Dataset for CDS BCL-2-like of organism Bos mutus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

L8IZT5_BCL2A1-01      atgactgacactgagtttggctacg--ttcacggg--ctggctgaggact
L8HP19_BCL2L2-01      atggcgaccccagcctcggccccaga-cacacgggctctagtggcagact
L8HP19_BCL2L2-02      atggcgaccccagcctcggccccaga-cacacgggctctagtggcagact
L8J061_BCL2L1-01      at----------------gtctcagagtaaccgggagctggtggttgact
                      **                * *   *      ****  ** *  *  ****

L8IZT5_BCL2A1-01      atctgaaatatgtgttg---cagatacagcaa------------------
L8HP19_BCL2L2-01      ttgtgggctataagctgaggcagaaggggtat-----------gtt----
L8HP19_BCL2L2-02      ttgtgggctataagctgaggcagaaggggtat-----------gtt----
L8J061_BCL2L1-01      ttctctcttacaagctttcccagaaaggatacagctggagtcagtttagt
                       * *    **   * *    ****      *                   

L8IZT5_BCL2A1-01      --cctggatccaagccaagcaaaatatccagg------------------
L8HP19_BCL2L2-01      --tgtggag-----------------------------------------
L8HP19_BCL2L2-02      --tgtggag-----------------------------------------
L8J061_BCL2L1-01      gatgtggaagagaacagaactgaggccccagaagggacagaatcagatat

L8IZT5_BCL2A1-01      ---------------------------------gtgttacaag--atgtg
L8HP19_BCL2L2-01      ---------------------------------ctggccccgg--ggagg
L8HP19_BCL2L2-02      ---------------------------------ctggccccgg--ggagg
L8J061_BCL2L1-01      ggaaacccccagtgccatcaatggcaacgcatcctggcacctggcggata
                                                        **   *  *       

L8IZT5_BCL2A1-01      gctt--------------cctctgtcca------------ggacgaagtg
L8HP19_BCL2L2-01      gccc------------agcagctgacc-----------------------
L8HP19_BCL2L2-02      gccc------------agcagctgacc-----------------------
L8J061_BCL2L1-01      gccctgctgtgaatggagccactggccacagcagaagctcggatgcccgg
                      **                *  *** **                       

L8IZT5_BCL2A1-01      gaaagga------------ctctgaagcagtgcttg------------ga
L8HP19_BCL2L2-01      -------------------cgctacaccaagccatgcgggcagctggaga
L8HP19_BCL2L2-02      -------------------cgctacaccaagccatgcgggcagctggaga
L8J061_BCL2L1-01      gaagtgatccccatggcagcggtgaagcaagccctgagggaggcaggcga
                                         *  *  * **   * **            **

L8IZT5_BCL2A1-01      taagtttga--tgtggtgtccgtagacact--------------------
L8HP19_BCL2L2-01      tgagttcgagacccgcttccggcgcaccttctccgatctggcagctcagc
L8HP19_BCL2L2-02      tgagttcgagacccgcttccggcgcaccttctccgatctggcagctcagc
L8J061_BCL2L1-01      tgagtttgaactgaggtaccgacgggcattcagcgacctgacgtcccagc
                      * **** **     * *  *      *  *                    

L8IZT5_BCL2A1-01      ----------------gccagaacaata----ttcaaccaagtgatggaa
L8HP19_BCL2L2-01      tgcatgtgaccccgggctcggcccagcaacgcttcacccaggtctctgat
L8HP19_BCL2L2-02      tgcatgtgaccccgggctcggcccagcaacgcttcacccaggtctctgat
L8J061_BCL2L1-01      tccacatcaccccagggacagcatatcagagctttgaacaggtagtgaat
                                        * *   *  *    **    ** **     * 

L8IZT5_BCL2A1-01      aaggaatttgaagatggcattgttaactggggcaggattgtaaccatatt
L8HP19_BCL2L2-01      gaactcttccaagggggc---cccaactggggccgccttgtggccttctt
L8HP19_BCL2L2-02      gaactcttccaagggggc---cccaactggggccgccttgtggccttctt
L8J061_BCL2L1-01      gaactcttccgggacggg---gtgaactggggtcgcattgtggccttttt
                       *    **    *  **       ********  *  ****  ** * **

L8IZT5_BCL2A1-01      cgcctttgaaggtattcttaccaagaaacttctgggcaagtgtattgcct
L8HP19_BCL2L2-01      tgtctttggagccgcgttgtgtgctgagagtgtcaacaagg---------
L8HP19_BCL2L2-02      tgtctttggagccgcgttgtgtgctgagagtgtcaacaagg---------
L8J061_BCL2L1-01      ctccttcggtggggcactgtgcgtggaaagcgtagacaagg---------
                         *** *  *      *        *     *   ****          

L8IZT5_BCL2A1-01      cagacatggacatgtgcaaggacatttcttactttg-tggcggagttcat
L8HP19_BCL2L2-01      -agatggagccacttgtgggacaagtgcaggagtggatggtggcctacct
L8HP19_BCL2L2-02      -agatggagccacttgtgggacaagtgcaggagtggatggtggcctacct
L8J061_BCL2L1-01      -agatgcaggtattggtgagtcggatcgcaacttggatggccacttacct
                       ***    *  *   *   *     *       * * ***     * * *

L8IZT5_BCL2A1-01      caccgaaaatacaggagagtggataaagcaaaatggaggctgggaaa---
L8HP19_BCL2L2-01      ggagacgaggctggctgactggatccacagcagtgggggctgggcggagt
L8HP19_BCL2L2-02      ggagacgaggctggctgactggatccacagcagtgggggctgggcggagt
L8J061_BCL2L1-01      gaatgaccacctagagccttggatccaggagaacggcggctgggacactt
                                   *     *****  *    *  ** *******      

L8IZT5_BCL2A1-01      --atgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttc
L8HP19_BCL2L2-01      tcacagctctatacggggacggggccctggaggaggc--gcggcgtctgc
L8HP19_BCL2L2-02      tcacagctctatacggggacggggccctggaggaggc--gcggcgtctgc
L8J061_BCL2L1-01      ttgtggaactctacgggaacaatgc-----agcagcc--gaga-----gc
                           *   * **  *              *   * *  *         *

L8IZT5_BCL2A1-01      tggaagttacaggaaagatc-----------------------tgtgaaa
L8HP19_BCL2L2-01      gggagggg--aactgggcttcagtgaggacag-----tgctgacggg---
L8HP19_BCL2L2-02      gggagggg--aactgggcttcagtgaggacag-----tgctgacggg---
L8J061_BCL2L1-01      cggaagggccaggagcgcttca------accgctggttcctgacgggcat
                       *** *    *     * *                         * *   

L8IZT5_BCL2A1-01      cattatgtcgcctgaagcaata--------------------------ct
L8HP19_BCL2L2-01      ggctgtggcactgggggccctggtaactgtaggggccttttttgctagca
L8HP19_BCL2L2-02      ggctgtggcactgggggccctggtaactgtaggggccttttttgctagca
L8J061_BCL2L1-01      gactgtggctggtgtggttctg------ctgggctcgctcttcagtcgga
                         * ** *    *  *   *                             

L8IZT5_BCL2A1-01      attga
L8HP19_BCL2L2-01      agtga
L8HP19_BCL2L2-02      agtga
L8J061_BCL2L1-01      aatga
                      * ***

© 1998-2022Legal notice