgccccgaggtaccccgcacgctgattgg
A0A663EQJ0_MCL1-01      ggggcctgggccgccgccggtcgccctga---------------------
A0A663EQJ0_MCL1-02      ggggcctgggccgccgccggtcgccctga---------------------
A0A8B9M984_MCL1-01      gcggcctgggccgccgccggtcgccccga---------------------
A0A8B9M984_MCL1-02      gcggcctgggccgccgccggtcgccccga---------------------
A0A8C0ASR2_MCL1-01      cagaaatgagctggtttgg-------------------------------
A0A663M6G8_MCL1-01      aggggcagggctggtgcca-------------------------------
A0A8C8B1M7_MCL1-01      gggccctgcgctgctgagg-------------------------------
A0A8C0FD84_MCL1-01      tggaaacgagctgttttgg-------------------------------
A0A8D0FVP8_MCL1-01      ------------------g-------------------------------
A0A8D0G5J1_MCL1-01      gccccctgggcccctcgcgacccctcggccgagccgcgcgctctgattgg
A0A8C8RUG9_MCL1-01      gacccttggggtcccaacggtccttctgagggggctcgggcgctgattgg
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      gccgcttgggcttccaacggtcactctgaggggccccgggcgctgattgg
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      gcctcttggggttccaacggtcattctgagggggcccgggcgctgattg-
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      gcctcttggggtgccaacggtcattctgagggggcccgggcgctgattg-
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      acgcaaatgatgtcggtgcagctggatg----------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      ggacgagctgctctacgggc------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      gtacggttgacgctcactattgtttcagttgtaagtgcaca---------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      tgcctaggcctgcaactatg-------gacactcgt--------------
A0A3P8Y1W8_MCL1-04      gcctcttcgaagtccaaaatggacgttgatttagga--------------
A0A3P8Y1W8_MCL1-05      gcctcttcgaagtccaaaatggacgttgatttagga--------------
A0A6F9BEN5_MCL1-02      gcgtcaccgaagtctaaagtagatactgacttggga--------------
Q0KFR9_MCL1-01          gcgtcaccgaagtctaaagtg------gacttggga--------------
A0A673VWA7_MCL1-01      gcgtcaccgaagtctaaagtg------gacatggga--------------
A0A4W5QGT1_MCL1-01      gcgtcaccgacgtctaaagtg------gacttggga--------------
A0A8C8LPV9_MCL1-01      gcgtcaccgaagtctaaagtg------gacttggga--------------
A0A8C7LPD4_MCL1-01      gcgtcaccgaagtctaaagtg------gacttggga--------------
A0A8C7H1W6_MCL1-01      gcgtcaccgaagtctaaagtg------gacttggga--------------
A0A8C7H1W6_MCL1-02      gcgtcaccgaagtctaaagtg------gacttggga--------------
A0A4W5LP06_MCL1-01      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A4W5LP06_MCL1-02      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A674ELG3_MCL1-03      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A674ELG3_MCL1-01      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A674ELG3_MCL1-02      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A8C7PM33_MCL1-03      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A8C7PM33_MCL1-01      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A8C7PM33_MCL1-02      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A8C8CMB3_MCL1-01      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A8C8CMB3_MCL1-02      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A8C7H400_MCL1-01      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A8C7H400_MCL1-02      gcgtcaccgaagtcaaaagtggatactgacttgggt--------------
A0A1A8A7I9_MCL1-01      tcgcaactggcgccacgtta-------gactctgct--------------
A0A1A8A7I9_MCL1-03      tcgcaactggcgccacgtta-------gactctgct--------------
A0A1A8A7I9_MCL1-02      tcgcaactggcgccacgtta-------gactctgct--------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      cttcgacggcacaggcagtatttgcaagcccttcgt--------------
A0A8C7N2B4_MCL1-01      gctccttagcttacggcagcaaacactttggtgtac--------------
A0A8K9V051_MCL1-01      gctccttagcttacggcagcaaacactttggtgtac--------------
A0A674D165_MCL1-01      gcgccttagcttacgacaccacaaacttcggtgtac--------------
A0A674D1T7_MCL1-01      -----tcggcttacggcgc-------------------------------
A0A3Q2EDX8_MCL1-01      taccaatgaactccccaatg-------ggatctctt--------------
A0A6Q2XQM7_MCL1-01      ---------------------------tattttcaa--------------
A0A6Q2XQM7_MCL1-02      ---------------------------tattttcaa--------------
A0A6Q2XXK6_MCL1-01      ctgatgtcgacaccattcgaattttagtattttcaa--------------
A0A6Q2Y9Q3_MCL1-01      ctgatgtcgacaccattcgaattttagtattttcaa--------------
A0A3P8VHY5_MCL1-04      tagccttagcgtcttcgctg-------tcaacccac--------------
A0A3P8VHY5_MCL1-05      tagccttagcgtcttcgctg-------tcaacccac--------------
A0A3P8VHY5_MCL1-02      tagccttagcgtcttcgctg-------tcaacccac--------------
A0A3P8VHY5_MCL1-01      tagccttagcgtcttcgctg-------tcaacccac--------------
A0A3P8VHY5_MCL1-03      tagccttagcgtcttcgctg-------tcaacccac--------------
A0A8C2Z1X1_MCL1-01      tcgccatgggctccgctaag-------gactcccac--------------
G3PJT0_MCL1-01          tcgcaatgggctcggcgaag-------gactcccac--------------
A0A3Q3S6A5_MCL1-01      ttaccttg-------------------gactctcgc--------------
A0A3Q3S6A5_MCL1-02      ttaccttg-------------------gactctcgc--------------
A0A3Q3VP02_MCL1-01      tcgggatgggctcctgtcta-------gactctcac--------------
A0A2U9CJ81_MCL1-01      tcgccgtgggctccgtgatc-------gactcccgc--------------
A0A8D3B2J3_MCL1-05      tcgccgtgggctccatgatc-------gactcccgc--------------
A0A8D3B2J3_MCL1-03      tcgccgtgggctccatgatc-------gactcccgc--------------
A0A8D3B2J3_MCL1-04      tcgccgtgggctccatgatc-------gactcccgc--------------
A0A8D3B2J3_MCL1-01      tcgccgtgggctccatgatc-------gactcccgc--------------
A0A8D3B2J3_MCL1-02      tcgccgtgggctccatgatc-------gactcccgc--------------
A0A667YZT5_MCL1-01      tagcaatggcctccaccctg-------ga------a--------------
A0A667YZT5_MCL1-02      tagcaatggcctccaccctg-------ga------a--------------
A0A3Q3B4P5_MCL1-01      tctccattggcgcctcgcta-------ggctccgag--------------
A0A3Q3B4P5_MCL1-02      tctccattggcgcctcgcta-------ggctccgag--------------
A0A3Q1GX28_MCL1-01      tcaccatgagctcctcgata-------gacgcttgc--------------
A0A3Q1GX28_MCL1-02      tcaccatgagctcctcgata-------gacgcttgc--------------
A0A3Q3GP42_MCL1-01      tagcgatgggatcctcttta-------gcctcacaa--------------
A0A8C5H9Y5_MCL1-01      acgccatagacacgtctcta-------gactctctg--------------
A0A8C5H9Y5_MCL1-02      acgccatagacacgtctcta-------gactctctg--------------
A0A671VEU3_MCL1-02      tcgcgatgagctcgtctctg-------gactctcaa--------------
A0A671VEU3_MCL1-01      tcgcgatgagctcgtctctg-------gactctcaa--------------
A0A671VEU3_MCL1-03      tcgcgatgagctcgtctctg-------gactctcaa--------------
A0A3B4T8L9_MCL1-01      ttgccattggctctacaata-------tgttctcac--------------
A0A3B4T8L9_MCL1-02      ttgccattggctctacaata-------tgttctcac--------------
A0A3B4XKA5_MCL1-01      ttgccattggctctacatta-------tgttgtgac--------------
A0A4W6CDF4_MCL1-03      tcgccatgggctcaactata-------gactctcgc--------------
A0A4W6CDF4_MCL1-01      tcgccatgggctcaactata-------gactctcgc--------------
A0A4W6CDF4_MCL1-02      tcgccatgggctcaactata-------gactctcgc--------------
A0A3B4ZKP6_MCL1-01      tccccatggcctcccctttg-------gactcacac--------------
A0A3Q1EQB9_MCL1-01      tttccgtggcctcctctata-------gatcctcaa--------------
