Dataset for CDS BCL-2-like of organism Delphinapterus leucas

[Download (right click)] [Edit] [Sequences] [Repertoires]

11 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2Y9LKR0_BCL2A1-      atg-----------------------------------------------
A0A2Y9LKR0_BCL2A1-      at------------------------------------------------
A0A2Y9LKR0_BCL2A1-      atg-----------------------------------------------
A0A2Y9LKR0_BCL2A1-      atg-----------------------------------------------
A0A2Y9LKR0_BCL2A1-      atg-----------------------------------------------
A0A2Y9LKR0_BCL2A1-      atg-----------------------------------------------
A0A2Y9LKR0_BCL2A1-      atg-----------------------------------------------
A0A2Y9PZ68_BCL2L1-      atg-----------------------------------------------
A0A2Y9P9P5_BCL2-01      atg-gcg-------------------------------------------
A0A2Y9LQ01_BCL2L2-      atg-gcgacccca-------------------------------------
A0A2Y9MRT2_MCL1-01      atgttcggcctcaagagaaacgcagtgatcggactcaacctctactgtgg
                        **                                                

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9PZ68_BCL2L1-      ----------------------------------------tctcagagca
A0A2Y9P9P5_BCL2-01      ---------------------------------------cacgctgggag
A0A2Y9LQ01_BCL2L2-      ----------------------------------gcctcggccccagaca
A0A2Y9MRT2_MCL1-01      gggggccggattgggaccggatagcggcagcggcgcctccgctccgggaa
                                                                          

A0A2Y9LKR0_BCL2A1-      -------------------------------------accgacagcgagt
A0A2Y9LKR0_BCL2A1-      ----------------------------------------ggcggcga--
A0A2Y9LKR0_BCL2A1-      -------------------------------------accgacagcgagt
A0A2Y9LKR0_BCL2A1-      -------------------------------------accgacagcgagt
A0A2Y9LKR0_BCL2A1-      -------------------------------------accgacagcgagt
A0A2Y9LKR0_BCL2A1-      -------------------------------------accgacagcgagt
A0A2Y9LKR0_BCL2A1-      -------------------------------------accgacagcgagt
A0A2Y9PZ68_BCL2L1-      atcgggagctggtggt----tgactttc----------tctcctacaagc
A0A2Y9P9P5_BCL2-01      aacagggtatgataaccgggagatagtgatgaagtacatccactataagc
A0A2Y9LQ01_BCL2L2-      cacgggctctagtggc----agactttg----------taggctataagc
A0A2Y9MRT2_MCL1-01      ggcggcttttggctgc----aggaaaggaggccacggccgggcgagaggt
                                                                  *       

A0A2Y9LKR0_BCL2A1-      tt-------------------ggctatattca-------------catgc
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      tt-------------------ggctatattca-------------catgc
A0A2Y9LKR0_BCL2A1-      tt-------------------ggctatattca-------------catgc
A0A2Y9LKR0_BCL2A1-      tt-------------------ggctatattca-------------catgc
A0A2Y9LKR0_BCL2A1-      tt-------------------ggctatattca-------------catgc
A0A2Y9LKR0_BCL2A1-      tt-------------------ggctatattca-------------catgc
A0A2Y9PZ68_BCL2L1-      tttcccagaaa----------ggatacagctggagtcagtttagcgatgt
A0A2Y9P9P5_BCL2-01      tgtcgcagagg----------ggctacgagtgggat---gccggagacgc
A0A2Y9LQ01_BCL2L2-      tgaggcagaag----------ggttatgtttg---------tgga---gc
A0A2Y9MRT2_MCL1-01      agggggaggggaagccggcgaggtga--ttgg---------cggaagcgc
                                                                          

A0A2Y9LKR0_BCL2A1-      tggcccaggactacctgaag------------------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      tggcccaggactacctgaag------------------------------
A0A2Y9LKR0_BCL2A1-      tggcccaggactacctgaag------------------------------
A0A2Y9LKR0_BCL2A1-      tggcccaggactacctgaag------------------------------
A0A2Y9LKR0_BCL2A1-      tggcccaggactacctgaag------------------------------
A0A2Y9LKR0_BCL2A1-      tggcccaggactacctgaag------------------------------
A0A2Y9PZ68_BCL2L1-      ggacgagaacagaactgaggccccagaagggactgaa-------------
A0A2Y9P9P5_BCL2-01      gggcgccacgtccccgggggccgcccccgcgc----------------cg
A0A2Y9LQ01_BCL2L2-      tggccc--------------------------------------------
A0A2Y9MRT2_MCL1-01      cggcccgagcccccc---ggccactctcgcgcccgacgcccggagggtcg
                                                                          

