Dataset for CDS BCL-2-like of organism Bos mutus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|L8HP19_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Bos mutus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|L8HP19_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos mutus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|L8IZT5_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Bos mutus GN=BCL2A1 (length=528 residues).
atgactgacactgagtttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaatatccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggcaagtg
tattgcctcagacatggacatgtgcaaggacatttcttactttgtggcggagttcatcaccgaaaatacaggagagtgga
taaagcaaaatggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgcctgaagcaatactattga
>gnl|bcl2dbcds|L8J061_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
© 1998-2020Legal notice