Dataset for CDS MCL-1 of organism Sinocyclocheilus grahami

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672KMK1_MCL1-01      atgttccctgggagtaaagtttcaaacgacagcggcttttggccatgcat
A0A672RP45_MCL1-02      atgt------ggagcgca-tttta-------------------cgtgc--
A0A672RP45_MCL1-01      atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcat
A0A672RP45_MCL1-03      atgttccctgggagtaaagttttaaacgacaaaggcttttggccatgcat
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      ---------gtccagaagccggcccgtgtg---aggggaggagtttcggg
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      atgtcactgagccccgcattaccccgtgagtcagagggtgaagcttcagt

A0A672KMK1_MCL1-01      tggaatagcagctcttaacgtcaacaacagctcgagcgggtttggtcgca
A0A672RP45_MCL1-02      -ggaa--------cctgat--------cagctcgggcgggctgggtcgca
A0A672RP45_MCL1-01      tggaataacagctcttaatgtcaacagcagctcgggcgggctgggtcgca
A0A672RP45_MCL1-03      tggaataacagctcttaatgtcaacagcagctcgggcgggctgggtcgca
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      g---------------------------------------aaatccgtga
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      gctttcacacacgactaatctgagctcagcgctcgctctcacagcttgca

A0A672KMK1_MCL1-01      agccacttgtaatgccagaactgaaagcccagaaccagttcacagggaac
A0A672RP45_MCL1-02      agccactggtaatgccagaactgaaaccccagaaccagtttacagggaac
A0A672RP45_MCL1-01      agccactggtaatgccagaactgaaaccccagaaccagtttacagggaac
A0A672RP45_MCL1-03      agccactggtaatgccagaactgaaaccccagaaccagtttacagggaac
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      cgcagcacgcagcacgcagc------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      cgcagcacgcagcacgcagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

A0A672KMK1_MCL1-01      ggtctccagggctcggtaccatcctcgcctgagacggactgcgaggaaat
A0A672RP45_MCL1-02      ggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagt
A0A672RP45_MCL1-01      ggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagt
A0A672RP45_MCL1-03      ggactccagggctcggtaccatcctcgcctgagccggattgcgaggaagt
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      ---------------------------------------------accac
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      nnnnnnnnnnnnnnnntcgtttccgcggcggacggatctctaccgagcac

A0A672KMK1_MCL1-01      ---agatgattacacctccatctacgccgccctggaaatggacacgcgag
A0A672RP45_MCL1-02      acaagatgaatacacgtccatctacgacgccctggaaatggacacacgag
A0A672RP45_MCL1-01      acaagatgaatacacgtccatctacgacgccctggaaatggacacacgag
A0A672RP45_MCL1-03      acaagatgaatacacgtccatctacgacgccctggaaatggacacacgag
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      accggacccgcaggagctcggttccgccgaactggaccgcgacacgagac
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      accggacccgcaggagctcggttccgccgaactggaccgcgacacgagac

A0A672KMK1_MCL1-01      agattattgacgctttcttaaaaagctttacaggactccctcattctaaa
A0A672RP45_MCL1-02      agattattgacattttcttaaaaaacgttactggattccctcattctaaa
A0A672RP45_MCL1-01      agattattgacattttcttaaaaaacgttactggattccctcattctaaa
A0A672RP45_MCL1-03      agattattgacattttcttaaaaaacgttactggattccctcattctaaa
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      agctcttgctggacttctaccgcacgcgcaccggaatgtgtccgcgggac
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      agctcttgctggacttctaccgcacgcgcaccggaatgtgtccgcgggac

A0A672KMK1_MCL1-01      agtgaaaaaacccaggttctgtctacgatgaagcgggttgtggacagtct
A0A672RP45_MCL1-02      agtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtct
A0A672RP45_MCL1-01      agtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtct
A0A672RP45_MCL1-03      agtgggaataaacaggttctggcaacgatgaatcgggttgtggaaagtct
A0A672KAT0_MCL1-01      ---------cctgatgatccgacgatagctgctcgcatctcagcttgtct
A0A672PT04_MCL1-02      cggaagctgcatcacgcgctaccgacggtgactcgcgttgtcgcggacgt
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      cggaagctgcatcacgcgctaccgacggtgactcgcgttgtcgcggacgt