A0A2Y9LKR0_BCL2A1-      --------------tacgtcttgcagatacc-------------------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      --------------tacgtcttgcagatacc-------------------
A0A2Y9LKR0_BCL2A1-      --------------tacgtcttgcagatacc-------------------
A0A2Y9LKR0_BCL2A1-      --------------tacgtcttgcagatacc-------------------
A0A2Y9LKR0_BCL2A1-      --------------tacgtcttgcagatacc-------------------
A0A2Y9LKR0_BCL2A1-      --------------tacgtcttgcagatacc-------------------
A0A2Y9PZ68_BCL2L1-      --------------tcagacatggaaacccccagtgccatcaatggcaac
A0A2Y9P9P5_BCL2-01      ggcatcttctcctcccagcctgggagcaccccagcgccatcca-------
A0A2Y9LQ01_BCL2L2-      -------------------cggggagggccc-------------------
A0A2Y9MRT2_MCL1-01      cgcggccctcgcccattggcgccgagggccccgacgtcaccgc-------
                                                                          

A0A2Y9LKR0_BCL2A1-      -------------------gcaacctggatctggtccaagcaaaacatcc
A0A2Y9LKR0_BCL2A1-      --------------------cggccgtgagcagcgccaagcggagcctgc
A0A2Y9LKR0_BCL2A1-      -------------------gcaacctggatctggtccaagcaaaacatcc
A0A2Y9LKR0_BCL2A1-      -------------------gcaacctggatctggtccaagcaaaacatcc
A0A2Y9LKR0_BCL2A1-      -------------------gcaacctggatctggtccaagcaaaacatcc
A0A2Y9LKR0_BCL2A1-      -------------------gcaacctggatctggtccaagcaaaacatcc
A0A2Y9LKR0_BCL2A1-      -------------------gcaacctggatctggtccaagcaaaacatcc
A0A2Y9PZ68_BCL2L1-      ccgtcctggcacctggcagacagccctgcggtgaatggagccactg----
A0A2Y9P9P5_BCL2-01      -------ggacctcccc--gccgccg-ccccagaccgctcccgccgccc-
A0A2Y9LQ01_BCL2L2-      ------------------agcagctg------------acccgctgcacc
A0A2Y9MRT2_MCL1-01      -------gacccccgccaggctgctgttcttcgcgcccacccgccgcgcc
                                            *  *                *         

A0A2Y9LKR0_BCL2A1-      agggtgttacaagacgttgctttctca-----------------------
A0A2Y9LKR0_BCL2A1-      ggg-----------------------------------------------
A0A2Y9LKR0_BCL2A1-      agggtgttacaagacgttgctttctca-----------------------
A0A2Y9LKR0_BCL2A1-      agggtgttacaagacgttgctttctca-----------------------
A0A2Y9LKR0_BCL2A1-      agggtgttacaagacgttgctttctca-----------------------
A0A2Y9LKR0_BCL2A1-      agggtgttacaagacgttgctttctca-----------------------
A0A2Y9LKR0_BCL2A1-      agggtgttacaagacgttgctttctca-----------------------
A0A2Y9PZ68_BCL2L1-      --gccacagcagcagcttggatgcccgggaggtgat--ccccatggca--
A0A2Y9P9P5_BCL2-01      ---ccgccagggggcctgcgct-------------cagccccgtgccacc
A0A2Y9LQ01_BCL2L2-      aagccatgcgggcagctgga------------------------------
A0A2Y9MRT2_MCL1-01      tcgccgcccgaagagatggaatcctcggtctccgacgccatcatgtcgcc
                                                                          

