Dataset for CDS BOK of Organism Amphilophus citrinellus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q0RFY4_BOK-01      atggagatgttgcgccgctcctctgtgtttgcctctgaa---------gt
A0A3Q0S613_BOK-01      atggaagtcctgcgcaagtcatcagtatttgcttcggaggtcttggacgt
                       *****  *  *****   ** ** ** ***** ** **          **

A0A3Q0RFY4_BOK-01      gtttgatcgctcgcccaccgacaaggagctggtgtcccaggccaaagcgc
A0A3Q0S613_BOK-01      gtttgaccgatcgctgactgaaaaggagctggtgtcccagtccaaggcac
                       ****** ** ****  ** ** ****************** **** ** *

A0A3Q0RFY4_BOK-01      tgtgcagggactacatccactccaggctgaaccgggccgggatcggctgg
A0A3Q0S613_BOK-01      tgtgcagagactacatcttgtccagactcacccagaacgggttgggatgg
                       ******* *********   ***** ** * ** *  **** * ** ***

A0A3Q0RFY4_BOK-01      tccaagcctgagcacggactgtctgcgtcaggtgggactctgggagaaat
A0A3Q0S613_BOK-01      tccaaaactgagctcaatttttctccctcgaatgcagcgctggctgaagt
                       *****  ****** *    * *** * **   **   * ****  *** *

A0A3Q0RFY4_BOK-01      atcgtcggtcctgctgtggctgggtgatgagttggagtgccttcgtccca
A0A3Q0S613_BOK-01      gtctatggtgcttctctgtcttggcgatgagctggagtgtatacagccta
                        **   *** ** ** ** ** ** ****** *******  * *  ** *

A0A3Q0RFY4_BOK-01      atgtgtaccgtaacgtcgcccgacagctgaacatcacagtggcgtcggag
A0A3Q0S613_BOK-01      ctttgtacaggaacgtggcgcggcagctcaacatttcagttgccatggag
                        * ***** * ***** ** ** ***** *****  **** **   ****

A0A3Q0RFY4_BOK-01      ggcgtggtgtccgatgccttcctggctgtcgctgcagacattttctccac
A0A3Q0S613_BOK-01      aacatggtttcggatgccttcatcggcgtagcaacagagattttctcagc
                         * **** ** ********* * *  ** **  **** ********  *

A0A3Q0RFY4_BOK-01      aggtgtcacatggggaaaggtggtttccttgtacgctgtggcgggagcct
A0A3Q0S613_BOK-01      aggcataacatggggtaaggtggtgtccatgtatgcagtagctggagccc
                       ***  * ******** ******** *** **** ** ** ** ****** 

A0A3Q0RFY4_BOK-01      tggcggtggactgtgtacgccacggtcatccagcaatggtccataccatt
A0A3Q0S613_BOK-01      tggcagtggactgtgtcagacaaggccatccagccacagtacacatctta
                       **** ***********  * ** ** ******** *  ** ** * * * 

A0A3Q0RFY4_BOK-01      gttgactgcatgggggagtttgtccgcaagagtctgaccgcctggttaaa
A0A3Q0S613_BOK-01      gtggacagtctgggacagtttgtccgcaaattcctggttccctggctgaa
                       ** *** *  ****  *************    ***    ***** * **

A0A3Q0RFY4_BOK-01      aaggagaggaggctgggtggatgtaacgaagtgcgtggtgaacactgacc
A0A3Q0S613_BOK-01      gagacggggagggtgggtaagtatcacaaaatgtgtggtgaagaaggatc
                        **  * ***** *****   * * ** ** ** ******** *  ** *

A0A3Q0RFY4_BOK-01      ccagcttccactctcactggctggtgtctgctgtctgtgccttcgggcac
A0A3Q0S613_BOK-01      ttgctcctgaagaaaactggctgtcatccacctttgagtctctcaaatac
                                *     ********   **  *  *     *  **    **

A0A3Q0RFY4_BOK-01      tacctgaaggcggtcgtgctacacctcctccgggagaagtga
A0A3Q0S613_BOK-01      ttcctgaccacgctatatgtctacatcatgaaggagccgtaa
                       * *****   ** *     *  ** ** *   ****  ** *

© 1998-2020Legal notice