A0A672KMK1_MCL1-01      cgcggtgaagcacgaactggcttacaaaggtatgattgcacggctgaatc
A0A672RP45_MCL1-02      tgtgatgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
A0A672RP45_MCL1-01      tgtgatgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
A0A672RP45_MCL1-03      tgtgatgaagcacgaactggcttacaaaggtatgattgcacgtctgaatc
A0A672KAT0_MCL1-01      at------------atatattttctgcagggatgctgcagcgtctgcagc
A0A672PT04_MCL1-02      tctcgtgaagcacgagatcgcgtacaaaggaatgctgcagcgtctgcagc
A0A672K136_MCL1-01      -------------------------------atgctgcagcgtctgcagc
A0A672PT04_MCL1-01      tctcgtgaagcacgagatcgcgtacaaaggaatgctgcagcgtctgcagc
                                                       *** *    ** *** * *

A0A672KMK1_MCL1-01      tggagcagaaaggagaagatgtgagttttgtcaagactgtggcaacagaa
A0A672RP45_MCL1-02      tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacagaa
A0A672RP45_MCL1-01      tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacagaa
A0A672RP45_MCL1-03      tggagcagaaaggagaagatgtgagtttcgtcaagactgtggcaacagaa
A0A672KAT0_MCL1-01      tggactctcagccggacgacttgagcttcatcggctgtatagcaaagacg
A0A672PT04_MCL1-02      tggaatctcaagcggacgacatgagcttcatcggctgtatagcagagact
A0A672K136_MCL1-01      tggaatctcaagcggacgacatgagcttcatcggctgtatagcagagact
A0A672PT04_MCL1-01      tggaatctcaagcggacgacatgagcttcatcggctgtatagcagagact
                        ****     *    ** **  **** **  **     * * ***      

A0A672KMK1_MCL1-01      ctcttcagcgatggcatcacaaactgggggcgcatttgcagcctgctgac
A0A672RP45_MCL1-02      gtcttcagcgatggcatcacaaactggggtcgcattgccagcctgcttgc
A0A672RP45_MCL1-01      gtcttcagcgatggcatcacaaactggggtcgcattgccagcctgcttgc
A0A672RP45_MCL1-03      gtcttcagcgatggcatcacaaactggggtcgcattgccagcctgcttgc
A0A672KAT0_MCL1-01      atgttcagagatgacaccactaactggggccgggtcgtgagtctggtggc
A0A672PT04_MCL1-02      atgttcaacgacaacaccaccaactggggccggatcgtgagtctggtggc
A0A672K136_MCL1-01      atgttcaacgacaacaccaccaactggggccggatcgtgagtctggtggc
A0A672PT04_MCL1-01      atgttcaacgacaacaccaccaactggggccggatcgtgagtctggtggc
                         * ****  **   ** *** ******** **  *    ** *** *  *

A0A672KMK1_MCL1-01      ttttggggcaatggtatgcaagcatcaaaatga----tagaggacttggc
A0A672RP45_MCL1-02      ttttggggcagtggtatgcaagcatcagaatga----taaaggacttagc
A0A672RP45_MCL1-01      ttttggggcagtggtatgcaagcatcagaatga----taaaggacttagc
A0A672RP45_MCL1-03      ttttggggcagtggtatgcaagcatcagaatga----taaaggacttagc
A0A672KAT0_MCL1-01      cttcggagctgtggtgtgctcacagctgaaggagctgcagaggg---agc
A0A672PT04_MCL1-02      cttcggggccgtggtgtgctcgcgtctgaaagagctgcagaggg---agc
A0A672K136_MCL1-01      cttcggggccgtggtgtgctcgcgtctgaaagagctgcagaggg---agc
A0A672PT04_MCL1-01      cttcggggccgtggtgtgctcgcgtctgaaagagctgcagaggg---agc
                         ** ** **  **** ***   *  *  ** **     * ***     **

A0A672KMK1_MCL1-01      aagtgtgtgagtctggtgggggaagagatctcttcctatcttctcacaga
A0A672RP45_MCL1-02      aagtgtgtgagtctggtggggaaagagatctcttcctatcttctcacaac
A0A672RP45_MCL1-01      aagtgtgtgagtctggtggggaaagagatctcttcctatcttctcacaac
A0A672RP45_MCL1-03      aagtgtgtgagtctggtggggaaagagatctcttcctatcttctcacaac
A0A672KAT0_MCL1-01      -ggtgcgtggagacggtggcccagctgatctcctcttatctgatctcaga
A0A672PT04_MCL1-02      -ggtgcgtggagacggtggcccagcagatctcctcctatctgatctccga
A0A672K136_MCL1-01      -ggtgcgtggagacggtggcccagcagatctcctcctatctgatctccga
A0A672PT04_MCL1-01      -ggtgcgtggagacggtggcccagcagatctcctcctatctgatctccga
                          *** ***     *****   *   ****** ** *****  ** *   