A0A2Y9LKR0_BCL2A1-      -------------gtccaaaacgaagttgaaaagaatttgaaaccatgct
A0A2Y9LKR0_BCL2A1-      ---------------------ccgagctgaagcg----------------
A0A2Y9LKR0_BCL2A1-      -------------gtccaaaacgaagttgaaaagaatttgaaaccatgct
A0A2Y9LKR0_BCL2A1-      -------------gtccaaaacgaagttgaaaagaatttgaaaccatgct
A0A2Y9LKR0_BCL2A1-      -------------gtccaaaacgaagttgaaaagaatttgaaaccatgct
A0A2Y9LKR0_BCL2A1-      -------------gtccaaaacgaagttgaaaagaatttgaaaccatgct
A0A2Y9LKR0_BCL2A1-      -------------gtccaaaacgaagttgaaaagaatttgaaaccatgct
A0A2Y9PZ68_BCL2L1-      -gcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggt
A0A2Y9P9P5_BCL2-01      tgtggtccacctgaccctgcgccaggccggtgatgatttttctcgtcgct
A0A2Y9LQ01_BCL2L2-      -------------gatgagttcgagac------------------ccgct
A0A2Y9MRT2_MCL1-01      cgaagaggagctggacgggtgcgagccgga--------------gcctct
                                                                          

A0A2Y9LKR0_BCL2A1-      ------------------tggacaatattgatgttgtgtc----------
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      ------------------tggacaatattgatgttgtgtc----------
A0A2Y9LKR0_BCL2A1-      ------------------tggacaatattgatgttgtgtc----------
A0A2Y9LKR0_BCL2A1-      ------------------tggacaatattgatgttgtgtc----------
A0A2Y9LKR0_BCL2A1-      ------------------tggacaatattgatgttgtgtc----------
A0A2Y9LKR0_BCL2A1-      ------------------tggacaatattgatgttgtgtc----------
A0A2Y9PZ68_BCL2L1-      -------------accggcgggcatt--cagcgacctgacatcccagctc
A0A2Y9P9P5_BCL2-01      -------------accgccgcgacttcgccgagat--gtccagccagctg
A0A2Y9LQ01_BCL2L2-      -------------tccggcgcacctt--ctcggatctggcagctcagctg
A0A2Y9MRT2_MCL1-01      agggaagcggccgtccgtcctgcctttgctggaattggtcggcgaggcca
                                                                          

A0A2Y9LKR0_BCL2A1-      ----------catagacaccg----------ccagaacaatattcaacca
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      ----------catagacaccg----------ccagaacaatattcaacca
A0A2Y9LKR0_BCL2A1-      ----------catagacaccg----------ccagaacaatattcaacca
A0A2Y9LKR0_BCL2A1-      ----------catagacaccg----------ccagaacaatattcaacca
A0A2Y9LKR0_BCL2A1-      ----------catagacaccg----------ccagaacaatattcaacca
A0A2Y9LKR0_BCL2A1-      ----------catagacaccg----------ccagaacaatattcaacca
A0A2Y9PZ68_BCL2L1-      cacatcac--cccagggacgg----------catatcagagctttgagca
A0A2Y9P9P5_BCL2-01      cacctgacgcccttcaccgcgaggg------------gacgctttgccac
A0A2Y9LQ01_BCL2L2-      catgtgac--cccaggctcgg----------cccagcaacgcttcaccca
A0A2Y9MRT2_MCL1-01      ---gtaacagcccgggcaaggacggctcactcccctcgacgccgccccca
                                                                          

A0A2Y9LKR0_BCL2A1-      agtgatggaaagggaatttgaagatggcatcgttaactggggaag-----
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      agtgatggaaagggaatttgaagatggcatcgttaactggggaag-----
A0A2Y9LKR0_BCL2A1-      agtgatggaaagggaatttgaagatggcatcgttaactggggaag-----
A0A2Y9LKR0_BCL2A1-      agtgatggaaagggaatttgaagatggcatcgttaactggggaag-----
A0A2Y9LKR0_BCL2A1-      agtgatggaaagggaatttgaagatggcatcgttaactggggaag-----
A0A2Y9LKR0_BCL2A1-      agtgatggaaagggaatttgaagatggcatcgttaactggggaag-----
A0A2Y9PZ68_BCL2L1-      ggtagtgaacgaactcttccgggatgg---ggtgaactggggtcg-----
A0A2Y9P9P5_BCL2-01      ggtggtggaggagctcttcagggatgg---agtaaactgggggag-----
A0A2Y9LQ01_BCL2L2-      ggtctctgatgaactcttccaaggggg---gcccaactggggccg-----
A0A2Y9MRT2_MCL1-01      g----cagagg---------aggagga---ggacgagttgtaccggcagt
                                                                          