A0A3Q1EQB9_MCL1-02      tttccgtggcctcctctata-------gatcctcaa--------------
A0A3P8RQX7_MCL1-01      ttgccgtggcctcctccata-------gactctcac--------------
A0A3P8RQX7_MCL1-02      ttgccgtggcctcctccata-------gactctcac--------------
A0A3Q1BKL8_MCL1-01      ttgccgtggcctcctccata-------gactctcac--------------
A0A3Q1BKL8_MCL1-02      ttgccgtggcctcctccata-------gactctcac--------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      ---------ttacatcccca-------gac--------------------
A0A3Q0R633_MCL1-03      atgccacaggtacacctaaa-------gac--------------------
A0A668SNL1_MCL1-01      aaacc---tggtcttgttag-------ga---------------------
I3KXG5_MCL1-01          aaacc---tggtcttgttag-------ga---------------------
A0A669C7T2_MCL1-03      atgccacaggctcctctaaa-------gactctagc--------------
A0A668RLC9_MCL1-01      atgccacaggctcctctaaa-------gactctagc--------------
A0A669C7T2_MCL1-01      atgccacaggctcctctaaa-------gactctagc--------------
A0A669C7T2_MCL1-02      atgccacaggctcctctaaa-------gactctagc--------------
A0A3Q4HLQ8_MCL1-01      acgccacaggctcctctaaa-------gactctagc--------------
A0A3P9BVM3_MCL1-01      acgccacaggctcctctaaa-------gactctagc--------------
A0A3P8NP63_MCL1-02      acgccacaggctcctctaaa-------gactctagc--------------
A0A3P8NP63_MCL1-01      acgccacaggctcctctaaa-------gactctagc--------------
A0A3P8NP63_MCL1-03      acgccacaggctcctctaaa-------gactctagc--------------
A0A3Q2VNL8_MCL1-01      acgccacaggctcctctaaa-------gactctagc--------------
A0A3B4G4Z6_MCL1-01      acgccacaggctcctctaaa-------gactctagc--------------
A0A8C9XY04_MCL1-01      ttgcaatgggctcatctaaa-------gaatctcac--------------
A0A8P4G790_MCL1-01      tcgcaatgggctcttctcta-------gcctctcac--------------
A0A8P4G790_MCL1-02      tcgcaatgggctcttctcta-------gcctctcac--------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      cccgtagccccgctcaaagcgaaaagcg----------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      ggaaaagcattttgcagtgtctcgattcgtctgcaagagccgcaaacaca
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      cctcgcgcggcgctaatcccgacccgtccgaacagatgaaaagac-----
A0A3B3CEX1_MCL1-02      cctcgcgcggcgctaatcccgacccgtccgaacagatgaaaagac-----
A0A8C7X109_MCL1-01      cctctcgcgtggcaaaccccgacccgtccgatccgatcaaaagac-----
A0A3P9ILF6_MCL1-01      cctctcgcgtggcaaatcccgacccgtccgatcagttcaaaagac-----
A0A3P9ILF6_MCL1-02      cctctcgcgtggcaaatcccgacccgtccgatcagttcaaaagac-----
A0A3B3IJ04_MCL1-01      cctctcacgtggcaaaccccgacccgtccgatcagctcaaaagac-----
A0A3B3IJ04_MCL1-02      cctctcacgtggcaaaccccgacccgtccgatcagctcaaaagac-----
A0A3P9L1F3_MCL1-01      cctctcgcgtggcaaaccccgacccgtccgatcagctcaaaagac-----
A0A3P9L1F3_MCL1-02      cctctcgcgtggcaaaccccgacccgtccgatcagctcaaaagac-----
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      ----------ctcgtccggctcctccaagctgccgagcg-----------
A0A3B4CGU9_MCL1-03      ---------ccggcccgaccgcggcctgga-gggactacaggcagcgccc
A0A3B4CGU9_MCL1-01      agggaggttccagttccagctcagctcagacgggttctcctgctgctcct
A0A3B4CGU9_MCL1-02      agggaggttccagttccagctcagctcagacgggttctcctgctgctcct
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      tcgcggacaacaaaggggaccccggggacgagc-----------------
A0A3B5PQ55_MCL1-01      -----ggtcgcaatgggctccactgtagaatctcttcattcgcctaagga
A0A3B5PQ55_MCL1-02      -----ggtcgcaatgggctccactgtagaatctcttcattcgcctaagga
A0A3P9Q4I8_MCL1-01      -----agtcgcaatgggctcccgtgtagaatctcttcattcgcctatgga
A0A3P9Q4I8_MCL1-02      -----agtcgcaatgggctcccgtgtagaatctcttcattcgcctatgga
A0A3B3VM25_MCL1-01      -----agtcgcaatgggagccactgtagattctcttcattcgcctaagga
A0A087X830_MCL1-01      -----agtcgcaatgggagccactgtagattctcttcattcgcctaagga
A0A3B3YCD0_MCL1-01      -----agtcgcaatgggagccactgtagattctcttcattcgcctaagga
A0A665TFT7_MCL1-01      cgtcgccaaacgacccaccaacctggaggtgagctctaaaggcggctgcc
A0A672GRK8_MCL1-01      gacccccaagcgaccgaagaacctggatgtagctgcggtgaa--------
A0A674PI93_MCL1-01      gcaacgacagcccgaagcggcccagcaagctctccgtgatcgcacccaag
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      agacccacagccctgcaagtcaagaacgaccattcaagaaagc-------
A0A8C6SVR4_MCL1-01      --acccacagccctgcaagtcaagaacgaccattcaagaaagc-------
A0A8C6SVR4_MCL1-03      agacccacagccctgcaagtcaagaacgaccattcaagaaagc-------
A0A3P8Y1W8_MCL1-01      -------------gatgagcgctgaggagtt-------------------
A0A3P8Y1W8_MCL1-02      -------------gatgagcgctgaggagtt-------------------
A0A3P8Y1W8_MCL1-03      -------------gatgagcgctgaggagtt-------------------
A0A8C5CE84_MCL1-02      gaaacggttcgctgcctagcactccggaactccagtcagaagtagacacg
A0A8C5CE84_MCL1-03      gaaacggttcgctgcctagcactccggaactccagtcagaagtagacacg
A0A8C5CE84_MCL1-01      gaaacggttcgctgcctagcactccggaactccagtcagaagtagacacg
A0A8C5CE84_MCL1-04      --------------ctcagctctgcagagct-----------------gg
W5MMB7_MCL1-01          accccatgctcaaggcggactacgccg-----------------------
G3TVG9_MCL1-01          gccccagcgtcaccgcgacccctgcgaggcccatgctctttgcatccatc
A0A5F8GAQ2_MCL1-03      cccccgacgtcacca---ccgatccgatgccgagcctgttcgcgccgggc
A0A5F8GAQ2_MCL1-01      cccccgacgtcacca---ccgatccgatgccgagcctgttcgcgccgggc
A0A5F8GAQ2_MCL1-02      cccccgacgtcacca---ccgatccgatgccgagcctgttcgcgccgggc
A0A7N4PRP1_MCL1-01      ctcgcgacgtcaccg---ccccgccgagaccgttctttttcgcgccgggc
A0A7N4PRP1_MCL1-02      ctcgcgacgtcaccg---ccccgccgagaccgttctttttcgcgccgggc
A0A7N4PRP1_MCL1-03      ctcgcgacgtcaccg---ccccgccgagaccgttctttttcgcgccgggc
H0XHA5_MCL1-01          --------------------------------------------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          gtcccgatggcaccgcggcccctgccaggtggctgttct---cgcccatc
G1PZ39_MCL1-01          gccccgacgtcatcgggacccttc--gcgcggcggctgtttgcgcccctt
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      ---------------------------------------------ccggg
A0A8C2MG79_MCL1-01      accccgacgtcaccgcgtcggccgagaggcggctgctccggtcgcccggc
A0A8C2MG79_MCL1-02      accccgacgtcaccgcgtcggccgagaggcggctgctccggtcgcccggc
A0A8C6GJU8_MCL1-01      accccgacgtcaccgcgtcggccgaaaggcggctgcataagtcgcccggc
A0A8C6GJU8_MCL1-02      accccgacgtcaccgcgtcggccgaaaggcggctgcataagtcgcccggc
A0A8C6GJU8_MCL1-03      accccgacgtcaccgcgtcggccgaaaggcggctgcataagtcgcccggc
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          tccccgacgtcagcgcgacccccgcgaggctgctgtacttggcgcccacc
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          gccccgacgtcactgcgattcccgcgaggccgacgttctttgcgcccacc
A0A8C6QA84_MCL1-01      tccccgacgtcaccgcgacccccgagaagctgatgctcttc---ccagcg
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      tccccgacgtcaccgcgaccccgccgaggcgactctttttcgcgcccacc
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      tccccgacgtcaccgcgaccccggcgaggcgactctttttcgcgcccacc
A0A287DCH9_MCL1-02      tccccgacgtcaccgcgaccccggcgaggcgactctttttcgcgcccacc
A0A2K5C7L5_MCL1-01      --------------------------------tggttcttcgcgcccacc
H0XFB7_MCL1-01          tccccgacgtcaccgcgacccccacgaggctgctgttcttcgcgcccacc
A0A8C9AD42_MCL1-01      --------------------------------------------------
A0A8B7GKA0_MCL1-01      tccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacc
A0A8B7GKA0_MCL1-02      tccccgacgtcaccgcgacccccgagaggctgctgttcttcgcgcccacc
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      tccccgacgtcaccgcgacccccgaaaggctgctgtttttcgcgcccacc
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      tccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacc
A0A2K6GI15_MCL1-02      tccccgacgtcaccgcgaccccggagaggctgctgttcttcgcgcccacc
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      tccccgacgtcactgcgacccctgcgaggctgctgttcttcgcgcccacc
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacc
A0A2I3RTV4_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacc
A0A087WT64_MCL1-09      tccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacc
A0A2I2YJ87_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2I3RTV4_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacc
A0A2R9BPJ5_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacc
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          --------------------------------------------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      tccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacc
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      tccccgacgtcaccgcgacccccgcgaggctgcttttcttcgcgcccacc
B4DG83_MCL1-01          --------------------------------------------------
A0A8I5TL14_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcgcccacc
A0A8I5TL14_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgtttttcttcgcgcccacc
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5I9I0_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      tccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacc
A0A2K6PPI3_MCL1-02      tccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacc
A0A2K6KRW9_MCL1-01      tccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacc
A0A2K6PPI3_MCL1-01      tccccgacgtcaccgggacccccgcgaggctgcttttctttgcgcccacc
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      tccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacc
A0A096MRS6_MCL1-01      tccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacc
A0A2I3GB35_MCL1-01      tctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacc
A0A2I3GB35_MCL1-02      tctccgacgtcactgcgacccccgcgaggctgcttttcttcgctcccacc
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5XSB2_MCL1-02      tccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacc
A0A2K5W0Y7_MCL1-03      tccccgacgtcaccgcgagccccgcgagg------ttctttgcgcccacc
A0A2K6ECQ5_MCL1-02      tccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacc
A0A2K5LXU8_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
I7G687_MCL1-01          tccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacc
A0A2K5W0Y7_MCL1-01      tccccgacgtcaccgcgagccccgcgagg------ttctttgcgcccacc
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      tccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacc
F7HUE9_MCL1-01          tccccgacgtcaccgcgagccccgcgaggctgcttttctttgcgcccacc
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgcttttctttgcgcccacc
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      tccccgacgtcaccgcgacccccgcgaggctgtttttctttgcgcccacc
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      tccccgacgtcaccgcgacccccgcgaggccgcttttctttgcgcccacc
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          tccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacc
A0A2K6V5X4_MCL1-02      tccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacc
A0A2K6V5X4_MCL1-01      tccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacc
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      tccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacc
A0A2K5CFB8_MCL1-01      tccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacc
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A452GA25_MCL1-02      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A5PJR2_MCL1-01          gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A8B9W7D1_MCL1-03      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A8B9W7D1_MCL1-02      gccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccaca
A0A671G0G2_MCL1-01      gccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctcc
A0A671G0G2_MCL1-02      gccccgacgtcacggcgacccccgcgaggcggctgttcttcgcgccctcc
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      tccccgacgtcaccgcgaccccggcgaggcgactgttcttcgcgcccacc
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      gccccgacgtcacggctacctccccgaagctgctgttctatgcggccacc
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      gccccgacgtcacggctacctccccgaagctgctgttctatgcggccacc
A0A673TBH1_MCL1-01      gccccgacgtcacggctacctccccgaagctgctgttctatgcggccacc
A0A673TBH1_MCL1-02      gccccgacgtcacggctacctccccgaagctgctgttctatgcggccacc
A0A8C4L244_MCL1-01      gccccgacgtcaccgcgcccccctccaggctgcgtttcttcgcgcccacc
A0A5F5Q151_MCL1-01      gccccgacgtcaccgcgccctcctccaggctgctgttcttcgcgcccacc
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      gccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacc
A0A8C0DF47_MCL1-01      gccccgacgtcaccgcgacccccgctaggctgctgttcttcgcgcccacc
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      gccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacc
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      gccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacc
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      gccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacc
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      gccccgacgtcaccgcgacccctccgaagctgctgttcttcgcggccacc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      gccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacc
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      gccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacc
Q7YRZ9_MCL1-01          gccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacc
A0A337S3J9_MCL1-03      gccccgacgtcaccgcgacccccccgaagctgctgttcttcgcggccacc
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          gccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccc
A0A8C0MCZ5_MCL1-02      gccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccc
A0A8C0L4C8_MCL1-01      gccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccc
A0A8C0MCZ5_MCL1-01      gccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccc
A0A8I3P430_MCL1-01      gccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccc
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      gcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacc
A0A8C3W949_MCL1-02      gcccagacgtcaccgcgacccccgccagactggtgttcttcgcgcccacc
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A8D1G1G8_MCL1-04      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A4X1SEZ6_MCL1-01      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A4X1SFB1_MCL1-01      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A8D1FTD4_MCL1-01      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A8D1G1G8_MCL1-02      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A8D1RYD1_MCL1-01      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A8D1RYD1_MCL1-02      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A4X1SEZ6_MCL1-02      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