A0A672KMK1_MCL1-01      ccaacgggactggctgctcaaaaacaaagcatgggatggctttgtggaat
A0A672RP45_MCL1-02      ccagcgggactggctgctcaaaaacaatgcatgggatggctttgtggaat
A0A672RP45_MCL1-01      ccagcgggactggctgctcaaaaacaatgcatgggatggctttgtggaat
A0A672RP45_MCL1-03      ccagcgggactggctgctcaaaaacaatgcatgggatggctttgtggaat
A0A672KAT0_MCL1-01      acagcacgactggctgctcaataacaagggctggcatgggttcgtggcgt
A0A672PT04_MCL1-02      tcagcacgactggctgctcaacaacaagggctggcatggattcgtggagt
A0A672K136_MCL1-01      tcagcacgactggctgctcaacaacaagggctggcatggattcgtggagt
A0A672PT04_MCL1-01      tcagcacgactggctgctcaacaacaagggctggcatggattcgtggagt
                         ** *  ************** ***** *  *** **** ** ****  *

A0A672KMK1_MCL1-01      tttttcatgtcccggatacagaggcaactatgagaaacacattgatggcc
A0A672RP45_MCL1-02      tttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggcc
A0A672RP45_MCL1-01      tttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggcc
A0A672RP45_MCL1-03      tttttcatgtcccaaatacagaagcggctgtgagaaacacattgatggcc
A0A672KAT0_MCL1-01      tcttccgcgtggaggacatggagtctgtggttcgcagcgctctgatggct
A0A672PT04_MCL1-02      ttttccgcgtggaggatgtggagtctgtgattcgtaatgctttgatggct
A0A672K136_MCL1-01      ttttccgcgtggaggatgtggagtctgtgattcgtaatgctttgatggct
A0A672PT04_MCL1-01      ttttccgcgtggaggatgtggagtctgtgattcgtaatgctttgatggct
                        * ** *  **     *    **  *     *  * *   *  ******* 

A0A672KMK1_MCL1-01      attggtggtgtggcaacattcggagctgctcttgcttatatgatacggtg
A0A672RP45_MCL1-02      attggcagtgtggctacatttggagctgcacttgcttatttgatacggtg
A0A672RP45_MCL1-01      attggcagtgtggctacatttggagctgcacttgcttatttgatacggtg
A0A672RP45_MCL1-03      attggcagtgtggctacatttggagctgcacttgcttatttgatacggtc
A0A672KAT0_MCL1-01      gttgtgggatgtgctgggatcggcgccggtctcgctctcctgatccgatg
A0A672PT04_MCL1-02      gtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtg
A0A672K136_MCL1-01      gtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtg
A0A672PT04_MCL1-01      gtggtgggatgcgctgggatcggcgccggtctcgctttcctgatccggtg
                         * *   *    **     * ** ** *  ** ***    **** ** * 

A0A672KMK1_MCL1-01      a-------------------------------------------------
A0A672RP45_MCL1-02      a-------------------------------------------------
A0A672RP45_MCL1-01      a-------------------------------------------------
A0A672RP45_MCL1-03      atccgtggggtctaatgaggactatggtaatgacacacacagggcctcac
A0A672KAT0_MCL1-01      a-------------------------------------------------
A0A672PT04_MCL1-02      a-------------------------------------------------
A0A672K136_MCL1-01      a-------------------------------------------------
A0A672PT04_MCL1-01      a-------------------------------------------------

A0A672KMK1_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      ctgatcctccagctcactgctgcaacacctgctgtggttacctgagccag
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------

A0A672KMK1_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-02      --------------------------------------------------
A0A672RP45_MCL1-01      --------------------------------------------------
A0A672RP45_MCL1-03      gcggcacatggctgttatactcagtggaatacaagtaaagccatgcgaca
A0A672KAT0_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-02      --------------------------------------------------
A0A672K136_MCL1-01      --------------------------------------------------
A0A672PT04_MCL1-01      --------------------------------------------------

A0A672KMK1_MCL1-01      -------------------------------------
A0A672RP45_MCL1-02      -------------------------------------
A0A672RP45_MCL1-01      -------------------------------------
A0A672RP45_MCL1-03      gtacatgtcaagtcaagtcaagtcaccttttatatag
A0A672KAT0_MCL1-01      -------------------------------------
A0A672PT04_MCL1-02      -------------------------------------
A0A672K136_MCL1-01      -------------------------------------
A0A672PT04_MCL1-01      -------------------------------------

© 1998-2021Legal notice