A0A2Y9LKR0_BCL2A1-      gattgtga-----ccatatttgcatttgaaggcattctcatcaag--aaa
A0A2Y9LKR0_BCL2A1-      ---------------------gcgtctgcgggcgct-----------gag
A0A2Y9LKR0_BCL2A1-      gattgtga-----ccatatttgcatttgaaggcattctcatcaag--aaa
A0A2Y9LKR0_BCL2A1-      gattgtga-----ccatatttgcatttgaaggcattctcatcaag--aaa
A0A2Y9LKR0_BCL2A1-      gattgtga-----ccatatttgcatttgaaggcattctcatcaag--aaa
A0A2Y9LKR0_BCL2A1-      gattgtga-----ccatatttgcatttgaaggcattctcatcaag--aaa
A0A2Y9LKR0_BCL2A1-      gattgtga-----ccatatttgcatttgaaggcattctcatcaag--aaa
A0A2Y9PZ68_BCL2L1-      cattgtgg-----cctttttctccttcggtggggcactgtgcgtggaaag
A0A2Y9P9P5_BCL2-01      gatcgtgg-----ccttctttgagttcggtggggtcatgtgtgtggagag
A0A2Y9LQ01_BCL2L2-      ccttgtgg-----ctttctttgtctttggagccgcgctgtgtgctgagag
A0A2Y9MRT2_MCL1-01      ccctggagattatctctcgatacctccgggagcaggc----------aac
                                                *  *                    * 

A0A2Y9LKR0_BCL2A1-      cttctaggagggcgaattgccccagatgtggacacttacaagga------
A0A2Y9LKR0_BCL2A1-      cgccgaggagcg---gctgcgccag-------------------------
A0A2Y9LKR0_BCL2A1-      cttctaggagggcgaattgccccagatgtggacacttacaagga------
A0A2Y9LKR0_BCL2A1-      cttctaggagggcgaattgccccagatgtggacacttacaagga------
A0A2Y9LKR0_BCL2A1-      cttctaggagggcgaattgccccagatgtggacacttacaagga------
A0A2Y9LKR0_BCL2A1-      cttctaggagggcgaattgccccagatgtggacacttacaagga------
A0A2Y9LKR0_BCL2A1-      cttctaggagggcgaattgccccagatgtggacacttacaagga------
A0A2Y9PZ68_BCL2L1-      cgtagacaagg------------agatgcaggtattggtgagtcggattg
A0A2Y9P9P5_BCL2-01      cgtcaaccggg------------agatgtcccccct--------------
A0A2Y9LQ01_BCL2L2-      tgtcaacaagg------------agatggagccacttgtgggacaagtgc
A0A2Y9MRT2_MCL1-01      cggcaccaagg------------acgcgaagccact----------gggc
                                 *             *                          

A0A2Y9LKR0_BCL2A1-      ----------gatttcctact---------ttgttgcagagttcataacc
A0A2Y9LKR0_BCL2A1-      --------------tcccgcc---------tcttggc-----------cc
A0A2Y9LKR0_BCL2A1-      ----------gatttcctact---------ttgttgcagagttcataacc
A0A2Y9LKR0_BCL2A1-      ----------gatttcctact---------ttgttgcagagttcataacc
A0A2Y9LKR0_BCL2A1-      ----------gatttcctact---------ttgttgcagagttcataacc
A0A2Y9LKR0_BCL2A1-      ----------gatttcctact---------ttgttgcagagttcataacc
A0A2Y9LKR0_BCL2A1-      ----------gatttcctact---------ttgttgcagagttcataacc
A0A2Y9PZ68_BCL2L1-      cagcttggatggccacttacc--------------------tgaatgacc
A0A2Y9P9P5_BCL2-01      ----------ggtggacaaca---------tcg---ccctgtggatgact
A0A2Y9LQ01_BCL2L2-      aggagtggatggtggcctacc---------tggagac---gcggctggcc
A0A2Y9MRT2_MCL1-01      gggtctgg--ggccgccagccggaaagcgttagagaccctgcgacgggtc
                                           *                              

A0A2Y9LKR0_BCL2A1-      aaaaacacaggagaatggata-------------------aggcagaatg
A0A2Y9LKR0_BCL2A1-      agaa----------------------------------------------
A0A2Y9LKR0_BCL2A1-      aaaaacacaggagaatggata-------------------aggcagaatg
A0A2Y9LKR0_BCL2A1-      aaaaacacaggagaatggata-------------------aggcagaatg
A0A2Y9LKR0_BCL2A1-      aaaaacacaggagaatggata-------------------aggcagaatg
A0A2Y9LKR0_BCL2A1-      aaaaacacaggagaatggata-------------------aggcagaatg
A0A2Y9LKR0_BCL2A1-      aaaaacacaggagaatggata-------------------aggcagaatg
A0A2Y9PZ68_BCL2L1-      a------------cctagagc-----------------------------
A0A2Y9P9P5_BCL2-01      gagt---------acctgaac---------------------------cg
A0A2Y9LQ01_BCL2L2-      g------------actggatccaca-------------------gcagcg
A0A2Y9MRT2_MCL1-01      ggggacggtgtgcaacggaaccacgagacggccttccaaggcatgcttcg
                                                                          