A0A8D1FTD4_MCL1-04      gccccgacgtcaccgcgacccccgccagactgctgttcttcgcgcccacc
M3XZZ5_MCL1-01          gccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacc
A0A8C7BMW8_MCL1-01      gccccaacgtcaccgcgacccccccgaggctgctgttcttcgagcctacc
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      gtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacc
G1L3L7_MCL1-01          gtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacc
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      cggggggcctcgcgccggacccctgagggcgctgattggcccctgggagg
A0A803T0A4_MCL1-02      cggggggcctcgcgccggacccctgagggcgctgattggcccctgggagg
A0A803T0A4_MCL1-03      cggggggcctcgcgccggacccctgagggcgctgattggcccctgggagg
A0A670K3Y6_MCL1-01      ctcaggggcgcccctggcggggcccctggcgcggattgggcccttcgaag
A0A8D0E7Q9_MCL1-01      caggcccctggagggggcgccccggccccgagcggcgccgcccgcccggg
A0A8D0E7Q9_MCL1-02      caggcccctggagggggcgccccggccccgagcggcgccgcccgcccggg
A0A8C5PJK5_MCL1-01      ttaaaactggttggcttgcagtttcccgcgctgtctgctcagatcattat
A0A670Z5Q4_MCL1-01      --------tgcaggcaggtccccctccccccatt----------------
A0A8C5WWU9_MCL1-01      cggagggtcgcgcgcagggcccctctcgctgattgggcccccggacgcgg
A0A8C6VLE3_MCL1-01      cggagggccgcgcgcagggcccctctcgctgattgggaccagggacgcgg
A0A8C6VLE3_MCL1-02      cggagggccgcgcgcagggcccctctcgctgattgggaccagggacgcgg
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      ccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccg--------
A0A8D2IVC0_MCL1-02      ccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccg--------
A0A8D2IVC0_MCL1-03      ccgcgcgcgcctgcccgcggcccgccgcgctcccgctgcccg--------
A0A6I8NSR7_MCL1-01      ctgggggtcgcgcgcccggcccccattggcgccgagggccctgacgtcat
A0A6I8NSR7_MCL1-02      ctgggggtcgcgcgcccggcccccattggcgccgagggccctgacgtcat
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      ---------------------ttttgg-----------------------
A0A8B9EU67_MCL1-01      ---------------------ccgccg-----------------------
A0A493U0E8_MCL1-01      ---------------------attcag-----------------------
A0A8B9VGG9_MCL1-01      ---------------------attcag-----------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      tcgctgattggctccgccgctccgccg-----------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      cgtgcggctctgctcactagcaggatgctcggctcgaaggcagcc-----
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      t--cgaggcgcggcgccgcgctcgctgattggctgcggcgcgact-----
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      c--tgcggcgccgcgccccgcgcgctgattggctgcggcgcgact-----
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          ---------gtgtcctctcact----------------------------
A0A8C2TT61_MCL1-01      c--tccggggctgccccccactctccgattggctccggggctgcccccca
A0A8C2TT61_MCL1-02      c--tccggggctgccccccactctccgattggctccggggctgcccccca
A0A8C9EP12_MCL1-01      c--tccgaggcggccccccactctctgactggctccgaggaggccccccg
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------ctccgaggcgctgctgggctgcggcccggtcccgc-
A0A672UZL1_MCL1-01      --------------cgctgaggcgctgctgggctgcggcgcggccccgc-
A0A8C4U2H6_MCL1-01      c--caggccgcagccccccgctcgctgattggctgcggcgcggcccc---
A0A663EQJ0_MCL1-01      ---------gca--cccccgcgcgctggttggctgcggcgcggcccc---
A0A663EQJ0_MCL1-02      ---------gca--cccccgcgcgctggttggctgcggcgcggcccc---
A0A8B9M984_MCL1-01      ---------gca--cccccgcgcgctggttggctgcggcgcggcccc---
A0A8B9M984_MCL1-02      ---------gca--cccccgcgcgctggttggctgcggcgcggcccc---
A0A8C0ASR2_MCL1-01      ------------------------------gtct----------------
A0A663M6G8_MCL1-01      ------------------------------ggctgc--------------
A0A8C8B1M7_MCL1-01      ------------------------------ggctgctgcacggggct---
A0A8C0FD84_MCL1-01      ------------------------------ggct----------------
A0A8D0FVP8_MCL1-01      ------------------------------tgct----------------
A0A8D0G5J1_MCL1-01      cggggcgctgccgcgcgagggtcccccggctgaggagccccgcgctctga
A0A8C8RUG9_MCL1-01      tcaggagccccag------------------gaggggccccgggcgctga
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      cgaggcgccccgc------------------gcgcggagcagctcccc--
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      -----------------------------------------gctcccc--
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      -----------------------------------------gctcccc--
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01      --------------------------------------------------
A0A673MXF5_MCL1-01      --------------------------------------------------
A0A3B3R4U0_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-01      --------------------------------------------------
A0A3B4C341_MCL1-02      --------------------------------------------------
A0A3B4C341_MCL1-03      --------------------------------------------------
A0A3B1K5R1_MCL1-01      --------------------------------------------------
A0A8B9JW80_MCL1-01      --------------------------------------------------
A0A3B3SG34_MCL1-01      ccctgtctggagtcctccgggttatggg----------------------
A0A8C1YDY0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-03      --------------------------------------------------
A0A673GSK0_MCL1-01      --------------------------------------------------
A0A673GSK0_MCL1-02      --------------------------------------------------
A0A671LEY4_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A671LAP7_MCL1-01      --------------------------------------------------
A0A673HSI2_MCL1-01      --------------------------------------------------
A0A4W4F1X6_MCL1-01      --------------------------------------------------
Q568V1_MCL1-01          --------------------------------------------------
Q1L8X3_MCL1-01          --------------------------------------------------
Q9I9N3_MCL1-01          --------------------------------------------------
A0A3B3CEX1_MCL1-01      --------------------------------------------------
A0A3B3CEX1_MCL1-02      --------------------------------------------------
A0A8C7X109_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-01      --------------------------------------------------
A0A3P9ILF6_MCL1-02      --------------------------------------------------
A0A3B3IJ04_MCL1-01      --------------------------------------------------
A0A3B3IJ04_MCL1-02      --------------------------------------------------
A0A3P9L1F3_MCL1-01      --------------------------------------------------
A0A3P9L1F3_MCL1-02      --------------------------------------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A8C9WE28_MCL1-01      --------------------------------------------------
A0A3B4CGU9_MCL1-03      ggacccgct-----------------------------------------
A0A3B4CGU9_MCL1-01      gaactcactcacgtccaggtcaacagcattagcatt--------------
