Dataset for CDS BCL-2-like of organism Delphinapterus leucas

[Download (right click)] [Alignment] [Repertoires]

11 sequence(s)

>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=1023 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcactacaagtgaacctgtagag
atgagagtctgccaggttttctatcacagttttactggcctcatgaaacgagttggcattctttggacccggacttggaa
ttttctttctgtgttaagagcacacgtggccagaagagtggtcttctgcccagtctggaagcttggccagaggaactggt
gttcttgtgtaatgagatcatctttcaaaagtaccagacggtttttcgtccttctcacccaaacgcaacgtttcctggca
gccattccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaagtacaggatag
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=720 residues).
atggcggcgacggccgtgagcagcgccaagcggagcctgcgggccgagctgaagcggcgtctgcgggcgctgagcgccga
ggagcggctgcgccagtcccgcctcttggcccagaaggtgtttacccatagtcaatatcaaaagtccaaaagaatctcca
tctttctgagcatgcaagatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatc
ccacggtaccagttccagagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaac
atcctggaatattcatcagcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcacta
caagtgaacctgtagagatgagagtctgccaggttttctatcacagttttactggcctcatgaaacgagttggcattctt
tggacccggacttggaattttctttctgtgttaagagcacacgtggccagaagagtggtcttctgcccagtctggaagct
tggccagaggaactggtgttcttgtgtaatgagatcatctttcaaaagtaccagacggtttttcgtccttctcacccaaa
cgcaacgtttcctggcagccattccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaagtacaggatag
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=942 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcactacaagtgaacctgtagag
atgagagtctgccaggctgacccagttgaaagttgtaacagctggaggaatctctgttcgtctactcagaccagaactgg
gctcccactcgtgagtagtgccaacaaatgtgtcacttcccatttccttaaaaagctcccaaactcgggcacagtttata
gtcttgcttcacttctgctggaggagttcactacggcagattcaagctggggaaattgctaa
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=813 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacaggttctctgctttccagcactacaagtgaacctgtagag
atgagagtctgccaggtggaatcatccatttcatatccacccccaccccgccccacttactgccagccagaaaaatggga
acttaccccctga
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-05 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=915 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacagggggacttgatctcatcttcatgccgggtcttgggttt
gacaaacacggcaaccgtttggggcggggcaagggctactacgatgcctacctgaagcgctgtctgcagtcccaggatgt
gaggccctacaccctggccttggctttcaaagagcagatttgccttcaggtccccgtggatgaaaatgacatgaaggtag
atgaagtgctttacgaagactcctcagcatcttaa
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-06 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=717 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcaaggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcca
gagcaatcacatggatatggtgaaattagcatcgcctgaggaaatctcttcacttcccaaaacatcctggaatattcatc
agcccagtgaggtcgaggttcgggaggaggccttgtccacagcacacaggctttctctagttgcggcgagcgggtga
>gnl|bcl2dbcds|A0A2Y9LKR0_BCL2A1-07 BCL2-related protein A1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2A1 (length=528 residues).
atgaccgacagcgagtttggctatattcacatgctggcccaggactacctgaagtacgtcttgcagataccgcaacctgg
atctggtccaagcaaaacatccagggtgttacaagacgttgctttctcagtccaaaacgaagttgaaaagaatttgaaac
catgcttggacaatattgatgttgtgtccatagacaccgccagaacaatattcaaccaagtgatggaaagggaatttgaa
gatggcatcgttaactggggaaggattgtgaccatatttgcatttgaaggcattctcatcaagaaacttctaggagggcg
aattgccccagatgtggacacttacaaggagatttcctactttgttgcagagttcataaccaaaaacacaggagaatgga
taaggcagaatggaggctgggaaaatggctttgtaaagaagtttgaacccaagtctggctggctgacttttctggaagtt
acaggaaagatctgtgaaatattatgtctcctgaagcagtactattga
>gnl|bcl2dbcds|A0A2Y9LQ01_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccccggggagggcccagcagctgacccgctgcaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctcggatctggcagctcagctgcatgtgaccccaggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaaggggggcccaactggggccgccttgtggctttctttgtctttggagccgcgctgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagcgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2Y9MRT2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Delphinapterus leucas GN=MCL-1 (length=1056 residues).
atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgggggggccggattgggaccggatagcggcag
cggcgcctccgctccgggaaggcggcttttggctgcaggaaaggaggccacggccgggcgagaggtagggggaggggaag
ccggcgaggtgattggcggaagcgccggcccgagccccccggccactctcgcgcccgacgcccggagggtcgcgcggccc
tcgcccattggcgccgagggccccgacgtcaccgcgacccccgccaggctgctgttcttcgcgcccacccgccgcgcctc
gccgcccgaagagatggaatcctcggtctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccggagc
ctctagggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggccagtaacagcccgggcaaggacggctca
ctcccctcgacgccgcccccagcagaggaggaggaggacgagttgtaccggcagtccctggagattatctctcgatacct
ccgggagcaggcaaccggcaccaaggacgcgaagccactgggcgggtctggggccgccagccggaaagcgttagagaccc
tgcgacgggtcggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaac
gaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgac
tctcatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaa
gcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggacttcttc
catgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggc
gtatctaataagatag
>gnl|bcl2dbcds|A0A2Y9P9P5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL-2 (length=702 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcgggcgccacgtccccgggggccgcccccgcgccgggcatcttctcctcccagcctg
ggagcaccccagcgccatccaggacctccccgccgccgccccagaccgctcccgccgcccccgccagggggcctgcgctc
agccccgtgccacctgtggtccacctgaccctgcgccaggccggtgatgatttttctcgtcgctaccgccgcgacttcgc
cgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcaggg
atggagtaaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatg
tcccccctggtggacaacatcgccctgtggatgactgagtacctgaaccgacacctgcacacctggatccaggataacgg
aggctgggatgcctttgtggagctgtacggtcccagcatgcggcctctgtttgatttctcctggctgtctctgaaggcac
tgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A2Y9PZ68_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Delphinapterus leucas GN=BCL2L1 (length=702 residues).
atgtctcagagcaatcgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggacgagaacagaactgaggccccagaagggactgaatcagacatggaaacccccagtgccatcaatggca
acccgtcctggcacctggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacggcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
© 1998-2020Legal notice