A0A2Y9LKR0_BCL2A1-      gaggctggg-----------------------------------------
A0A2Y9LKR0_BCL2A1-      -------ggtgtttacccatagtcaatatcaaaagtccaaaagaatctcc
A0A2Y9LKR0_BCL2A1-      gaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctcc
A0A2Y9LKR0_BCL2A1-      gaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctcc
A0A2Y9LKR0_BCL2A1-      gaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctcc
A0A2Y9LKR0_BCL2A1-      gaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctcc
A0A2Y9LKR0_BCL2A1-      gaggctgggtgtttacccatagtcaatatcaaaagtccaaaagaatctcc
A0A2Y9PZ68_BCL2L1-      --------------------------------------------------
A0A2Y9P9P5_BCL2-01      acacctg----------------------------------------cac
A0A2Y9LQ01_BCL2L2-      ggggctggg-----------------cg--------------gagttcac
A0A2Y9MRT2_MCL1-01      gaaactgga-----------------catcaaaaacgaagacgatgtcaa
                                                                          

A0A2Y9LKR0_BCL2A1-      -------------------------------aaaatggc----------t
A0A2Y9LKR0_BCL2A1-      atctttctg---------------agcatgcaagatgaa----------a
A0A2Y9LKR0_BCL2A1-      atctttctg---------------agcatgcaagatgaa----------a
A0A2Y9LKR0_BCL2A1-      atctttctg---------------agcatgcaagatgaa----------a
A0A2Y9LKR0_BCL2A1-      atctttctg---------------agcatgcaagatgaa----------a
A0A2Y9LKR0_BCL2A1-      atctttctg---------------agcatgcaagatgaa----------a
A0A2Y9LKR0_BCL2A1-      atctttctg---------------agcatgcaagatgaa----------a
A0A2Y9PZ68_BCL2L1-      -cttggatc---------------------caggagaacggcg------g
A0A2Y9P9P5_BCL2-01      acctggatc---------------------caggataacggag------g
A0A2Y9LQ01_BCL2L2-      agctctata---------------------cggg--gacggggc-----c
A0A2Y9MRT2_MCL1-01      atctttgtctcgagtgatggtccatgttttcagt--gacggagtaacaaa
                                                                          

A0A2Y9LKR0_BCL2A1-      ttg----------------taaag----------aagttt------gaac
A0A2Y9LKR0_BCL2A1-      ttgagacagaagagatcatcaagg----------acattttccaacaagg
A0A2Y9LKR0_BCL2A1-      ttgagacagaagagatcatcaagg----------acattttccaacaagg
A0A2Y9LKR0_BCL2A1-      ttgagacagaagagatcatcaagg----------acattttccaacaagg
A0A2Y9LKR0_BCL2A1-      ttgagacagaagagatcatcaagg----------acattttccaacaagg
A0A2Y9LKR0_BCL2A1-      ttgagacagaagagatcatcaagg----------acattttccaacaagg
A0A2Y9LKR0_BCL2A1-      ttgagacagaagagatcatcaagg----------acattttccaacaagg
A0A2Y9PZ68_BCL2L1-      ctgggac---------------------------actttcgtgg------
A0A2Y9P9P5_BCL2-01      ctgggat---------------------------gcctttgtgg------
A0A2Y9LQ01_BCL2L2-      ctggaggaggcgcg--------------------gcgtctgcgg------
A0A2Y9MRT2_MCL1-01      ctggggcaggattgtgactctcatttcttttggtgcctttgtggccaaac
                         **                                  *            