A0A3B4CGU9_MCL1-02      gaactcactcacgtccaggtcaacagcattagcatt--------------
H3AR18_MCL1-01          --------------------------------------------------
H3AR18_MCL1-02          --------------------------------------------------
A0A8C4BCS5_MCL1-01      --------------------------------------------------
A0A3B5PQ55_MCL1-01      tcccttcatgaaacgcccgacgaatc------------------------
A0A3B5PQ55_MCL1-02      tcccttcatgaaacgcccgacgaatc------------------------
A0A3P9Q4I8_MCL1-01      tcccttcaagaaacgcccgacgaatc------------------------
A0A3P9Q4I8_MCL1-02      tcccttcaagaaacgcccgacgaatc------------------------
A0A3B3VM25_MCL1-01      tccctacaagcaacgcccgacgaatc------------------------
A0A087X830_MCL1-01      tccctacaagaaacgcccgacgaatc------------------------
A0A3B3YCD0_MCL1-01      tccctacaagcaacgcccgacgaatc------------------------
A0A665TFT7_MCL1-01      cgccga--------------------------------------------
A0A672GRK8_MCL1-01      --------------------------------------------------
A0A674PI93_MCL1-01      gtttgcgtggcgaaggccatccagg-------------------------
J7H260_MCL1-01          --------------------------------------------------
A0A3B1IEV7_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-02      --------------------------------------------------
A0A8C6SVR4_MCL1-01      --------------------------------------------------
A0A8C6SVR4_MCL1-03      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      -----------------agatgcgctgg----------------------
A0A3P8Y1W8_MCL1-02      -----------------agatgcgctgg----------------------
A0A3P8Y1W8_MCL1-03      -----------------agatgcgctgg----------------------
A0A8C5CE84_MCL1-02      gacagccaggcgggggaagaagtgttggataacgacaccaagcgaatcat
A0A8C5CE84_MCL1-03      gacagccaggcgggggaagaagtgttggataacgacaccaagcgaatcat
A0A8C5CE84_MCL1-01      gacagccaggcgggggaagaagtgttggataacgacaccaagcgaatcat
A0A8C5CE84_MCL1-04      aacagctgg-----------------------------------------
W5MMB7_MCL1-01          --------------------------------------------------
G3TVG9_MCL1-01          ccctgcacgtcgccgcctgaggaggcgaatgcctca--------------
A0A5F8GAQ2_MCL1-03      cgctgctcgtcggcgcccgccgaggtggccgatggg--------------
A0A5F8GAQ2_MCL1-01      cgctgctcgtcggcgcccgccgaggtggccgatggg--------------
A0A5F8GAQ2_MCL1-02      cgctgctcgtcggcgcccgccgaggtggccgatggg--------------
A0A7N4PRP1_MCL1-01      ggccgctgctcgccccccgccgaggtggccgatgga--------------
A0A7N4PRP1_MCL1-02      ggccgctgctcgccccccgccgaggtggccgatgga--------------
A0A7N4PRP1_MCL1-03      ggccgctgctcgccccccgccgaggtggccgatgga--------------
H0XHA5_MCL1-01          ------------ctaccagaccagatggaagcccaa--------------
A0A8C8YP84_MCL1-01      --------------------------------------------------
G1QAV8_MCL1-01          agccg---gaattgccctgaagagctgggagctctg--------------
G1PZ39_MCL1-01          ggctgtgcggggctgcccgcggagatggaaagccgcg-------------
A0A8I5ZM43_MCL1-01      --------------------------------------------------
A0A8I5Y8B7_MCL1-01      --------------------------------------------------
A0A8C8UMK7_MCL1-01      ctcct---------------------------------------------
A0A8C2MG79_MCL1-01      ctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctc
A0A8C2MG79_MCL1-02      ctcctcgccgtgccgcccgaggagatggccgcgccggcctccgcctcctc
A0A8C6GJU8_MCL1-01      ctcctcgccgtgccgcccgaggagatggccgcgtcg--------------
A0A8C6GJU8_MCL1-02      ctcctcgccgtgccgcccgaggagatggccgcgtcg--------------
A0A8C6GJU8_MCL1-03      ctcctcgccgtgccgcccgaggagatggccgcgtcg--------------
A0A2K6F6N9_MCL1-01      --------------------------------------------------
A0A2K5DMS4_MCL1-01      --------------------------------------------------
A0A286Y1M5_MCL1-01      --------------------------------------------------
G1T2Q0_MCL1-01          cgccgcgcgtcgccgctcgaggagatggaagccccg--------------
G1T2Q0_MCL1-02          --------------------------------------------------
G3T756_MCL1-01          cgccgcgcgtcgccgcctgtggagatggaggctcta--------------
A0A8C6QA84_MCL1-01      ggtcgtgcgtcgccgcctgaggacatggccgcgccg--------------
A0A8C5VC33_MCL1-01      --------------------------------------------------
A0A8D2KCB0_MCL1-01      tactgcgtgtcgccgcctgagaagatggaagccccc--------------
A0A8C9QEN4_MCL1-01      --------------------------------------------------
A0A287DCH9_MCL1-01      tactgcgtgtcgccgcctgagaagatggaagccccc--------------
A0A287DCH9_MCL1-02      tactgcgtgtcgccgcctgagaagatggaagccccc--------------
A0A2K5C7L5_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
H0XFB7_MCL1-01          ctccgtgcggcgccgcgggaggagatggaagcccct--------------
A0A8C9AD42_MCL1-01      ------------------------atggga-----t--------------
A0A8B7GKA0_MCL1-01      cgccgcgcggtgccgcctgaggagatggaagcccct--------------
A0A8B7GKA0_MCL1-02      cgccgcgcggtgccgcctgaggagatggaagcccct--------------
A0A8B7GKA0_MCL1-03      --------------------------------------------------
A0A8C9AD42_MCL1-02      cgccgcgcgttgccgtccgaggagatggaggcccct--------------
A0A8C9AD42_MCL1-03      --------------------------------------------------
A0A2K6GI15_MCL1-01      cgccgcgcattgccgtccgaggagatggaagcccct--------------
A0A2K6GI15_MCL1-02      cgccgcgcattgccgtccgaggagatggaagcccct--------------
A0A2K6GI15_MCL1-03      --------------------------------------------------
A0A2K5EPX0_MCL1-01      --------------------------------------------------
A0A2K5EPX0_MCL1-02      --------------------------------------------------
A0A8C0WJK2_MCL1-01      cgccgtgcgtcgacgcctaaggagatggaagccccg--------------
G2HFR3_MCL1-01          --------------------------------------------------
C8YZ26_MCL1-01          --------------------------------------------------
A0A2I3RTV4_MCL1-04      --------------------------------------------------
A0A2R9BPJ5_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2I3RTV4_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A087WT64_MCL1-09      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2I2YJ87_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2I3RTV4_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2R9BPJ5_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2R9BPJ5_MCL1-03      --------------------------------------------------
A0A2I3RTV4_MCL1-03      --------------------------------------------------
B4E3L8_MCL1-01          ------------------------atggaagccccg--------------
A0A2I2YJ87_MCL1-03      --------------------------------------------------
A0A2I2YJ87_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
B4DU51_MCL1-01          --------------------------------------------------
B4DLY8_MCL1-01          --------------------------------------------------
A0A087WT64_MCL1-06      --------------------------------------------------
A0A087WT64_MCL1-03      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A087WT64_MCL1-05      --------------------------------------------------
A0A087WT64_MCL1-07      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
B4DG83_MCL1-01          ------------------------atggaagccccg--------------
A0A8I5TL14_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A8I5TL14_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A8I5TL14_MCL1-03      --------------------------------------------------