A0A2Y9LKR0_BCL2A1-      ccaagtctggctg-------gctgacttttctgga--agttac-------
A0A2Y9LKR0_BCL2A1-      caaaacctgctttatcccacggtaccagttccagagcaatcacatggata
A0A2Y9LKR0_BCL2A1-      caaaacctgctttatcccacggtaccagttccagagcaatcacatggata
A0A2Y9LKR0_BCL2A1-      caaaacctgctttatcccacggtaccagttccagagcaatcacatggata
A0A2Y9LKR0_BCL2A1-      caaaacctgctttatcccacggtaccagttccagagcaatcacatggata
A0A2Y9LKR0_BCL2A1-      caaaacctgctttatcccacggtaccagttccagagcaatcacatggata
A0A2Y9LKR0_BCL2A1-      caaaacctgctttatcccacggtaccagttccagagcaatcacatggata
A0A2Y9PZ68_BCL2L1-      -----------------------aactctatgggaaca-----atg----
A0A2Y9P9P5_BCL2-01      -----------------------agctgtacggtccc---agcatg----
A0A2Y9LQ01_BCL2L2-      -----------------gaggggaactg----------------------
A0A2Y9MRT2_MCL1-01      acttgaagagtataaaccaagaaagctgcatcgaaccattagcaga----
                                                 *                        

A0A2Y9LKR0_BCL2A1-      -------------------------------aggaaaga-----------
A0A2Y9LKR0_BCL2A1-      tggtgaaattagcatcg----------cctgaggaaatc-----------
A0A2Y9LKR0_BCL2A1-      tggtgaaattagcatcg----------cctgaggaaatc-----------
A0A2Y9LKR0_BCL2A1-      tggtgaaattagcatcg----------cctgaggaaatc-----------
A0A2Y9LKR0_BCL2A1-      tggtgaaattagcatcg----------cctgaggaaatc-----------
A0A2Y9LKR0_BCL2A1-      tggtgaaattagcatcg----------cctgaggaaatc-----------
A0A2Y9LKR0_BCL2A1-      tggtgaaattagcatcg----------cctgaggaaatc-----------
A0A2Y9PZ68_BCL2L1-      ---------cagcagcc-------------gagagccgg-----------
A0A2Y9P9P5_BCL2-01      ---------cggcctct-----------gt--------------------
A0A2Y9LQ01_BCL2L2-      ----------ggcctca-----------gtgaggacag------------
A0A2Y9MRT2_MCL1-01      ---------aagcatcacagatgttctcgtaaggacaaaacgagactggc
                                                                          

A0A2Y9LKR0_BCL2A1-      ----------------------------tctg------------------
A0A2Y9LKR0_BCL2A1-      ----------------------------tcttcacttcccaa-----aac
A0A2Y9LKR0_BCL2A1-      ----------------------------tcttcacttcccaa-----aac
A0A2Y9LKR0_BCL2A1-      ----------------------------tcttcacttcccaa-----aac
A0A2Y9LKR0_BCL2A1-      ----------------------------tcttcacttcccaa-----aac
A0A2Y9LKR0_BCL2A1-      ----------------------------tcttcacttcccaa-----aac
A0A2Y9LKR0_BCL2A1-      ----------------------------tcttcacttcccaa-----aac
A0A2Y9PZ68_BCL2L1-      -----------------------------------------------aag
A0A2Y9P9P5_BCL2-01      ------------------------------ttgatttctcct-----ggc
A0A2Y9LQ01_BCL2L2-      ----------------------------tgctgac------------ggg
A0A2Y9MRT2_MCL1-01      tagtcaaacaaagaggctgggatgggtttgtggacttcttccatgtagag
                                                                          

A0A2Y9LKR0_BCL2A1-      ----tgaaatat---------------ta---------------------
A0A2Y9LKR0_BCL2A1-      atcctggaatat---------------tcatcagcccagtgaggtcgagg
A0A2Y9LKR0_BCL2A1-      atcctggaatat---------------tcatcagcccagtgaggtcgagg
A0A2Y9LKR0_BCL2A1-      atcctggaatat---------------tcatcagcccagtgaggtcgagg
A0A2Y9LKR0_BCL2A1-      atcctggaatat---------------tcatcagcccagtgaggtcgagg
A0A2Y9LKR0_BCL2A1-      atcctggaatat---------------tcatcagcccagtgaggtcgagg
A0A2Y9LKR0_BCL2A1-      atcctggaatat---------------tcatcagcccagtgaggtcgagg
A0A2Y9PZ68_BCL2L1-      ggccaggagcgcttcaaccgctggttcctgacgggcatg---actgtggc
A0A2Y9P9P5_BCL2-01      tgtct----------------------ctgaaggcactgctcagtctggc
A0A2Y9LQ01_BCL2L2-      ggcc------gtggca-----------ctgggggccctggtaact-----
A0A2Y9MRT2_MCL1-01      gacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgc
                                                                          

A0A2Y9LKR0_BCL2A1-      ----------------------tgtctcctga------------------
A0A2Y9LKR0_BCL2A1-      ttcgggag-------gaggccttgtccacagg-----------ttctctg
A0A2Y9LKR0_BCL2A1-      ttcgggag-------gaggccttgtccacagggggacttgatctcatctt
A0A2Y9LKR0_BCL2A1-      ttcgggag-------gaggccttgtccacagg-----------ttctctg
A0A2Y9LKR0_BCL2A1-      ttcgggag-------gaggccttgtccacagg-----------ttctctg
A0A2Y9LKR0_BCL2A1-      ttcgggag-------gaggccttgtccacagg-----------ttctctg
A0A2Y9LKR0_BCL2A1-      ttcgggag-------gaggccttgtccacag-------------------
A0A2Y9PZ68_BCL2L1-      tggcgtggttctgctgggctcgctc-------------------------
A0A2Y9P9P5_BCL2-01      cctggtgg-------gagcttgcatcaccctg--------------ggtg
A0A2Y9LQ01_BCL2L2-      ----gtag-------gggccttttt-----------------------tg
A0A2Y9MRT2_MCL1-01      cggagtag-------gagctggttt-----------------------gg
                                                                          

A0A2Y9LKR0_BCL2A1-      ------agcagt------------actattga------------------
A0A2Y9LKR0_BCL2A1-      ctttccagcact------------acaagtgaacctgtagagatgag---
A0A2Y9LKR0_BCL2A1-      catgccgggtcttgggtttgacaaacacggcaaccgtttggggcggggca
A0A2Y9LKR0_BCL2A1-      ctttccagcact------------acaagtgaacctgtagagatgag---
A0A2Y9LKR0_BCL2A1-      ctttccagcact------------acaagtgaacctgtagagatgag---
A0A2Y9LKR0_BCL2A1-      ctttccagcact------------acaagtgaacctgtagagatgag---
A0A2Y9LKR0_BCL2A1-      -----------c------------aca-----------------------
A0A2Y9PZ68_BCL2L1-      -----ttcagtc------------ggaaatga------------------
A0A2Y9P9P5_BCL2-01      cctatctgggcc------------ataagtga------------------
A0A2Y9LQ01_BCL2L2-      -----ctag----------------caagtga------------------
A0A2Y9MRT2_MCL1-01      cgtatctaa----------------taagatag-----------------
                                                                          

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      -agtctgccaggttttctatcacagttttactggcctcatgaaacgagtt
A0A2Y9LKR0_BCL2A1-      agggctactacgatgcctacc-----------------------tgaagc
A0A2Y9LKR0_BCL2A1-      -agtctgccaggt-------------------------------------
A0A2Y9LKR0_BCL2A1-      -agtctgccaggctgac---------------------------ccagtt
A0A2Y9LKR0_BCL2A1-      -agtctgccaggttttctatcacagttttactggcctcatgaaacgagtt
A0A2Y9LKR0_BCL2A1-      --------caggctttct--------------------------ctagtt
A0A2Y9PZ68_BCL2L1-      --------------------------------------------------
A0A2Y9P9P5_BCL2-01      --------------------------------------------------
A0A2Y9LQ01_BCL2L2-      --------------------------------------------------
A0A2Y9MRT2_MCL1-01      --------------------------------------------------
                                                                          

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      ggcattctttggacccggacttggaatttt----------ctttctgtgt
A0A2Y9LKR0_BCL2A1-      gctgtctgcagtcccaggatgtgaggccctacaccctggccttggctttc
A0A2Y9LKR0_BCL2A1-      ---------------------ggaatcatc----------catttcatat
A0A2Y9LKR0_BCL2A1-      gaaagttgtaacagctgga--ggaatctct----------gttcgtctac
A0A2Y9LKR0_BCL2A1-      ggcattctttggacccggacttggaatttt----------ctttctgtgt
A0A2Y9LKR0_BCL2A1-      g-------------------------------------------------
A0A2Y9PZ68_BCL2L1-      --------------------------------------------------
A0A2Y9P9P5_BCL2-01      --------------------------------------------------
A0A2Y9LQ01_BCL2L2-      --------------------------------------------------
A0A2Y9MRT2_MCL1-01      --------------------------------------------------
                                                                          