A0A2K5I9I0_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5I9I0_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5I9I0_MCL1-03      --------------------------------------------------
A0A8C9I795_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A8C9I795_MCL1-02      --------------------------------------------------
A0A2K6KRW9_MCL1-02      cgccgcgcggcgcctcttgaggagatggaagccccg--------------
A0A2K6PPI3_MCL1-02      cgccgcgcggcgcctcttgaggagatggaagccccg--------------
A0A2K6KRW9_MCL1-01      cgccgcgcggcgcctcttgaggagatggaagccccg--------------
A0A2K6PPI3_MCL1-01      cgccgcgcggcgcctcttgaggagatggaagccccg--------------
A0A2K6KRW9_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-04      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A096MRS6_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2I3GB35_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2I3GB35_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2I3GB35_MCL1-03      --------------------------------------------------
A0A2K5LXU8_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5XSB2_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5W0Y7_MCL1-03      cgccgcgcggggccgcttgaggagatggaagccccg--------------
A0A2K6ECQ5_MCL1-02      cgccgcgcggggccgcttgaggagatggaagccccg--------------
A0A2K5LXU8_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5LXU8_MCL1-03      --------------------------------------------------
A0A0D9RZP5_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
I7G687_MCL1-01          cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5W0Y7_MCL1-01      cgccgcgcggggccgcttgaggagatggaagccccg--------------
A0A2K5W0Y7_MCL1-02      --------------------------------------------------
A0A2K6ECQ5_MCL1-01      cgccgcgcggggccgcttgaggagatggaagccccg--------------
F7HUE9_MCL1-01          cgccgcgcgtcgccgcttgaggagatggaagccccg--------------
A0A2K6ECQ5_MCL1-03      --------------------------------------------------
A0A8D2F160_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A8D2F160_MCL1-02      --------------------------------------------------
A0A2K5XSB2_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5XSB2_MCL1-03      --------------------------------------------------
A0A096MRS6_MCL1-02      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A096MRS6_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-01          cgccgcgcggcgccgctggaggagatggaagccccg--------------
A0A2K6V5X4_MCL1-02      cgccgcgcggcgccgctggaggagatggaagccccg--------------
A0A2K6V5X4_MCL1-01      cgccgcgcggcgccgctggaggagatggaagccccg--------------
A0A2K6V5X4_MCL1-03      --------------------------------------------------
F7GTF7_MCL1-02          --------------------------------------------------
A0A2K5CFB8_MCL1-03      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5CFB8_MCL1-01      cgccgcgcggcgccgcttgaggagatggaagccccg--------------
A0A2K5CFB8_MCL1-02      --------------------------------------------------
A0A8C0CVU0_MCL1-01      --------------------------------------------------
W5QI41_MCL1-01          --------------------------------------------------
F1MQX4_MCL1-01          --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2CQV1_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A4W2G6Q5_MCL1-01      --------------------------------------------------
A0A8C6E5E6_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8C6E5E6_MCL1-02      --------------------------------------------------
A0A452GA25_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A452GA25_MCL1-02      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A5PJR2_MCL1-01          cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8B9W7D1_MCL1-03      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8B9W7D1_MCL1-04      --------------------------------------------------
A0A8B9W7D1_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8B9W7D1_MCL1-02      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A671G0G2_MCL1-01      ttccgcgcgtcgccgcttaaggagatggaagccccg--------------
A0A671G0G2_MCL1-02      ttccgcgcgtcgccgcttaaggagatggaagccccg--------------
A0A671G0G2_MCL1-03      --------------------------------------------------
A0A8D2AJ70_MCL1-01      tactgcgtgtcgccgccggaggagatggaagccccc--------------
A0A8D2AJ70_MCL1-02      --------------------------------------------------
A0A673TBH1_MCL1-04      cgctgtgcgtcgccgcctgaagagatggaaggcccc--------------
A0A673TBH1_MCL1-05      --------------------------------------------------
A0A673TBH1_MCL1-03      cgctgtgcgtcgccgcctgaagagatggaaggcccc--------------
A0A673TBH1_MCL1-01      cgctgtgcgtcgccgcctgaagagatggaaggcccc--------------
A0A673TBH1_MCL1-02      cgctgtgcgtcgccgcctgaagagatggaaggcccc--------------
A0A8C4L244_MCL1-01      cgctgcgcgtcgccgcctgaggggatggaagccccg--------------
A0A5F5Q151_MCL1-01      cgctgcgcgtcgccgcctgaggggatggaagccccg--------------
A0A5F5Q151_MCL1-02      --------------------------------------------------
A0A8C0DF47_MCL1-02      cgccgcgcctcgccgcccgaagagatggaatcctcg--------------
A0A8C0DF47_MCL1-01      cgccgcgcctcgccgcccgaagagatggaatcctcg--------------
A0A8C0DF47_MCL1-03      --------------------------------------------------
A0A4V5P8C2_MCL1-01      cgccgcgcctcgccgcccgaagagatggaatcctcg--------------
A0A4V5P8C2_MCL1-02      --------------------------------------------------
A0A8C9BA52_MCL1-01      cgccgcgcctcgccgcccgaagagatggaatcctcg--------------
A0A8C9BA52_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-02      cgctgtgcgtcgccgcctgaaaagatggaaggccca--------------
A0A8C9K7H4_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      cgctgtgcgtcgccgcctgaaaagatggaaggccca--------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A667GXX5_MCL1-01      cgctgtgcgtcgccgcctgaaaagatggaaggccca--------------
A0A667GXX5_MCL1-02      --------------------------------------------------
A0A337S3J9_MCL1-01      cgctgtgcgtcgccgcctgaaaagatggaaggccca--------------
Q7YRZ9_MCL1-01          cgctgtgcgtcgccgcctgaagagatggaaggccca--------------
A0A337S3J9_MCL1-03      cgctgtgcgtcgccgcctgaaaagatggaaggccca--------------
A0A337S3J9_MCL1-04      --------------------------------------------------
Q8HYS5_MCL1-01          tgccgcgcgtcgccgcctgaagagatggaaggcccg--------------
A0A8C0MCZ5_MCL1-02      tgccgcgcgtcgccgcctgaagagatggaaggcccg--------------
A0A8C0L4C8_MCL1-01      tgccgcgcgtcgccgcctgaagagatggaaggcccg--------------
A0A8C0MCZ5_MCL1-01      tgccgcgcgtcgccgcctgaagagatggaaggcccg--------------
A0A8I3P430_MCL1-01      tgccgcgcgtcgccgcctgaagagatggaaggcccg--------------
A0A8I3P430_MCL1-02      --------------------------------------------------
A0A8C3W949_MCL1-01      cgcctcgcgtcgccgcccgaagagatggactccccg--------------
A0A8C3W949_MCL1-02      cgcctcgcgtcgccgcccgaagagatggactccccg--------------
A0A8C3W949_MCL1-03      --------------------------------------------------
Q95KR3_MCL1-01          --------------------------------------------------