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      taagagcacacgtggccagaagagtggtcttctgcccagtctggaagctt
A0A2Y9LKR0_BCL2A1-      aaagagcagatttgccttcagg-----------tccccgtggatgaaaat
A0A2Y9LKR0_BCL2A1-      ccacccccaccccg-------------------ccccactt---actgcc
A0A2Y9LKR0_BCL2A1-      tcagaccagaactgggc----------------tcccactcgtgagtagt
A0A2Y9LKR0_BCL2A1-      taagagcacacgtggccagaagagtggtcttctgcccagtctggaagctt
A0A2Y9LKR0_BCL2A1-      -------------------------------------------------c
A0A2Y9PZ68_BCL2L1-      --------------------------------------------------
A0A2Y9P9P5_BCL2-01      --------------------------------------------------
A0A2Y9LQ01_BCL2L2-      --------------------------------------------------
A0A2Y9MRT2_MCL1-01      --------------------------------------------------
                                                                          

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      ggccagaggaactggtgttcttgtgtaatgagatcatctttcaaaagtac
A0A2Y9LKR0_BCL2A1-      gacatga-aggtagatga--------------------------------
A0A2Y9LKR0_BCL2A1-      agccagaaaaatggg-----------------------------------
A0A2Y9LKR0_BCL2A1-      gcc--aacaaatgtgtcacttcccatttccttaaaaagctcccaaactcg
A0A2Y9LKR0_BCL2A1-      ggccagaggaactggtgttcttgtgtaatgagatcatctttcaaaagtac
A0A2Y9LKR0_BCL2A1-      ggc-----gagcgggtga--------------------------------
A0A2Y9PZ68_BCL2L1-      --------------------------------------------------
A0A2Y9P9P5_BCL2-01      --------------------------------------------------
A0A2Y9LQ01_BCL2L2-      --------------------------------------------------
A0A2Y9MRT2_MCL1-01      --------------------------------------------------
                                                                          

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      cagacggtttttcgtccttctcacccaaacgcaacgtttcctggcagcca
A0A2Y9LKR0_BCL2A1-      ---------------------------------agtgctttacgaagact
A0A2Y9LKR0_BCL2A1-      -------------------------------------------------a
A0A2Y9LKR0_BCL2A1-      ggcacagtttatagtcttgct----------tcacttctgctggagg--a
A0A2Y9LKR0_BCL2A1-      cagacggtttttcgtccttctcacccaaacgcaacgtttcctggcagcca
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9PZ68_BCL2L1-      --------------------------------------------------
A0A2Y9P9P5_BCL2-01      --------------------------------------------------
A0A2Y9LQ01_BCL2L2-      --------------------------------------------------
A0A2Y9MRT2_MCL1-01      --------------------------------------------------
                                                                          

A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9LKR0_BCL2A1-      ttccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaagt
A0A2Y9LKR0_BCL2A1-      cctcagcatcttaa------------------------------------
A0A2Y9LKR0_BCL2A1-      acttaccccctga-------------------------------------
A0A2Y9LKR0_BCL2A1-      gttcactacggcagattcaagctggggaaat-------------------
A0A2Y9LKR0_BCL2A1-      ttccaccaccaaagtgccaggaaaggggactacaaatgcctcctaaaagt
A0A2Y9LKR0_BCL2A1-      --------------------------------------------------
A0A2Y9PZ68_BCL2L1-      --------------------------------------------------
A0A2Y9P9P5_BCL2-01      --------------------------------------------------
A0A2Y9LQ01_BCL2L2-      --------------------------------------------------
A0A2Y9MRT2_MCL1-01      --------------------------------------------------
                                                                          

A0A2Y9LKR0_BCL2A1-      ---------
A0A2Y9LKR0_BCL2A1-      acaggatag
A0A2Y9LKR0_BCL2A1-      ---------
A0A2Y9LKR0_BCL2A1-      ---------
A0A2Y9LKR0_BCL2A1-      ---tgctaa
A0A2Y9LKR0_BCL2A1-      acaggatag
A0A2Y9LKR0_BCL2A1-      ---------
A0A2Y9PZ68_BCL2L1-      ---------
A0A2Y9P9P5_BCL2-01      ---------
A0A2Y9LQ01_BCL2L2-      ---------
A0A2Y9MRT2_MCL1-01      ---------
                                 

© 1998-2020Legal notice