A0A8D1FTD4_MCL1-03      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8D1G1G8_MCL1-04      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A4X1SEZ6_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A4X1SFB1_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8D1FTD4_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8D1G1G8_MCL1-02      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8D1RYD1_MCL1-01      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A4X1SEU3_MCL1-02      --------------------------------------------------
A0A4X1SEZ6_MCL1-03      --------------------------------------------------
A0A4X1SFB1_MCL1-02      --------------------------------------------------
A0A8D1FTD4_MCL1-05      --------------------------------------------------
A0A8D1G1G8_MCL1-01      --------------------------------------------------
A0A8D1RYD1_MCL1-03      --------------------------------------------------
A0A4X1SEU3_MCL1-01      nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn--------------
A0A8D1G1G8_MCL1-03      --------------------------------------------------
A0A8D1FTD4_MCL1-02      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8D1RYD1_MCL1-02      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A4X1SEZ6_MCL1-02      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
A0A8D1FTD4_MCL1-04      cgcctcgcgtcgccgcctgaagagatggaatccccg--------------
M3XZZ5_MCL1-01          caccgcgcgtcgccgcctgaagagatggaaggccca--------------
A0A8C7BMW8_MCL1-01      cgccgcgcgtcgccgcctgaagagatggaaggccca--------------
A0A8C7BMW8_MCL1-02      --------------------------------------------------
A0A452RHX5_MCL1-01      cgccgcgcgtcgccgcctgaagagatggaaggccca--------------
G1L3L7_MCL1-01          cgccgcgcgtcgccgcctgaagagatggaaggccca--------------
G1L3L7_MCL1-02          --------------------------------------------------
A0A803T0A4_MCL1-01      ggtctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaa
A0A803T0A4_MCL1-02      ggtctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaa
A0A803T0A4_MCL1-03      ggtctcagcgggcgctgattggctgcgacgctgagggagaaggagagcaa
A0A670K3Y6_MCL1-01      tagcgccccgcgcgctgattggctcccccgccgcggcggccgttggcggc
A0A8D0E7Q9_MCL1-01      aaggaggaggaggaggaggaggag--------------------------
A0A8D0E7Q9_MCL1-02      aaggaggaggaggaggaggaggag--------------------------
A0A8C5PJK5_MCL1-01      caagatggaggcaggaaaggtggctgttgcgatggcactgagagaaaaag
A0A670Z5Q4_MCL1-01      ---tgcaggaaatgaccagaca----------------------------
A0A8C5WWU9_MCL1-01      acgcgcgcgcgctgattggccaggcggcactgccgccggcgacccccg--
A0A8C6VLE3_MCL1-01      ccgcgcgcgcactgattggtca---ggcatcggcggcgacgacccccg--
A0A8C6VLE3_MCL1-02      ccgcgcgcgcactgattggtca---ggcatcggcggcgacgacccccg--
A0A8D2IVC0_MCL1-04      --------------------------------------------------
A0A8D2IVC0_MCL1-01      --------------------------------------------------
A0A8D2IVC0_MCL1-02      --------------------------------------------------
A0A8D2IVC0_MCL1-03      --------------------------------------------------
A0A6I8NSR7_MCL1-01      cgggaccctcgcgcccgcccggcgcgcgccgcctgaggggacggagccgc
A0A6I8NSR7_MCL1-02      cgggaccctcgcgcccgcccggcgcgcgccgcctgaggggacggagccgc
A0A8C9NTQ6_MCL1-01      --------------------------------------------------
A0A8D2MBY7_MCL1-01      --------------------------------------------------
A0A8C6YT47_MCL1-01      --------------------------------------------------
A0A8B9BNC2_MCL1-01      --------------------------------------------------
A0A8B9EU67_MCL1-01      --------------------------------------------------
A0A493U0E8_MCL1-01      --------------------------------------------------
A0A8B9VGG9_MCL1-01      --------------------------------------------------
A0A8B9SWV2_MCL1-01      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------
A0A8C4K2K9_MCL1-01      --------------------------------------------------
A0A8B9P3N9_MCL1-01      ------------------------------ggatttgggatgcgtcgagg
A0A8C3UEV5_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-01      --------------------------------------------------
A0A674HQK4_MCL1-02      --------------------------------------------------
A0A8C0UE15_MCL1-01      --------------------------------------------------
A0A8C3QRB8_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-01      --------------------------------------------------
A0A8D2NMF1_MCL1-02      --------------------------------------------------
G1MPY7_MCL1-01          --------------------------------------------------
A0A8C2TT61_MCL1-01      ctctccgattggttccgagtttgccccccactctctgattggtcccgcca
A0A8C2TT61_MCL1-02      ctctccgattggttccgagtttgccccccactctctgattggtcccgcca
A0A8C9EP12_MCL1-01      cgctccgattggtt------------------------------ccgccg
A0A669R428_MCL1-01      --------------------------------------------------
A0A8B9GMI8_MCL1-01      --------------------------------------------------
A0A672UZL1_MCL1-01      --------------------------------------------------
A0A8C4U2H6_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-01      --------------------------------------------------
A0A663EQJ0_MCL1-02      --------------------------------------------------
A0A8B9M984_MCL1-01      --------------------------------------------------
A0A8B9M984_MCL1-02      --------------------------------------------------
A0A8C0ASR2_MCL1-01      --------------------------------------------------
A0A663M6G8_MCL1-01      --------------------------------------------------
A0A8C8B1M7_MCL1-01      --------------------------------------------------
A0A8C0FD84_MCL1-01      --------------------------------------------------
A0A8D0FVP8_MCL1-01      --------------------------------------------------
A0A8D0G5J1_MCL1-01      ttggcaggggggccccggccgaggcgccccgcgtcctgattggcggcggc
A0A8C8RUG9_MCL1-01      ttggctcccctgccccttccccggttgc----------------------
A0A8C3EZ48_MCL1-01      --------------------------------------------------
A0A674JQC4_MCL1-01      --------------------------------------------------
A0A8C3TAL3_MCL1-01      --------------------------------------------------
K7FPN7_MCL1-01          --------------------------------------------------
A0A8C3T6A5_MCL1-01      ----cacgaccccccctgcgctggtggc----------------------
A0A8C0GRW6_MCL1-01      --------------------------------------------------
A0A8C4YAJ9_MCL1-01      ----cgcagccgccccgtctctggtggc----------------------
A0A8C3H9M3_MCL1-01      --------------------------------------------------
A0A674IPL6_MCL1-01      ----cgccaccccccctgcgcggggggc----------------------
                                                                          

B6V6J0_MCL1-01          --------------------------------------------------
A0A8C4RFB4_MCL1-01      --------------------------------------------------
A0A4W4H9I6_MCL1-01      --------------------------------------------------
A0A8C9VMU9_MCL1-01      --------------------------------------------------
A0A8C5QRL7_MCL1-01      --------------------------------------------------
A0A8C9XS62_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-01      --------------------------------------------------
A0A3B4AFB7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-04      --------------------------------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A6F9BEN5_MCL1-02      --------------------------------------------------
Q0KFR9_MCL1-01          --------------------------------------------------
A0A673VWA7_MCL1-01      --------------------------------------------------
A0A4W5QGT1_MCL1-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C7LPD4_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A4W5LP06_MCL1-01      --------------------------------------------------
A0A4W5LP06_MCL1-02      --------------------------------------------------
A0A674ELG3_MCL1-03      --------------------------------------------------
A0A674ELG3_MCL1-01      --------------------------------------------------
A0A674ELG3_MCL1-02      --------------------------------------------------
A0A8C7PM33_MCL1-03      --------------------------------------------------
A0A8C7PM33_MCL1-01      --------------------------------------------------
A0A8C7PM33_MCL1-02      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A1A8A7I9_MCL1-01      --------------------------------------------------
A0A1A8A7I9_MCL1-03      --------------------------------------------------
A0A1A8A7I9_MCL1-02      --------------------------------------------------
A0A4W5KYB3_MCL1-01      --------------------------------------------------
A0A4W5LZB2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-01      --------------------------------------------------
A0A4W5Q5Q2_MCL1-02      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8K9V051_MCL1-01      --------------------------------------------------
A0A674D165_MCL1-01      --------------------------------------------------
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A3Q2EDX8_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      --------------------------------------------------
A0A3P8VHY5_MCL1-05      --------------------------------------------------
A0A3P8VHY5_MCL1-02      --------------------------------------------------
A0A3P8VHY5_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-03      --------------------------------------------------
A0A8C2Z1X1_MCL1-01      --------------------------------------------------
G3PJT0_MCL1-01          --------------------------------------------------
A0A3Q3S6A5_MCL1-01      --------------------------------------------------
A0A3Q3S6A5_MCL1-02      --------------------------------------------------
A0A3Q3VP02_MCL1-01      --------------------------------------------------
A0A2U9CJ81_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-05      --------------------------------------------------
A0A8D3B2J3_MCL1-03      --------------------------------------------------
A0A8D3B2J3_MCL1-04      --------------------------------------------------
A0A8D3B2J3_MCL1-01      --------------------------------------------------
A0A8D3B2J3_MCL1-02      --------------------------------------------------
A0A667YZT5_MCL1-01      --------------------------------------------------
A0A667YZT5_MCL1-02      --------------------------------------------------
A0A3Q3B4P5_MCL1-01      --------------------------------------------------
A0A3Q3B4P5_MCL1-02      --------------------------------------------------
A0A3Q1GX28_MCL1-01      --------------------------------------------------
A0A3Q1GX28_MCL1-02      --------------------------------------------------
A0A3Q3GP42_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-01      --------------------------------------------------
A0A8C5H9Y5_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-02      --------------------------------------------------
A0A671VEU3_MCL1-01      --------------------------------------------------
A0A671VEU3_MCL1-03      --------------------------------------------------
A0A3B4T8L9_MCL1-01      --------------------------------------------------
A0A3B4T8L9_MCL1-02      --------------------------------------------------
A0A3B4XKA5_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-03      --------------------------------------------------
A0A4W6CDF4_MCL1-01      --------------------------------------------------
A0A4W6CDF4_MCL1-02      --------------------------------------------------
A0A3B4ZKP6_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-01      --------------------------------------------------
A0A3Q1EQB9_MCL1-02      --------------------------------------------------
A0A3P8RQX7_MCL1-01      --------------------------------------------------
A0A3P8RQX7_MCL1-02      --------------------------------------------------
A0A3Q1BKL8_MCL1-01      --------------------------------------------------
A0A3Q1BKL8_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-02      --------------------------------------------------
A0A3Q0R633_MCL1-01      --------------------------------------------------
A0A3Q0R633_MCL1-03      --------------------------------------------------
A0A668SNL1_MCL1-01      --------------------------------------------------
I3KXG5_MCL1-01          --------------------------------------------------
A0A669C7T2_MCL1-03      --------------------------------------------------
A0A668RLC9_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-01      --------------------------------------------------
A0A669C7T2_MCL1-02      --------------------------------------------------
A0A3Q4HLQ8_MCL1-01      --------------------------------------------------
A0A3P9BVM3_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-02      --------------------------------------------------
A0A3P8NP63_MCL1-01      --------------------------------------------------
A0A3P8NP63_MCL1-03      --------------------------------------------------
A0A3Q2VNL8_MCL1-01      --------------------------------------------------
A0A3B4G4Z6_MCL1-01      --------------------------------------------------
A0A8C9XY04_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-01      --------------------------------------------------
A0A8P4G790_MCL1-02      --------------------------------------------------
A2BF68_MCL1-02          --------------------------------------------------
Q8UWD6_MCL1-01          --------------------------------------------------
A2BF68_MCL1-01          --------------------------------------------------
Q568W5_MCL1-01          --------------------------------------------------
A0A671RQ00_MCL1-01      --------------------------------------------------
A0A673IXK8_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      --------------------------------------------------
A0A8C1JUN1_MCL1-01      --------------------------------------------------
A0A8C1JUN1_MCL1-02      --------------------------------------------------
A0A671L9M9_MCL1-01      --------------------------------------------------
A0A672KMK1_MCL1-01 &nbs